name: ________________________________________
date: _______________
period: _____
DNA and Protein Synthesis
Answer the following questions based on the following sequence of nucleotides:
TACCCCCGTACCCCGAGCCCCATATTT
1. The above strand is a segment of what molecule? _________________________
a. How did you arrive at your answer? ___________________________________________________________
2. Circle the correct choices. The segment is part of a (polymer, monomer) which, is made up of
(polymers, monomers) called (amino acids, nucleotides).
3. Write the complementary strand of the above molecule.
__ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __
4. Write the mRNA molecule that would be made or ________________________ from the above boldtype strand.
__ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __ __
a. The strand of DNA that is read to make mRNA is known as the ________________________ strand.
b. Each group of 3 nucleotides above is called a(n) _______________________ .
5. Write the protein segment coded for by the above mRNA.
_______ _______ _______ _______ _______ _______ _______ _______ _______
a. Write the anticodons that correspond to each amino acid above.
_______ _______ _______ _______ _______ _______ _______ _______ _______
6. Write the protein segment that would result from the 11th nucleotide of the DNA strand being
changed from a C to a T.
_______ _______ _______ _______ _______ _______ _______ _______ _______
a. What is the change in the DNA molecule called? _______________________________
7. The following is an anticodon.
A U A
a. What is the corresponding codon? _____ _____ _____
b. What is the corresponding set of DNA nucleotides? _____ _____ _____
c. What amino acid would be carried by a tRNA possessing this anticodon? _______________________
8. Write a codon that would serve to stop protein synthesis. _____ _____ _____