SUPPLEMENTAL INFORMATION
 SUPPLEMENTAL MATERIALS AND METHODS
Opa1 mouse strain construction and breeding
We generated Opa1 Knock-in mice carrying the recurrent OPA1 c.2708_2711delTTAG
mutation described in patients. A targeting strategy was designed to obtain the 4 bp deletion
in exon 27 of the murine Opa1 gene based on homologous recombination in ES cells, at the
Opa1 gene locus. Recombined ES cells from 129/SvPas strain were injected into 3.5
embryonic day blastocysts of C57Bl6/J leading to genetically modified chimeras. Finally, the
F1 breeding of chimeras with Cre-expressing mice resulted in the elimination of the neomycin
cassette and led to constitutive knock-in Opa1 mice (GenOway, Lyon, France). Mice were
kept in the animal house facility of the Institute for Neurosciences of Montpellier (B
3417236, 11/03 2010) in clear plastic boxes, subjected to standard light cycles (12 h to 90 lux
light, 12 h dark). The care and use of animals followed the animal welfare guidelines of the
"Institut National de la Santé et de la Recherche Medicale" (INSERM), under the approval of
the French "Ministère de l’Alimentation, de l’Agriculture et de la Pêche". All efforts were
made to minimize the number of animals used and their suffering according to the European
directive 2010/63/UE.
PCR genotyping of Opa1 mouse strain
Mouse genotyping was performed using total DNA extracted from tail biopsies with
REDExtract-N-Amp™ Tissue PCR Kit (Sigma). The primers used for PCR were (5’-3’):
GX6130
=
GGAGGATGTGTGTATAGCATAGCCATTGG
and
GX6131
=
CAAAACCACCAAGTAGTGCTCAGGACG. Opa1+/+ and Opa1+/- amplicons were 795 and
935 bp respectively. The PCR reaction was performed using a thermocycler (Eppendorf,
Mastercycler Gradient) with the following program: 94°C for 2 min, then 94°C for 30 sec,
65°C for 30 sec, 68°C for 5 min (x35 cycles) and followed by 68°C for 8 min. Ten microliters
of each reaction were then loaded and migrated on a 2% agarose gel and visualized by
ethidium bromide staining.
qRT-PCR primers
We used a set of six primers to amplify the four Opa1 transcripts: Opa1S1:
GAGTATATCGATTTTTGGTTCTC, Opa1S2: CTTTTTTACCTCAGGTTCTCC, Opa1S3:
GAGTATATCGATTTTGGTCACA, Opa1S4: GACTTTTTTACCTCAGGTCAC, Opa1AS5:
CTCTTTGTCTGACACCTTTCT, Opa1AS6: TCACCAAGCAGACCCTTTCT. The relative
quantification was made using an external standard curve carried out with the amplification of
the human β-Globin gene from the Human Genomic DNA (Roche). Primers used for this
amplification
were:
HsBetaGlobinS:
ACACAACTGTGTTCTTCACTAGC,
HsBetaGlobinAS: CAACTTCATCCACGTTCACC. Each Opa1 transcript expression was
normalized
to
the
ribosomal
protein
L27
gene
with
primers:
MmL27S:
ACGCAAAGCCGTCATCGTGAAG, MmL27AS: CTTGGCGATCTTCTTCTTGCC.
Mitochondrial DNA quantification
Primers
used
to
amplify
the
AGAGCCACCTTACAAATAAGC,
mitochondrial
ND1
gene
were:
MmND1S:
MmND1AS:
CGTAGTTGTATGTACCCTAAG.
Referent nuclear gene used to normalize mtDNA copy number was the Mus musculus βGlobin
gene with
the primers: MmBetaGlobinS:
ACATAGTTGTGTTGACTCAC,
MmBetaGlobinAS: ACCAACTTCATCGGCGTTCA. The relative quantification was
performed with the amplification of the ND1 and the β-Globin genes separately using total
genomic DNA.
Protein quantification
For protein purification, homogenates from tissue samples were treated with SET 1X buffer:
10 mM TRIS, 1 mM EDTA, 150 mM NaCl, 1% SDS at pH= 6.8, heated at 95°C for 10 min
and centrifuged at 14,000 rpm. The protein content of the supernatant was assessed according
to Bradford (Bradford, 1976). Proteins (40 μg) were separated by 7.5% SDS-PAGE and
transferred onto a nitrocellulose membrane (Bio-Rad, Hertfordshire, UK). Primary antibodies
against OPA1 protein (Olichon et al., 2002) and Actin (1:5000 Sigma) were visualized using
horseradish peroxidase-conjugated secondary antibody. Final quantification was performed
with ImageJ software. For the mitochondrial subunit study, forty micrograms of total protein
were separated on a 12.5% SDS-polyacrylamide gel and electro-blotted onto a PVDF
membrane (Amersham Biosciences, Little Chalfont, Buckinghamshire, UK). Primary
monoclonal mouse anti-COX I (1:1000 Mitosciences, Eugene, OR, USA), anti-COX V5a
(1:1000 Mitosciences), and anti-II 30 (1:1000 Mitosciences) antibodies were used and
detected with an anti-mouse IgG horseradish peroxidase conjugated antibody (1:20 000
Amersham Biosciences, UK). Bands were visualized with enhanced chemiluminescence
(ECL+ Western Blotting Detection Reagents, Amersham Biosciences) and quantified using
Quantity One software (Bio-Rad).
Vision electrophysiology assessments
Mice were anesthetized by intra-peritoneal injections mixture of Ketamine (120 mg/kg) and
Rompun (10 mg/kg). Visual Evoked Potentials (VEPs) were recorded using needle electrodes
placed subcutaneously near the tail and in the snout as references and in the back of the head
to contact the visual cortex of both hemispheres. Three phases of 60 flashes were performed,
then the cortex needle was repositioned and the experiment repeated. The flash duration was 5
milliseconds with a frequency of 1 Hz and intensity of 159 cd.s-1.m-2. Amplitudes and
latencies obtained during each phase were averaged. A cut-off filter was set at 35 Hz.
Auditory function assessments
We studied Opa1 mice of 3, 5 and 11 month of age. All procedures were performed under
general anesthesia using an intra-peritoneal injection of a mixture of Rompun 2% (3 mg/kg)
and Zoletyl 50 (40 mg/kg). The acoustical stimuli were generated by an arbitrary function
generator (type 9100R, LeCroy Corp.), consisting of 9-ms tone bursts with a 1-ms rise and
fall time delivered at a rate of 10/s. Tone bursts were passed through a programmable
attenuator and delivered to the animal by a JBL 075 loudspeaker (James B. Lansing Sound,
Inc., Stamford, CT) in a calibrated free field. The auditory brainstem responses (ABRs) were
recorded by needle electrodes placed subcutaneously at the vertex and on the mastoid of the
stimulated ear, whereas the ground electrode was placed in the muscles of the posterior leg.
The physiological signal was amplified 100.000 by a Tektronix (TM 503) differential
amplifier and digitized (50 kHz sampling rate, with a 12-bit dynamic range and 1024
samples/burst), averaged 512 times, and stored on a computer (Dell Dimensions, Dell Inc.,
Round Rock, TX). Intensity-amplitude functions of ABR were obtained at each frequency
tested (2, 4, 6, 8, 10, 12, 16, 20, 26, and 32 kHz) by varying the intensities of the tone bursts
from 0 to 100 dB SPL, by 5-dB steps. The ABR thresholds were defined as the minimum
sound intensity necessary to elicit a clearly distinguishable response.
Behavioral tests
Catwalk test: Animals traverse a walkway with an entrance at one end. A light source is
projected via one of the long edges of the glass floor (100cm×12 cm×0.6 cm) of the walkway.
The light is almost entirely reflected within the glass except at points where an object such as
a paw touches the glass, where the light illuminates the contact area and is reflected
downwards. The light signals produced by each paw contact are recorded through the whole
run via a camera placed under the glass plate, the signals are digitised and data stored on a
computer. The intensity of the signal depends on the pressure exerted, so that the spot will
appear brighter when more weight is put on the paw. If no or only little weight is supported
on the paw, no print will be visible. Therefore, this technique is suitable to detect how the
animal supports its weight upon the paw while walking.
In the present study, parameters related to single paws were analysed:
(1) Print area: The total floor area (cm²) contacted by the paw during stance phase
(2) Print width: The width (vertical direction, cm) of the complete paw print
(3) Print length: The length (horizontal direction, cm) of the complete paw print
(4) Mean intensity: The mean intensity (arbitrary units, a.u) of the complete paw. This
parameter describes the mean pressure exerted by one individual paw during the floor contact.
(5) Maximum intensity: The maximum intensity (arbitrary units, a.u) of the complete paw
(6) Minimum intensity: The minimum intensity (arbitrary units, a.u) of the complete paw
(7) Stand (or stance phase): The duration in seconds of contact of a paw with the glass plate
(8) Swing: The duration in seconds of no contact of a paw with the glass plate
(9) Swing speed: The speed (cm/s) of the paw during swing
(10) Stride length: The distance between successive placements of the same paw
(11) Step cycle: The time in seconds between two consecutive initial contacts of the same paw
(12) Duty cycle: The ratio between the stance duration and the step cycle duration. It is
calculated according to the formula: stance phase duration/[stance + swing phases
duration]×100
(13) Base of support (in cm): The distance between left and right front paws or hind paws.
Retinal ganglion cell counting
Eyes still connected to their optic nerve were formalin-fixed and embedded in paraffin.
Sagittal cross sections of 5 μm passing through the optic nerve were de-paraffined with
xylene and successive decreased ethanol baths. Epitope retrieval was performed using the
Rapid Microwave Histoprocessor (Histos 5, Milestone Srl, Shelton USA) for 19 min at 98°C.
The sections were immunolabelled using Hoescht (1:1000, Invitrogen) to stain nuclei of the
different cell layers into the retina. An antibody specific for the RGC transcription factor
Brn3a was used as primary antibody (1:400, Santa Cruz Biotechnology) and detected with a
Donkey anti-mouse secondary antibody conjugated to Alexa 488. Visualization was
performed using a Zeiss AxioImager microscope and quantification was expressed as the ratio
of RGCs to the total number of Hoechst positive cells in the ganglion cell layer.
Magnetic Resonance Imaging and Spectroscopy analysis
Opa1 mice were secured in animal bed and anesthetized through a mask by spontaneous
inhalation of 0.3 ml/min O2 and 0.7 ml medical air with 1.5% isofluran. The probe was
thermostated at 39°C by warm circulation and heating map. The mouse temperature and
respiration were 37°C and 70-100 BPM, respectively. The anaesthesia concentration was
adjusted by monitoring the respiratory rate. The study did not exceed 150 minutes.
All experiments were performed on Bruker Biospec Avance III 117/16 USR equipped with a
152 mm/90 mm gradient coil (750mT/m, 100us). Mice were carefully secured in animal bed
handling system with the head centred in a circular polarized 1H rat brain radiofrequency coil
used for excitation and signal reception. The global shim was optimized with first and second
order shim terms which were automatically adjusted from a field map acquisition. The highresolution T2 weighted axial and sagittal images were acquired using a TurboRARE (Rapid
Acquisition with Relaxation Enhancement) pulse sequence. To increase the contrast in sagittal
image, a 8 RARE factor was used giving an effective echo time = 28 ms, TR = 2.5 s and
number average = 4. Seventeen continuous 0.5 mm thick slices were necessary to cover
entirely the mouse brain, number of average was 2. The field of view was 1.8 x 3.6 for in
plane resolution 70 x 70 μm. The motion artefact was limited by use of the Motion module in
Paravision Software. The same sequence was performed in other directions with the same
resolution. In this condition the different brain structure in particular the cerebellum were
identified. For spectroscopy, the volume of interest was centred in the cerebellum and the size
2 x 3 x 2 (12μL) was adjusted to fit the anatomical structure of the cerebellum. The first order
shims XYZ were automatically optimized in volume to obtain a half-height line width of
water signal < 20 Hz. The point resolved sequence (PRESS) was used for localization. 1H
NMR spectra were acquired with TE = 9.8 ms, TR = 4 s, spectral width = 5 000 Hz. Each
spectrum represented an average of 512 scans. The water signal was suppressed by variable
power RF pulses with optimized relaxation delays (VAPOR) (Tkac et al. 1999).
Absolute quantification: a spectrum was acquired in the same experimental conditions
without VAPOR water suppression for absolute quantification of metabolites. In vivo
metabolite concentrations were determined with jMRUI software. Previously the signal of
residual water was filtered with HLSVD pre-processing and an apodisation (10 Hz) was
applied to increase the signal-to-noise. The quantification method used was the time-domain
semi-parametric algorithm QUEST, based on metabolites basis set. This basis was built with
the following 10 metabolites Creatine (Cr), Choline (Cho), γ-aminobutyric acid (GABA),
Glutamate (Glu), Glutamine (Gln), Lactate (Lac), Myo-Inositol (Myo-Ins), N-AcetylAspartate (NAA), Taurine (Tau) and Phospho-Creatine (PCr). They were acquired with the
same experimental conditions. The pH of each solution was adjusted to 7.3. The QUEST
algorithm calculates the best fit for experimental spectrum to the basis metabolites. The
intensity of the water signal obtained from non-suppressed water spectra was used as an
internal reference. For this purpose, we considered that the water content was 80%
(Papadopoulos et al. 2004; Chassain et al. 2008, 2010). We assumed the visibility of the water
signal to be 100% and used a water molarity of 55.5 M. The metabolites were quantified with
Cramer-Rao lower bounds (CRLB) of 10-35% except Gln and Cho quantified with CRLB >
35%.
Mitochondrial respiratory chain analysis
Animal and tissue dissections
For metabolic function analyses, barbituric and CO2 must be avoided due to mitochondrial
toxicity (Pearce and Duchen 1995, Gomez-Casanovas et al. 2007). Mice were anaesthetized
using isofluran (1 minute for 10 grams) and euthanized by decapitation in accordance with
European Community guidelines (2010/63/UE directive).
Analyses of mitochondrial function were performed on two types of neuronal tissues (retina,
optic nerve, brain) and striated muscles (heart and skeletal muscles tissues), which were snap
frozen in liquid nitrogen and then stored frozen following dissection at -80°C. For functional
analysis on muscles, the tissue was rapidly placed in permeabilisation buffer (7.23 mM
K2EGTA, 2.77 mM CaK2EGTA, 20 mM imidazole, 0.5 mM DTT, 3 mM KH2PO4, 6.56 mM
MgCl2, 0.2% fatty acid-free BSA, 53.3 mM MES, 20 mM taurine, 5.3 mM ATP and 15 mM
phosphocreatine, pH 7.1). Because of their energetic metabolism, glycolytic and oxidative
muscles where considered separately. Indeed, the highly oxidative soleus muscle relies on
oxidative phosphorylation for ATP supply, whereas the fast-twitch glycolytic part of the
gastrocnemius muscle mostly relies on anaerobic glycolysis.
Mitochondrial respiratory rates
Resting respiration (state 2) was initiated in the presence of either complex I substrates, 5 mM
malate and 2.5 mM pyruvate, or complex II substrate, 5 mM succinate supplemented with 10
µM rotenone, then maximal ADP-stimulated respiration (state 3) was measured with one
addition of saturating ADP concentration (0.5 mM). Cyt c was added (8 μM) to check outer
mitochondrial membranes integrity. Finally, in one oxygraphic chamber, 2 µg/mL oligomycin
were added, and the capacity of the electron transport system was recorded by uncoupling
respiratory chain using 1 µM carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone
(FCCP). In the second one, antimycin was added and COX-linked respiration was analysed
using 50 mM ascorbate and 5 mM N,N,N′,N′-Tetramethyl-p-phenylenediamine (TMPD) as
substrates.
Mitochondrial enzymatic activities
The activities of the mitochondrial OXPHOS complexes were measured on brain, muscles or
heart homogenates at 37°C using a Beckman DU-640B spectrophotometer (Beckman Coulter,
CA, USA) (1). The complex IV activity was measured by following the oxidation of reduced
cytochrome c at 550 nm. For retina, measurement of activity of complexes I and II were
realized successively in a reaction medium containing 100 mM phosphate buffer (pH 7.5),
3.75 mg/mL fatty acid-free bovine serum albumin, 0.1 mM decylubiquinone, 1 mM KCN, 5
µg/mL antimycine, 80 µM DCPIP and 10 µg of homogenates. After 2 min of incubation at
37°C, complex I activity was initiated by adding 0.1 mM NADH. Complex I was then
inhibited by 0.01 mM rotenone, and the complex II reaction was initiated by adding 30 mM
succinate. The activities were measured at 600 nm by monitoring the reduction of DCPIP. In
the optic nerve, only the complex IV activity was measured due to reduced material
availability.
BN PAGE analysis
Following transfer to membranes (Amersham) and saturation with 10% in non-fat milk
dissolved in TBS-Tween 0.1%, the presence of complex I, II, III and IV were assessed using
antibodies against NDUFB6, II70, III core 2 and COX I respectively (Mitosciences).
Membranes were incubated with anti-mouse IgG horseradish peroxidase-linked antibody
(1:10 000 Amersham Biosciences, UK) for 2 h at room temperature. The immunoreactive
proteins were visualized with enhanced chemiluminescence (ECL+ Western Blotting
Detection Reagents, Amersham Biosciences). Band intensities were quantified with Quantity
One software (Bio-Rad).
Mitochondrial DNA deletions analysis
For Long-Range PCR (LR), mouse mtDNA was amplified using three pairs of primers: LR1:
F1409-1118 (wild-type mtDNA fragment of 16010 bp), LR2: F3387-14918 (wild-type
mtDNA fragment of 11531 bp) and LR3: F5383-640 (wild-type mtDNA fragment of 11557
bp). The PCR conditions are: 1 cycle at 94°C for 1 min; 30 cycles at 98°C for 10 s and 68°C
for 11 min; a final extension cycle at 72°C for 10 min. The PCR was performed using TaKara
LA Taq DNA polymerase for the first pair of primers, and TaKara Ex Taq DNA polymerase
for the other sets of primers (TaKara Shuzo Corp., Japan).
 SUPPLEMENTAL REFERENCES
1.
Medja, F., Allouche, S., Frachon, P., Jardel, C., Malgat, M., Mousson de Camaret, B.,
Slama, A., Lunardi, J., Mazat, J.P., and Lombes, A. 2009. Development and implementation of
standardized respiratory chain spectrophotometric assays for clinical diagnosis.
Mitochondrion 9:331-33
 SUPPLEMENTAL FIGURES
Figure S1
Figure S2
Figure S3
Figure S4
Figure S5
 SUPPLEMENTAL FIGURE LEGENDS
Figure S1: Mitochondrial network dynamics in Opa1delTTAG mice fibroblasts. Primary
cultures of murine skin fibroblasts were obtained from Opa1+/- and Opa1+/+ mice. Fibroblast
mitochondrial network was labeled using a primary antibody against OPA1 protein.
Figure S2: Electroretinogram recordings: ERG recordings of Opa1+/- and Opa1+/+ mice at
4, 6, 9, 11 and 13 months (n=7-12 per genotype). a- and b-wave amplitudes and latencies are
represented with time. No significant alteration was found.
Figure S3. Catwalk print area and max intensity detection in Opa1delTTAG mouse strain.
(A) Print area and Max. intensity detection during Catwalk test. LF: Left Front, LH: Left
Hind, RF: Right Front, RH: Right Hind. (B) 3-D representation of Print area and Max
intensity in both genotypes.
Figure S4. No defect in assembly of complexes I, II, III or IV in Opa1delTTAG mutant mice.
(A) Complexes I, II, III and IV were analyzed by BN PAGE on 5 and 11 month-old glycolytic
muscles (n=4 per genotype). (B) BN-PAGE analysis on 11 month-old glycolytic muscles with
use of 1 g/g and of digitonin shows supercomplex disassembly in WT and mutated genotypes.
Supercomplex composition and monomer of complexes are indicated on the right. Bracket
represents bands differentially expressed (n=4 per genotype).
Figure S5. Opa1delTTAG mutation does not lead to mtDNA deletions but to variations of
mtDNA abundance. (A) Agarose gel electrophoresis of mtDNA long-range PCR products
LR1 (left), LR2 (middle) and LR3 (right) of 16010 bp, 11531 bp and 11557 bp, respectively.
mtDNA deletions were investigated in glycolytic muscle, retina and heart samples of 5 and 16
month-old mice. Samples 1,3,5,7,9,11: Opa1+/+. Samples 2,4,6,8,10,12: Opa1+/-. M1 and M3:
Lambda DNA Hind III marker + 1Kb ladder, M2: 1Kb+ ladder (n=4 per genotype). (B)
mtDNA quantification in different tissues, expressed as the ratio of mtDNA to nuclear DNA
(n=4-7 per genotype, except optic nerve n=3 pools of 2). Bars represent mean ± SEM
(*<0.05).