Name ___________________________________
Per. ______
Nucleic Acids Practice
Given the following piece of messenger RNA (mRNA):
CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCA . .
Answer the following questions.
1. List the DNA strand sequence from which it was transcribed.
2. List the complementary non-coding DNA sequence.
3. List the amino acid sequence of the protein coded for.
4. What would be the effect of changing DNA base #14 to a G?
5. What would be the effect of changing DNA base #15 to a G?
6. What would be the effect of changing DNA base #16 to a G?
7. What would be the effect of deleting base 17?
1
Name ___________________________________
Per. ______
Below is a short segment of a DNA molecule. Translate the DNA codon into mRNA.
Use your mRNA codon chart to find the sequence of the amino acids coded for. The
top strand is the coding strand.
TACCATGAGAATTGTGGTCACCTTTTT
ATGGTACTCTTAACACCAGTGGAAAAA
1. mRNA:
2. If the nucleotide at position 23 in the DNA codon is changed to "A", what effect
would this have on the protein produced?
The following is the amino acid sequence for a small section of a protein.
methionine-phenylalanine-cysteine-glutamine-valine-tryptophan-isoleucine-prolineaspartate-serine-asparagine
Answer the following questions using the start codon. Include one stop codon at the end
of the mRNA and DNA molecules.
1. Find the mRNA triplets which code for this sequence.
2. Use the mRNA to determine the DNA strand.
3. Construct a complete double stranded DNA molecule for this small protein.
2