Detection of an Alu Polymorphism
by Polymerase Chain Reaction
As illustrated below, this exercise has four distinct steps. Since all four steps cannot be
completed in one three hour session, the different steps will be completed over the course
of several weeks. When working on any given step, it is a good idea to be aware of the
overall exercise.
Step one
extract
cheek cells
Step 2
Isolate DNA
Step 3
Amplify (PCR) DNA region
that may or may not have pv-92
Objectives
1. Reinforce concepts of exons, introns,
and DNA synthesis
2. Gain an insight into what transposons
are, and their number and significance in
the human genome
3. Learn techniques important to and
commonly used in biotechnology.
4. Each student is to determine the number of copies, if any, of a particular jumping gene he or she has.
Background Information
Each human chromosome is a very long
double stranded DNA molecule, and contains millions of nucleotides (A’s, T’s, G’s
and C’s). The pattern of these A’s, T’s,
G’s and C’s form the complete human genome. It is currently estimated that the
human genome has over 40,000 genes.
While these genes code for the cellular
activities that collectively result in a human being, a great part of human DNA,
about 25%, belongs to a category called
transposons.
Transposons, or jumping genes, have no
human related function, they serve only to
perpetuate themselves. There are a variety of different types of transposon (jump
Step 4
electrophoresis to resolve
amplified regions, & analyze
ing genes) present in each human cell.
The Alu family of transposons are only
about 300 base pairs in length. When
one is “activated”, it makes a copy of itself, and this copy is inserted randomly
into one of the 46 chromosomes. As might
be expected, the number of transposons
per cell increases each time one is copied. Over millions of years, the number of
Alu type transposons has grown to the
extent that each human cell has over
1,000,000 copies. With so many copies,
the Alu type of transposons amounts to
approximately 10% of human DNA.
Exactly where in a chromosome a transposable element inserts itself could be of
great consequence. To see how, one
needs to know that most of the 40,000
plus human genes code for proteins.
Whether a protein is an enzyme, a
transport molecule, or has some other
function, each protein contributes to some
aspect of cell life. Most genes have exons (coding regions) and introns (noncoding regions). The A’s, T’s, G’s and C’s
within exons code for the amino acids that
make up the functional protein. Any
change in the coding region (exon) of a
gene could be disastrous because the
change might result in the production of a
protein that does not function normally.
69
Severe human diseases, such as mental
retardation, immunodeficiencies, and cancer, are caused by changes in the coding
regions of certain genes. Neurofibromatosis, a tumor disease, is an example of a
human disease caused by the insertion of
an Alu transposon into the coding region
of a gene, the NF1 gene. In contrast, insertions into introns (non-coding regions
of a gene) generally have no effect on a
gene’s protein product.
Since there are so many transposons in
every cell, and since insertions into exons
can have serious consequences, it is often asked if transposons can have any
benefits. One school of thought is that the
many transposon copies increase the
probability of molecular events where
segments of DNA from different areas are
exchanged. Because such exchanges
can give rise to new genes and new gene
combinations, is thought that transposons
might be significant in evolution.
Alu-pv92 is the specific transposon
that is the focus of this exercise. This
insertion is found within an intron of a
gene that located in chromosome
number 16. Since the Alu-pv92 insertion
occurs within an intron, the insertion has
no effect on the production of this gene’s
protein. While the Alu-pv92 insertion is
wide spread in human populations
throughout the world, its frequency is
greater in certain parts of the world.
Nonetheless, it is expected that several
students in each laboratory section will
have one or two copies.
Then read over the text giving Alu stats,
number of Alu copies per cell, what per
cent of the human genome Alu occupies,
how long Alu elements are, and type of
transposon Alu is an example of.
NEXT
Click on MEDIA/ANIMATION
Then click on “How Alu Jumps” to see
the jumping mechanism.
What evidence is there that Alu transposons are “retrotransposons?”
The heart of this exercise is that you will
use state-of-the-art biotechnology to determine how many, if any, copies of PV-92
you have.
 You will first isolate your own DNA
from a sample of your cheek cells.
 You will then use PCR to make millions of copies of a targeted region
(the region that may or may not
have PV-92) of your genome.
 Finally, you will use electrophoresis
to resolve the DNA you made millions of copies of.
Polymerase Chain Reaction (PCR)
The web site mentioned above is also excellent for its PCR animations. This animation lets you see how PCR works, and
helps reinforce the concepts of how DNA
strands are held together, what primers
are and do, and how DNA synthesis is
accomplished.
Use the following address to go directly to
the PCR animations
The web site
http://vector.cshl.org/geneticorigins
is very good. It explains what Alu transposons are, how they make copies of
themselves, and how the copy inserts itself elsewhere.
http://vector.cshl.org/geneticorigins/pv92/a
luframeset.htm
First open the web site.
Click on the PV-92 insertions icon
Click on Continue on to Alu Insertion
Polymorphisms
Answer the following based on the website introduction
Click on MEDIA/ANIMATION
Then click on Polymerase Chain Reaction
70
What is a primer, and what do they do?
What two innovations are important to
PCR?
Next press “Menu” (lower left on the screen),
then click on “Amplification”
Try to answer the following questions as
you proceed through the PCR animation.
Be sure to ask your instructor if you can
not figure out the answers.
What holds the DNA strands together?
Why is a high temperature required
during denaturation?
What happens during the annealing
step?
Why must the temperature be reduced
during the annealing step?
What happens during the extend primers step?
Note that you can repeat a step many
times. This is helpful to reinforce what is
going on at a given step.
Press “Go to Second Cycle” and continue until you see the results of the fifth cycle.
When finished with the PCR animation,
Click on the Menu (lower left on the screen). Then
Click on Amplification Graph. Keep
clicking on Next Cycle until you have 25
cycles.
How many copies of the targeted region are there after 25 cycles?
Please visit this web site and answer
all of the questions before you go lab
to do Step three (PCR to amplify DNA
region that may or may not have PV92)
.
71
Two very important facts regarding PCR are
1. primers determine the beginning and end of
a specific segment DNA to be amplified
2. the number of DNA segments doubles after
each cycle (separating DNA strands, primer
binding, and extending the primer)
Using PCR to detect the presence of PV-92
So how does PCR allow one to determine
if they have one, two, or no copies of the
pv-92 transposon? First recall that pv-92
is located in an intron of chromosome
#16, and that everyone has two chromosome #16’s (one contributed from their
mother, and the other one contributed
from their father at the time of conception).
In the following example both chromosome #16’s of an individual is shown. In
this case, the intron of one of the person‘s
#16 chromosomes has the pv-92 transpo
son, and the intron of this person’s other
chromosome #16 does not have pv-92.
Arrows show where the primers used in
PCR will bind. Primer one will determine
the beginning, and primer two will determine the end of the intron region that PCR
will make millions of copies of.
In this example case, PCR would make
millions of copies that are 550 bases
(does not have pv-92), and also millions
of copies that are 850 bases (has pv-92).
The next step would be to sort out and
look at these two different sized pieces.
72
Determining PCR product size
It should be apparent from the two examples that the size of the amplified segment
is used to determine the presence of the
300 base pv-92 transposon. If the amplified segment is 550 bases long, then it
does not contain the transposon. However, if the amplified segment is 850 bases
long, then the amplified segment contains
the 300 base transposon. How then does
one determine the size of the PCR product? The method used is called electrophoresis. First, DNA samples are loaded
onto a gel, and electric current is applied.
Because DNA is uniformly negatively
charged, DNA is caused to migrate
through the gel toward the positive electrode. Shorter molecules migrate faster
then longer ones. Often DNA of known
sizes (a ladder) is run in the same gel.
The following is an example of a gel run in a previous Bio 111 class. Samples were loaded
in at the top.
A
B
C
1000
500
100
Discuss the following with others at your table.
Which sample B or C contained DNA segments that were shorter?
Noting the band of the ladder that is 500 bases, approximately how big is the DNA of sample C?
How can you explain the two DNA bands of sample A?
Which band A, B, or C is homozygous without the transposon? Explain
Which band A, B, or C is homozygous with the transposon? Explain
Which band A, B, or C is heterozygous with transposon? Explain
73
Laboratory Procedure
As illustrated below, this exercise has four
distinct steps. Since all four steps cannot
be completed in one three hour session,
the different steps will be completed over
the course of several weeks. When working on any given step, it is a good idea to
be aware of the overall exercise.
Step one
Step one
extract
cheek cells
Step two
Isolate DNA
Step three
Amplify (PCR) DNA region
that may or may not have pv-92
Cheek Cell Extraction
Do not consume food or drink for at least
30 minutes prior to cheek cell extraction.
1. With a sterile cotton swab, gently
scrape the inside of one cheek six times.
Without rotating the swab, move the swab
directly over to the inside of the other
cheek and gently scrape six times.
2. Gently touch part of the swab containing your cheek cells on a clean glass slide
once. Add a drop of methylene blue, then
a cover slip. Examine using the high dry
objective.
Step four
electrophoresis to resolve
amplified regions, & analyze
3. Insert the cotton portion of the swab
into the mouth of a 1.5 ml microcentrifuge
tube. The, using scissors or a pair of
dikes, cut off the stick just above the cotton so that the cotton part falls into the
tube. Close the lid, use a water insoluble
ink to label your tube, and place the tube
into the rack provided by your instructor.
Your instructor will then place the tubes in
the freezer (-20o) for storage.
4. Make a drawing of your cheek cells in
the box provided below, be sure to
indicate the magnification.
74
Step two
Step one
extract
cheek cells
Step two
Isolate DNA
Step three
Amplify (PCR) DNA region
that may or may not have pv-92
DNA Isolation
1. Add 400 l of phosphate buffered saline
(PBS) to the tube containing the cotton
swab coated with your cheek cells.
2. Add 400 l of Qiagen buffer AL. This
contains a detergent to aid in cell disruption, and to solubilize hydrophobic compounds.
3. Add 20 l of protease K solution.
Close the lid and vortex immediately for
15 seconds. Immediate mixing is required
to maximize cell lysis. This enzyme digests proteins, which will aid cells lysis,
and in isolating the DNA.
4. Place your microcentrifuge tube in a
heat block set to 56o, and incubate for ten
minutes. Remove the tube and tap the
tube on the counter to cause droplets, that
may have condensed on the inside of the
lid, to fall into the solution below.
5. Add 400 l of pure ethanol (190 –200
proof). Vortex for 15 seconds. This
amount of ethanol will cause the DNA to
precipitate but will leave the other compounds (proteins, carbohydrates, lipids,
and salts) to remain in solution.
6. Remove 700 l and place into a QIAamp spin column that is seated in a 2 ml
microfuge tube. Centrifuge at 8000 RPM
for one minute. At this point the precipitated DNA is retained by the filter in the
spin column, and the soluble compounds
have been forced to the tube below.
Step four
electrophoresis to resolve
amplified regions, & analyze
7. Add 500l Quiagen buffer AW1 without wetting the rim of the spin column.
Centrifuge at 8,000 RPM for one minute.
This, and the next step serve to wash the
DNA. Since these wash solutions contain
ethanol, the DNA remains precipitated
and unable to pass through the filter in the
spin column. Discard the tube containing
the filtrate, and insert the spin column into
a new 2 ml microfuge tube.
8. Add 500 l of Qiagen buffer AW2 without wetting the spin column rim. Centrifuge at 14,000 for 3 minutes. Complete
removal of the AW2 buffer is necessary
as its presence would prevent subsequent
resolubilization of the DNA trapped in the
spin column. Therefore, carefully remove the 2 ml microfuge tube to avoid
splashing the filtrate back on to the spin
column. Discard the microfuge tube containing the filtrate.
9. Insert the spin column into a sterile 1.5
ml microfuge tube. Add 150 l of AE
buffer. This buffer has no ethanol and will
bring the precipitated DNA back into solution. Incubate at room temperature for
one full minute to give the DNA time to
dissolve in the buffer.
10. Centrifuge at 8,000 RPM for one minute. The collection tube now contains
your isolated DNA in solution. Label the
tube with a water insoluble marker, and
place it in the rack provided by your instructor. You instructor will store the
tubes at –20oC.
Discard the tube containing the filtrate,
and insert the spin column containing your
DNA into a new 2 ml microfuge tube.
75
Step three
Step one
extract
cheek cells
Step two
Isolate DNA
Step three
Amplify (PCR) DNA region
that may or may not have pv-92
Polymerase Chain Reaction (PCR)
1. Obtain a PCR reaction tube containing
a PCR reaction bead
2. Add the following
 10l of your own isolated DNA
Step four
electrophoresis to resolve
amplified regions, & analyze
How many cycles is the machine programmed for?________
Once the reaction has started, observe
the PCR animation on the computer
hooked up to the web!
and

15 l of the primer/loading dye
mixture
3. Close the PCR reaction tube lid, and
mix the contents. Gently tap the tube on
the counter to cause all the liquid to go to
the bottom of the tube
4. Place you reaction tube into the thermocycler, and record its location.
Location _______________
5. After your instructor starts the 9700
thermocycler, observe one complete cycle. Be thinking about what is occurring at
each of the steps in a given cycle. Then,
record the temperature for the following:
Denaturation _______
Annealing _________
Extension_________
Once the program has run its course, your
instructor will remove the tray containing
all the reaction tubes, and will store them
in the in the freezer.
Considering that each cell has billions of
nucleotides arrayed on 46 chromosomes,
how many places will the primers, shown
below anneal to?
Notes:
The PCR reaction beads contain
 Taq polymerase, a temperature resistant
DNA polymerase,
 Mg ions needed by the enzyme,
 buffer to maintain the correct pH, and
 A, T, G, and C nucleotides.
The primer mixture contains two primers, one for
the beginning and one for the end of the region to
be amplified. The sequences
of these two primers are
5’ AACTGGGAAAATTTGAAGAGAAAGT, and 5’ CTCAAGAAACAGAAGCCCTGTCACC
76
Step four
Step one
extract
cheek cells
Step two
Isolate DNA
Step three
Amplify (PCR) DNA region
that may or may not have pv-92
Step four
electrophoresis to resolve
amplified regions, & analyze
Electrophoresis to resolve amplified regions and analysis
Work in groups of 6
1. Following instructions given by your instructor, prepare a two percent agarose
gel as follows:
o weigh out 0.40 grams of agarose
o add to a 50 ml flask containing 20
ml of TAE buffer
o microwave on high for 30 seconds
o use tongs, as the flask is now very
hot, and swirl the contents to insure
all of the agarose is dissolved
o allow solution to cool before pouring
into the gel casting tray.
4. Each student of the group is to load 10
l of their own PCR product into a well.
Since the PCR reaction mix already contains a loading buffer, there is no need to
add additional loading buffer to it.
2. When the gel is solidified, takes about
10 minutes, pour TAE buffer into the reservoirs until there is about one millimeter
of buffer above the gel
6. When the loading buffer dye is between
half and three quarters across the gel,
turn off the power supply.
3. At least one well per gel is to have a
100 bp ladder. One person of the group
should load 5 l of the ladder (already
contains a loading buffer) into the center
well.
5. Secure the gel tank cover in place, attach electrical cables, set the power supply to 85 volts (this gives a field strength
of 5 volts per centimeter), and press the
start button.
7. Wearing eye protection and gloves, lift
the tray containing the gel out of the gel
tank, and carry it to where the ethidium
bromide containers are located
.
.
ETHIDUIM BROMIDE IS A CARCINOGEN
Gloves and full eye protection
must be used whenever working close to ethidium bromide
8. Hold the tray close to the ethidium
bromide solution. Using one finger, protected by gloves, gently push the gel into
the ethidium bromide solution. Let sit for
about 10 minutes. During this time, ethidium bromide binds to DNA.
9. Use a spatula to transfer the gel from
the ethidium bromide solution to water.
77
Let sit an additional 10 minutes. During
this time unbound ethidium bromide diffuses into the water. This will result in a
cleaner, sharper picture.
10. Still wearing gloves and eye protection, pour out the water from the rinse
tray, and carry the tray containing the gel
over to the Gel Doc 2000. Use a spatula
to transfer the gel on to the transilluminator of the Gel Doc 2000. Your in-
structor will point out the orange fluorescence of ethidium bromide bound to DNA,
will capture the image, and will print out
one copy for each student. Paste the picture of this gel next to the gel shown below.
11. Use the 100 bp ladder to determine
the size of each DNA band. From the results determine your genotype with respect to the Alu-pv92 insert.
78
Where is pv 92?
As stated earlier in this exercise, pv 92 resides in an intron within a gene that is located on
chromosome 16. However, a question students ask is “what is the name of the gene that
houses the intron that pv 92 resides in?” This part of the exercise, actually an outside of
class assignment, is to answer this question using state-of-the-art tools currently used in
industry.
Each chromosome is essentially a very long DNA molecule that contains the bases A, T, G,
and C bonded together in a very long chain. Importantly the human genome has been sequenced, that is from the tip to the end of each chromosome researchers have determined
the actual sequence of As, Ts, Gs, and Cs. It has been found that each region of the
chromosome, each gene, has its own unique sequence of As, Ts, Gs, and Cs. So, if one
knew the sequence of a region like an intron, one could simply scan the entire DNA sequence to locate precisely where on which chromosome this sequence is located. This is
exactly what you will do. However, there is one problem. You need the sequence of the
intron pv 92 resides in. Recently several Cal Poly undergraduate students did this, and the
sequence is posted on a web site. So how do you find where on chromosome 16 this sequence is located? You will use a data base that contains the human genome. The following will lead you through the steps.
First, obtain the intron sequence. Visit the following website: www.bio.calpoly.edu/ubl
Click on “protocols,” then click on “Alu sequence.” Copy the entire sequence.
Visit the UCSC web site at: http://genome.ucsc.edu/cgi-bin/hgGateway.
Click on “Blat” at the top of the screen
Home - Genome Browser - Blat - Table Browser - FAQ - Help
Human Genome Browser Gateway
Human BLAT Search
BLAT Search Genome
Genome:
Human
Assembly:
July 2003
Query type:
BLAT's guess
Sort output:
query,score
Output type:
hyperlink
Please paste in a query sequence to see where it is located in the genome. Multiple
sequences can be searched at once if separated by a line starting with > and the
sequence name.
Submit
Reset
79
Rather than pasting a sequence, you can choose to upload a text file containing the sequence.
First make sure “July 2003” appears in the Assembly box.
Next, click in the box, and then paste in the sequence you copied from Cal Poly’s UBL site.
Then click on the submit button. The site’s software will begin scanning the entire genome,
and will stop when it finds a match to the sequence you submitted. It is incredibly fast!
When finished the Blats Search results will be displayed.
80
BLAT Search Results
ACTIONS
QUERY
SCORE START END QSIZE IDENTITY CHRO STRAND START
END
--------------------------------------------------------------------------------browser details YourSeq
453
2
462
468 100.0%
16 - 826917 82692186
browser details YourSeq
21
196
217
468 100.0%
7
+ 108763513 108763536
Next, click on “browser” for chromosome 16
The next screen (below) to come up is complicated. For the purpose of this class all we
need is the name of the gene, and to know what the gene does. Cick on CDH13. The
screen to come up will give you all of this information! Read the summary at the top of the
page. Your instructor will later help you understand function of this gene.
Home
DNA
BLAT
Tables
Convert
Ensembl
Map View
PDF/PS
Guide
UCSC Genome Browser on Human July 2003 Freeze
move
<<<
<<
<
>
>>
1.5x
Click here
to get the
name of
the gene
position
chr16:82,689,624-82,694,283
>>>
3x
zoom in
1.5x
3x
10x
base
zoom out
10x
size 4,660 bp. image width:
620
jump
81
Powerful stuff!
82
Review Questions:
1. Indicate the genotype of each lane in the gel below. Also indicate which bands have the
Alu-pv92 insert, and which bands do not contain the Alu-pv92 insert.
2. What is lane 6 of the above gel, and how is it used?
3. See the questions on page 73
4. What is a primer, and how is a primer used in PCR?
5. Starting with a gene, make an annotated flow diagram that illustrates transcription, intron removal, protein synthesis, and finally function of the protein coded for by the gene.
6. What are the three steps in a PCR cycle, and what do each do?
7. Compared to the amount of DNA at the beginning of one PCR cycle, how much DNA is
present at the end of that cycle? How many copies of the DNA region targeted by the primers present after 30 cycles? (see the web site http://vector.cshl.org/geneticorigins)
8. What is an exon, intron, and promoter?
9. Describe the possible effects on the production of a functional gene product (protein) if a
transposon was inserted into an exon, intron, or promoter of a gene.
10. What does gel electrophoresis do, and how is this accomplished?
11. Why is it necessary for DNA strands to separate during DNA replication?
Compare how the separation of DNA strands occurs during DNA replication in a human cell
with how DNA strands are separated in PCR.
12. What does Taq polymerase do in PCR? What is the source of Taq polymerase?
Compare the properties of Taq polymerase with human DNA polymerase.
13. The following questions relate to DNA isolation: What was accomplished when cheek
cells were incubated with detergents and proteinase K? Why was ethanol added? What
purpose did the filter in the spin column serve?
14. If your mother were homozygous with pv-92 and your father was homozygous without,
then what pattern on the gel you expect from your DNA? Explain
83