SIRC Workshop January 31, 2012
Anya Goodman, Ph.D. Department of Chemistry and Biochemistry, Cal Poly – SLO
James Youngblom, Ph.D. Department of Dept. of Biological Sciences, CSU-Stanislaus agoodman@calpoly.edu
; jyoungblom@csustan.edu
Adapted by Nicholas Ewing, Ph.D. Department of Biological Sciences, CSU, Sacramento, nnewing@csus.edu
Target Audience: This lab exercise is designed for beginning biology students. It is appropriate for a lower division entry-level biology class. No prerequisites courses are required, but some basic knowledge of the central dogma of molecular biology is highly recommended (see PowerPoint).
Requirements: Parts 1 and 2 require paper, pencil, printed sequence and "database", and a table of the genetic code. For the remainder of the exercise, it is best if each pair of students has a computer with internet access, although, a single computer and projector run by the instructor could substitute.
For part 4 (ID of real people), students may be provided with slides showing the phenotypes of the individuals X, Y and Z. The exercise can be completed in one 2 hour lab period. Alternatively, the lab can be split into two sessions.
List of files: All are accessible at http://www.csus.edu/indiv/e/ewingn/SIRCresources.htm
and in their original form at: http://gep.wustl.edu/curriculum/course_materials_GEP_partners/csuperb_workshop
1) Human Genome Project and Personalized Medicine.doc
Handout for guiding students through the exercise, includes answer sheet
2) Instructors Guide Human Genome Project and Personalized Medicine.doc
Instructor manual, including answer key and additional activities
3) DNA Sequences for lab (HGPandHealth_sequences.docx)
Large format sequences for part 1 – ready to print
4) Molecular Biology Intro (Molecular_Biology crash course.ppt) slides for introductory lecture on the basics
5) Celebrity photos (DNA_Celebrity_photos.ppt
Photos showing phenotypes of three people in part 5
6) Genetic Code--table of codons (The Genetic Code.docx)
Activities:
In parts 1-4, we will help a fictional patient Greg Mendel figure out whether he should be treated with a particular type of medication (beta-blockers, like metoprolol) to prevent heart attacks or to treat a heart attack. We will also look at several other traits of our patient. In part 5, we will examine genotypes of three real individuals and try to identify them based on the predicted phenotypes. In part 5, we formulate conclusions and, if time permits, discuss applications of genotyping and genome sequencing, as well as issues associated with the increasingly easy access of individuals to their genetic information.

SIRC Workshop January 31, 2012
Key Concepts:
1.
Traits (aka phenotype) of an organism are specified by the interactions between genes (genotype) and environment.
2.
Many traits rely on functions of multiple genes; some traits depend on a single gene.
3.
The relative importance of genetics and environment varies from trait to trait.
4.
The central dogma of molecular biology specifies the direction of information flow: DNA

RNA

protein.
5.
The DNA sequence of a protein-coding gene is translated into an amino acid sequence using the genetic code.
6.
Many small differences in DNA sequence (SNPs) among individuals contribute to the unique combination of traits of each person. a.
Changes in the coding region of a gene can change protein structure, and therefore, its function. (addressed) b.
Some changes in DNA do not lead to any changes in phenotype.
7.
Genetic information is becoming more accessible, but should be used with caution. One should carefully weigh the advantages and disadvantages of obtaining personal genetic information.
8.
Sequencing of the human genome and development of new DNA sequencing technologies have opened up new areas of research including personalized medicine, development of new drugs and diagnostic methods for diseases, and others.
Learning Objectives:
Upon completion of this lab, students should be able to
1.
Explain and use appropriately the following terms: genotype, phenotype, gene, SNP, mutation, coding region of a gene/CDS, DNA, protein, gene expression, genetic code, central dogma of molecular biology.
2.
Explain how small changes in the coding region of a gene can change organism’s phenotype.
Illustrate with a specific example.
3.
Explain how environment can override genetics in determining phenotype. Illustrate with two examples.
4.
Explain why in most cases, testing for a particular SNP/mutation does not accurately predict an individual’s phenotype.
5.
List advantages and disadvantages of obtaining personal genetic information.
Optional/additional:
6.
Explain how small changes outside the coding region of a gene can change organism’s phenotype. Illustrate with a specific example.
7.
Explain the impact/applications of the human genome sequencing and development of new DNA sequencing technologies on biomedical sciences and our society.

SIRC Workshop January 31, 2012
Appendix I provides the option of searching databases at NIH using BLAST. This more advanced module is appropriate for AP Bio courses. Reinforces objectives above and addresses additional learning objectives:
1.
Be able to search NCBI databases and compare two sequences using BLAST.
2.
Protein and DNA sequences can be compared using BLAST.
This lab was designed to be fairly modular to allow for maximum flexibility.
The instructor notes provide the answer key and specify possible activities and alterations to the student manual file.

SIRC Workshop January 31, 2012
Answer Sheet Name___ Key _________________
The patient’s sequence you are analyzing is SEQ1 or SEQ2 (circle one)
1A. What is the best match in the paper database? # _ 3_.
1B. How many different SNPs does the patient’s DNA contain in the given region?
_ one seq 1 or zero for seq 2 ___
2A.What codon (3-letter code) is different between two sequences?
Sequence 1 __ CGA_ ___ Sequence 2? ___ GGA _______
This codon codes for amino acid #389 in the adrenalin receptor.
What is the amino acid #389 in sequence 1? ___Arg _In sequence 2? ____Gly_________
2B. Do you expect this specific change in amino acid to affect the structure of the protein? Briefly explain why.
Yes, the side chain of Arg is large and positively charged, glycine has very small side chain, they will each have different non-covalent interactions in 3D structure of a protein.
2C. Both sequence 1 and 2 came from the same patient (Greg Mendel).
Why does the patient have two copies of this gene? One copy from mom, the other from dad
What is Greg’s genotype at this SNP? Circle one: CC
CG GG
3A. Action of what hormone do the beta-blocker drugs (bucindolol, metoprolol, etc.) block?
Adrenaline
3B. How do these drugs work in preventing/treating heart attacks?
Adrenaline normally (fight-or-flight response) increases heart rate; beta-blocker drug interferes with this signaling and keeps the heart rate level, even when adrenaline is signaling.
3C. Propose a hypothesis to explain on the molecular level why patients with a “G” in a particular
SNP do not respond to beta-blocker drugs.
SNP in the ADRB1 gene results in different amino acid side chain in the adrenaline receptor; the change in receptor protein structure changes patient’s ability to respond to drug (e.g. keeps the drug from binding to the receptor) and makes drug ineffective.
3D. Should Greg Mendel be treated with beta-blockers? Yes No
Explain why:
Based on the information given, patients with the same genotype did not have reduction in mortality when treated with the drug.
3E. Diabetes predisposition: under “disease risk,” find “Type 1 diabetes” and “Type 2…”

SIRC Workshop January 31, 2012
Does Greg Mendel have lower than average risk of developing type 1 diabetes? Yes No
Does Greg Mendel have lower than average risk of developing type 2 diabetes? Yes No
How many SNPs were used to predict predisposition for type 2 diabetes? ___ 11_(4 increased, 7 decreased risk, the magnitude varies)____
Do all SNPs make similar predictions: all increased or decreased risk of disease? Yes No
It is possible that there are other SNPs in the human genome that have not been discovered yet.
Imagine,that Greg Mendel had his whole genome sequenced and knew ALL the SNPs affecting his predisposition to type 1 and type 2 diabetes.
For what type of diabetes would scientists/doctors be able to predict the patient’s risk with more confidence? Type 1 Type 2 Explain. Much smaller environmental contribution, mostly genetics.
If genetic information suggested lower than average risk of developing diabetes, could the patient still develop the disease? Yes No Explain Environmental effects contribute to this phenotype. For type 2 diabetes: diet and lifestyle contribute more than genes; even for type 1, a person who does not have predisposition could end up with damaged pancreas (accident, pathogen, autoimmune disease), low or no insulin production and type 1 diabetes.
3F. What else can we learn about Greg Mendel from his genotype? Pick one trait that is of interest to you and summarize your findings. variable
Part 4 Complete the table below:
Table 2. Summary of predicted phenotypes of the three individuals and identification.
Trait (phenotype)
Lactose intolerance
Height (average, taller or shorter than average)
Eye color (Blue,
Brown, Green)
Hair curl
Longevity
Name of the person
X
No average blue
Straighter than average or typical
Greater odds or typical
Venter
Y
No
Ave or shorter
Brown (56%)
Typical
Typical or greater odds
Watson
Z
YES, lactose intolerant
Shorter brown
More curly (for
European)
Typical odds
Kim
5. Conclusion: Why is it difficult to predict traits from just knowing DNA letters at each SNP?
(Can you think of three reasons?)

SIRC Workshop January 31, 2012
1. gene-gene interactions OR multiple genes may be responsible for a trait (hard to make predictions until we know all contributions and their relative importance; examples – migraines, diabetes, height, eye color predictions)
2. Environmental factors (environment affects phenotype; examples: diet can affect height, diabetes, hair curl)
3. Available data gives probabilities, useful for populations but not as useful for individuals (e.g.
56% probability of brown eyes – means in a group of 100 people with this genotype, on average, 56 people will have brown eyes; for a particular person – we cannot say if he/she will be among these
56)
Appendix:
A1. How many significant “hits” did we find in the human database? __3___
A2. What is the name of the gene? _ ADRB1 _____ What protein does this DNA code for?
__ adrenaline receptor ________________________________________
A3. What chromosome does this gene reside on? _____ 10 _________
A4. Why is there more than one meaningful match to our sequence in the human genome?
Database contains genomic and transcript sequences, humans can have a C or a G in their genome

SIRC Workshop January 31, 2012
For part 1 (paper sequence alignment), the instructor will need to print patient’s sequence and the “database.” Sequences can be cut into strips and students can work in pairs – each student analyzes one patient sequence. Sequence 2 is the exact match to the database, just shifted, seq1 has a single nt polymorphism. Students initially seem intimidated by the task, but quickly figure out about sliding the “query” strip along each of the database entries.
Patient’s sequence 1(query)
…AGCCCCGACTTCCGCAAGGCCTTCCAGCGACTGCTCTGCTGCGCGCGCAG…
Patient’s sequence 2(query)
…AGCCCCGACTTCCGCAAGGCCTTCCAGGGACTGCTCTGCTGCGCGCGCAG…
Database:
#1 …TGCTACCCGCGCCCGGGCTTCTGGGGTGTTCCCCAACCACGGCCCAGCCC…
#2 …GCCCCGACTTAGGGCTGCCCGCCGGCGCCACGCGACCCACGGAGACCGGGCCT…
#3 …CCGACTTCCGCAAGGCCTTCCAGGGACTGCTCTGCTGCGCGCGCAGGGC…
#4 …GCGATTTCCACAAGGCCTTCTAGCGCTGCTCGGCTGCGCGTGCAGGGC…
#5 …CCCCGACTTCCGCAATAAGTCTAGGGCCTTCCATTGCGAAGAGGGC
Possible additions:
Part 4: for other traits (4E): migraines could be used as a simple alternative to diabetes. Both illustrate traits that have many SNPs often conflicting. No explicit assignment of the contribution of environment vs. genes.
4E. Is Greg Mendel likely to suffer from migraines (under disease risk)? Yes No uncertain
Can genotype tell us whether Greg will have a migraine tomorrow? Yes No
Does knowing genotype help us predict phenotype (tendency to develop migraines) in this case? Yes No Explain why:

SIRC Workshop January 31, 2012
For teaching the concept of “carrier” the following section on PKU may be included:
Part 6.
Have you been tested? Should you be tested?
Have you ever donated DNA and been genetically tested? Almost certainly you have. It is the law in all 50 states that newborns be screened for certain genetic conditions. In California the current newborn screening requires testing for 27 genetic conditions with the option of more tests. The test is usually performed a day or two after birth. Babies are pricked in the heel and a spot of blood is collected. In this exercise we will elaborate on one genetic test- the test for phenylketonuria (PKU).
PKU is a genetic disorder of the phenylalanine hydroxylase gene. Hundreds of different mutations disable the gene. Individuals are only affected if they inherit defective copies of this gene from each parent. Affected individuals cannot properly metabolize proteins. Proteins of course are found in meats, cheese, nuts, and many other foods. During normal food metabolism, proteins are broken down into amino acids, including phenylalanine. People with PKU cannot process phenylalanine. Affected and untreated individuals suffer from a buildup of phenylalanine in the blood and in other body fluids. The buildup particularly affects brain development. Affected and untreated individuals have abnormal brain development and serious cognitive problems. The severity of the condition, and what measures are needed to manage it, depends on the specific mutations inherited. Fortunately there is a cure. The cure involves a very restrictive low protein diet. Individuals need to monitor meticulously their protein intake, particularly their intake of foods with the amino acid phenylalanine. Phenylalanine is an essential amino acid so it cannot be eliminated entirely from anyone’s diet, but for individuals with PKU it needs to be taken in very low doses.
It is critical that this genetic test is preformed early in life as the dietary restrictions need to start right away. When you were just a few days old, you were tested for PKU. With proper treatment, affected individuals can live a long and healthy life. Obviously if you are affected with PKU, you would know it. However, even though you were tested for PKU, most of you don’t know your PKU status. You may have two unaffected copies of the phenylalanine hydroxylase gene, but you could carry one affected copy (making you a PKU carrier). PKU carriers are not affected. Nonetheless, can you think of any reason why someone would like to know whether or not they are a carrier of a PKU allele?

SIRC Workshop January 31, 2012
Part 7 - Genes, genetic interactions, and the environment
In all probabililty, you were not able to nail down many specific characteristics for the three people chronicled in the last exercise. Why? Doesn’t a person’s genotype determine their phenotype? In some cases the genotype-phenotype relationship is clear. Most cases of achondroplasia (short-limbed dwarfism) are caused by a mutation in the fibroblast growth factor receptor 3 (FGFR3) gene located on chromosome 4. Achondroplasia can be inherited but ~80% of all cases are caused by a new mutation that is passed on through either the egg or the sperm.
In more than 99% of these new cases the new mutations are affect the same codon. The 380 th codon ordinarily encodes glycine but the new mutation changes the 380 th codon to an arginine codon. This particular mutation disables the FGFR3 protein and causes achondroplasia. Why can’t the same precision be applied to all traits and diseases that are genetically influenced? To answer that question, we can look at diabetes. Both diabetes type 1 and diabetes type 2 have a genetic component. Go the 23andme sample report for Type 2 diabetes. After reading the short introductory paragraph scroll down to the section on examine the section on “Genes vs.
Environment”. Make note of the estimated percentage heritability. See also the “Marker
Effects”. Note the number of different genes involved. Next go to the Diabetes Type 1 sample report. Again make note of the estimated percentage heritability and the effects of various genes.
You should now be able to answer an important question:
Regarding a human disease state, why do some genes contribute such a tiny (but measurable) effect sometimes barely influencing a person’s probability of coming down with the disease
Explain why good eating and exercise habits can help someone defeat type 2 diabetes but not type 1 diabetes.