Supplementary Information
Supplementary Information
Methods
Patients. Ethical approval was obtained from the Central Oxford Research Ethics
Committee and skull phenotypes were assessed by plain radiographs, 3D computed
tomography (CT) scanning or magnetic resonance imaging (MRI). No individuals had
radiological manifestations of craniosynostosis or cleidocranial dysplasia, and at least
one affected person from each family had a normal G-banded karyotype. Clinical
examination of families segregating ALX4 mutations (pedigrees in Fig. 1b) did not
demonstrate dysmorphic features or abnormalities of the limbs, abdominal wall, male
genitalia, skin, hair or teeth. Family 1 is British. The proband (IV-1) presented as a
neonate with a midline skull defect (width 8.5 cm at 7 months) and a patent vitellointestinal duct. Bilateral PFM <1 cm width were identified on skull radiography in his
father III-3 (aged 40 y) and great uncle II-1 (aged 69 y), neither of whom were
previously aware of their condition. Individual III-1, the daughter of II-1, was born with
a midline skull defect and had unexplained drop attacks during childhood. A CT brain
scan showed an enlarged cerebrospinal fluid (CSF)-filled space in the posterior fossa.
Family 2 is of Slovakian origin; affection status, compared with the original pedigree7,
was revised in some individuals after skull radiography. ALX4 heterozygotes had
classical PFM, except for an obligate carrier aged 43 y (II-4) with increased bone
thickness only, a boy aged 5 y (IV-5) with abnormal skull modelling and his sister aged
4 months (IV-6) who exhibited mild cranium bifidum. Two individuals had learning
difficulties of unknown cause. Family 3 resides in Spain: a large posterior fontanelle
1
Supplementary Information
was identified in III-6 by prenatal ultrasound and a midline skull defect was confirmed
after birth8. Family 4 resides in Brazil. Apart from benign neonatal convulsions in II-2
and III-2, no additional clinical abnormalities were noted. Individual III-2 manifests
cranium bifidum, as shown in Fig. 2a. CT and MRI brain scanning of individuals I-2, II2 and III-2 demonstrated a wide hiatus of the tentorium cerebelli associated with a large
CSF-filled space, but no cerebellar hypoplasia. Measurements of the size of PFM
(expressed as a percentage of the maximum skull width on PA or AP skull radiograph)
were collated for all cases of known age with an identified mutation in MSX2 or ALX4
(refs 1,2,7,8,16–18).
Exclusion of MSX2 mutations and analysis of linkage to 11p. We excluded
mutations or large deletions of MSX2 in families 1–4 by linkage analysis, detection of
intragenic heterozygosity and sequencing of the coding region as previously described1.
Linkage of chromosome 11p simple sequence repeat polymorphisms including
D11S1393, D11S903, D11S2095 and D11S554 (refs 6,19 and The Genome Database,
http://www.gdb.org) to PFM was examined in families 2 and 3. The phenotype was
considered as autosomal dominant with a mutant allele frequency of 10-5. We defined
three liability classes with different penetrance values in heterozygotes, as follows.
Class 1, affected individuals and normal spouses (penetrance = 1); class 2,
radiologically normal individuals at 50% prior risk (penetrance = 0.8); class 3,
individuals at 25% prior risk, normal by history (penetrance = 0.5). The affection status
of individual IV-5 in family 2 was classed as unknown. Two-point lod scores were
calculated by using MLINK of the FASTLINK package version 4.0P (ref. 20) at the UK
HGMP-RC (http://www.hgmp.mrc.ac.uk).
2
Supplementary Information
Bioinformatics and physical map construction. The GCG package was used for
routine DNA and protein analysis. BLAST searches were carried out locally
(http://www.molbiol.ox.ac.uk) or at NCBI (http://www.ncbi.nlm.nih.gov). An
integrating script performing multiple BLAST queries and running several exon
prediction programs simultaneously (J. Peden, unpublished), aided gene identification in
genomic sequences. Protein databases, interrogated to find conserved elements, included
InterPro (http://www.ebi.ac.uk/interpro) and Pfam
(http://www.sanger.ac.uk/Software/Pfam/index.shtml).
A publicly available resource at Southwestern Medical Center listing genomic clones
covering the EXT2 region (Website discontinued) served as a starting point for map
construction. We assembled PAC clones21 189f14 from RPCI-1 and 366b4, 368b4,
404m15, 511i10 and 526d1 from RPCI-3 (Research Genetics) into a contig using the
existing framework of EXT2 exons22, markers D11S1393, D11S903 and D11S2095, and
end-fragment isolation. The order of markers D11S1393 and D11S578 relative to EXT2
is based on the complete sequence of PAC clone 404m15 and contrasts with a former
mapping4. Cosmid cSRL101h11 (ref. 3) and the RPCI-11 sequence-sampled BAC
clones 70a24 and 706a13 were identified through BLAST searches as matches against
PAC 404m15 and EXT2 exons respectively. We identified three putative genes between
D11S1393 and EXT2: a gene of unknown function represented by the Unigene cluster
Hs. 98649, a human homologue of a Fugu rubripes gene with significant similarity to
the 1-aminocyclopropane-1-carboxylate synthase family from plants23 and a paralogue
or pseudogene related to the latter.
The localization of D11S2095 and size estimates for ALX4 introns 2 and 3 were
based on long-range PCR of PAC clones 526d1 and 511i10 using the Expand Long
Template PCR System (Roche). The mapping of MluI and AscI sites within exon 1,
3
Supplementary Information
followed by inspection of genomic sequences flanking exons 1 and 2, enabled us to
deduce the size of intron 1. The relationship of the ALX4 and EXT2 transcription units
was corroborated by XhoI digestion of clone 526d1: probes corresponding to the
terminal exons of each gene and D11S2095 all detect the same ~18 kb fragment. The 3´
end of ALX4 was further localised by identification of two ESTs (GenBank AW071529
and AW613995) containing a predicted poly(A) signal and mapping ~4 kb downstream
from the termination codon.
Molecular analysis of ALX4. Alignments with mouse Alx4 cDNA and the presence of
canonical splice junctions demarcated human ALX4 exons in genomic sequences. We
demonstrated the mutation in family 2 by amplification and sequencing of a 651 bp
exon 1 product with the primer pairs 5´–GCAAGGAGTGCACAGCCACAGC–3´ and
5´–ACCAGTTTCAAGGGATGCGGAAG–3´; and the mutations in families 1, 3 and 4
by amplification of a 417 bp exon 2 product with the primer pairs 5´–
CCCCCTGACATTCCCCTTCTCTT–3´ and 5´–
GCTTTACCAGCCTCACTCCCAGGT–3´. A full list of primers is provided in Table 1.
Uniform PCR conditions comprised an ammonium buffer (50 mM Tris HCl pH 9.2, 16
mM (NH4)2SO4, 2.25 mM MgCl2, 0.5% Tween 20, 10% dimethylsulfoxide) and
annealing at 60 oC. SSCP analysis was carried out on the PCR products as described24
and sequencing was performed using the BigDye Terminator Cycle Sequencing kit
(Perkin-Elmer) on the ABI 377 Sequencer. Restriction enzymes for mutation
confirmation (loss of PvuII site in family 1, creation of BfaI site in family 2 and loss of
MspI site in families 3 and 4) were obtained from New England Biolabs. Appropriate
allele-specific oligonucleotides detected none of the mutations in a control panel of 48
unrelated north Europeans. We identified eight additional single nucleotide variants that
4
Supplementary Information
we considered to be polymorphisms. The more common allele is listed first with its
frequency in the same control panel in brackets: 104G>C encoding a R35T substitution
(0.52), 304C>T encoding a P102S substitution (0.57), 594C>A (>0.97), 729G>A (0.92),
778-11G>A (0.94), 882C>T (0.93), 1074C>T (0.70), 1464C>T (0.75). The mutated
alleles in families 3 and 4 exhibited different haplotypes for these polymorphisms,
indicating that the two families are unrelated.
cDNA isolation and Northern blot analysis. We reverse-transcribed total RNA from a
normal human fibroblast cell line using M-MLV RT (Promega) and random hexamers.
Amplification of ALX4 from cDNA employed the conditions and exon 1 forward primer
given above, with the reverse primer 5´–ACCTGGCTTTCTCCACTGCCTGT–3´ from
exon 4. This yielded a specific product of ~1.6 kb after 40 cycles which was directly
sequenced. A Real Human Fetal mRNA Blot (Invitrogen) was hybridized in Ultrahyb
buffer (Ambion) with an 32P-dCTP labelled PCR fragment from exon 4 of ALX4
(Megaprime DNA labelling system, Amersham Pharmacia) and washed under high
stringency. An ALX4 transcript was also detected in a human fetal liver mRNA
preparation (Clontech).
In situ hybridization of mouse skull sections. In situ hybridization analysis of normal
mouse embryos using Alx4 (ref. 9) and Spp1 probes was carried out as described15.
Whole mount analysis with antisense probes at E14, E16 and E18 showed no visible
staining (by comparison, the appearance at E10.5 was similar to that in ref. 9). Sections
were cut from fresh frozen tissue, acetylated, fixed and prehybridized. Hybridization
was carried out overnight using digoxygenin labelled probes and immunodetection was
performed using BCIP. The equivalent sense probes gave no significant staining.
5
Supplementary Information
Additionally, expression was observed in the mesenchymal tissue of early hair follicles
and in the meninges, including the falx cerebri and tentorium cerebelli.
References
16.
Preis, S., Engelbrecht, V. & Lenard, H.-G. Aplasia cutis congenita and enlarged
parietal foramina (Catlin marks) in a family. Acta Paediatr. 84, 701–702 (1995).
17.
Wuyts, W. et al. Identification of mutations in the MSX2 homeobox gene in
families affected with foramina parietalia permagna. Hum. Mol. Genet. 9, 1251–
1255 (2000).
18.
Schmidt-Wittkamp, E. & Christians, H. Die Lückenbildungen der Scheitelbeine.
Beobachtungen an 75 Mitgliedern einer Sippe mit gehäuftem Vorkommen von
Foramina parietalia permagna. Fortschr. Geb. Rontgenstr. Nuklearmed. 113, 29–
38 (1970).
19.
Dib, C. et al. A comprehensive genetic map of the human genome based on
5,264 microsatellites. Nature 380, 152–154 (1996).
20.
Cottingham, R.W.J., Idury, R.M. & Schaffer, A.A. (1993) Faster sequential
genetic linkage computations. Am. J. Hum. Genet. 53, 252–263 (1993).
21.
Ioannou, P.A. & de Jong, P.J. Construction of bacterial artificial chromosome
libraries using the modified P1 (PAC) system. in Current Protocols in Human
Genetics (eds Dracopoli, N.C. et al.) 5.15.1–5.15.24 (Wiley, New York, 1996).
22.
Clines, G.A., Ashley, J.A., Shah S. & Lovett, M. The structure of the human
multiple Exostosis 2 gene and characterization of homologs in mouse and
Caenorhabditis elegans. Genome Res. 7, 359–367 (1997).
6
Supplementary Information
23.
Peixoto, B.R., Mikawa, Y. & Brenner, S. Characterization of the recombinase
activating gene-1 and 2 locus in the Japanese pufferfish, Fugu rubripes. Gene
246, 275–283 (2000).
24.
Hayashu, K., Kukita, Y., Inazuka, M. & Tahira T. Single-strand conformation
polymorphism analysis. in Mutation Detection A Practical Approach (eds
Cotton, R.G.H., Edkins, E. & Forrest, S.) 8–24 (IRL Press, Oxford, 1998).
7
Supplementary Information
Tables
Table 1 Oligonucleotides used in characterisation of ALX4 and identification of
mutations and polymorphisms
PCR and Sequencing Primers
Oligonucleotide Sequence
Position & Orientation
5´–GCAAGGAGTGCACAGCCACAGC–3´
Exon 1, 5´ UTR; forward
5´–TAACAAGTTCCAGCCCCAGTCGTC–3´
Exon 1, coding region; forwarda
5´–CGCTGCAAGTAAAGATGCGGTTG–3´
Exon 1, coding region; reverse
5´–ACCAGTTTCAAGGGATGCGGAAG–3´
Intron 1; reverse
5´–CCCCCTGACATTCCCCTTCTCTT–3´
Intron 1; forward
5´–AGCTGGAGGAGCTGGAGAAGGTCT–3´
Exon 2; forward
5´–GTCTGTCCTCATGGCCAGCTGTT–3´
Exon 2; reverse
5´–GCTTTACCAGCCTCACTCCCAGGT–3´
Intron 2; reverse
5´–GGGAACAGTTTGCACTGCCTGAA–3´
Intron 2; forward
5´–CTCCTCCAAGGGGCTCATTCTCA–3´
Intron 3; reverse
5´–GAGCCCCTTCCACACCACACCT–3´
Intron 3; forward
5´–GCCTCAATGGCTACGAGCTCAACG–3´
Exon 4, coding region; forward
5´–ACTGTGCTCCTTGGCCTTCATGC–3´
Exon 4, coding region; reverse
5´–ACCTGGCTTTCTCCACTGCCTGT–3´
Exon 4, 3´ UTR; reverse
Mutation and SNP detection ASOs
Oligonucleotide sequence
Variant detectedb
5´–CCTTTTACGGCATTT–3´
104G>C SNP
8
Supplementary Information
5´–TGCGGCGACGGCTGG–3´
304C>T SNP
5´–CCTTCCTAGAGTTTG–3´
418C>T mutation
5´–CAGACCTACCCAGCC–3´
594C>A SNP
5´–CGGAACCAGACCACC–3´
653G>A mutation
5´–TGTATGCACGGGAAC–3´
729G>A SNP
5´–GCCAGCTATTCCCGC–3´
736C>T mutation
5´–CTGTTTCACGTCTTG–3´
778-11G>A SNP
5´–GGGTGAGAAGGGGCA–3´
882C>T SNP
5´–GGCCCACATGACTGC–3´
1074C>T SNP
5´–TGTGGCCAGGAGCAG–3´
1464C>T SNP
a
Further sequence analysis showed that this primer contains a mismatch (at italicized T)
with respect to the usual wild type sequence.
b
Variant nucleotide is underlined.
9