WS 8 – 3: Transcription
Name_________________________________________________
Write the answer to each question in the blank provided.
1. What is the enzyme that is important for the process of transcription?______________________________
2. In DNA, what is the sugar called?___________________________________________________________
3. What is a three nucleotide sequence of mRNA called?___________________________________________
4. What is the process when messenger RNA is made from a molecule of DNA?________________________
5. What type of RNA carries the DNA information to the cytoplasm?_________________________________
6. What part of the cell does transcription take place?______________________________________________
7. In RNA, the sugar is called what?___________________________________________________________
8. What does each codon represent?____________________________________________________________
9. Type of RNA that makes up ribosomes?______________________________________________________
10. type of RNA that brings amino acids to the ribosomes?__________________________________________
For the questions below, use the DNA molecule below.
Strand #1
ACGTTGCACGTAGCATAACCGGTTTAGACG
11. On the line above, synthesize the complementary DNA strand using strand #1 above.
12. On the line below, write the complementary mRNA base sequence to strand #1.
13. How many codons are in the mRNA molecule above?___________________________________________
14. How many amino acids would be coded for in the mRNA molecule above?__________________________
Strand #2
ACGTTGCACGTAGCATAACCGGTTTAGACG
15. On the line above, synthesize the complementary DNA strand using strand #1 above.
16. On the line below, write the complementary mRNA base sequence to strand #1.
17. How many codons are in the mRNA molecule above?___________________________________________
18. How many amino acids would be coded for in the mRNA molecule above?__________________________
19. The m in mRNA stands for what? What is the function of mRNA?
20. Compare and contrast DNA and RNA.
Use the diagram below to answer the questions.
21. What does structure #1 represent?__________________________________________________________
22. What does structure #2 represent?__________________________________________________________
23. What is the DNA code for aspartic acid?______________________________________________________
24. What is being described in process A? _________________________________________________
25. What part of the cell does it take place?_________________________________________________