Modified from http://www.mhhe.com/brooker
BIO 184
Fall 2006
LECTURE 4
Lecture 4:
Mutagenesis and Protein Function
Processing of human amyloid precursor protein (APP). Mutations in the APP gene that increase
beta-secretase’s affinity for its cleavage site on the APP protein or mutations in the gene coding
for γ-secretase that increase its affinity for the APP-CTFβ intermediate can cause early-onset
Alzheimer’s disease. Deposition of abnormally large amounts of Aβ product causes neuronal
breakdown and dementia. Diagram downloaded from: http://www.pubmedcentral.org/articlerender.fcgi?artid=1538601
I. General Types of Mutations

The term mutation refers to a heritable change in the genetic material

Mutations provide allelic variations
o On the positive side, mutations are the foundation for evolutionary
change
o On the negative side, mutations are the cause of many diseases
Page 1
Modified from http://www.mhhe.com/brooker
BIO 184
Fall 2006
LECTURE 4

Mutations can be divided into three main types:
1. Chromosome mutations
 Changes in chromosome structure
2. Genome mutations
 Changes in chromosome number
3. Single-gene mutations
 Relatively small changes in DNA structure that occur within a
particular gene

Only single-gene mutations will be discussed here. We’ll have future
lectures about chromosome and genome mutations.
II. Types of Single Gene Mutations

Single-gene mutations change the DNA sequence within a single gene.
o A point mutation is a change in a single base pair
 It involves the substitution of one base pair for another
5’ AACGCGAGATC
5’ AACGCTAGATC
3’
3’
 A transition is a change of a pyrimidine (C, T) to another
3’G) toTTGCGCTCTAG
pyrimidine or of a purine (A,
another purine
3’ TTGCGATCTAG
 E.g. C → T is a transition point mutation
5’
5’
 Transitions are more
common than transversions

A transversion is a change of a pyrimidine to a purine or vice
versa
 E.g. C → A is a transversion point mutation
o Insertions or deletions can also occur


These can involve a single base-pair or multiple base-pairs
See diagram at top of next page
Page 2
Modified from http://www.mhhe.com/brooker
BIO 184
Fall 2006
LECTURE 4
5’ AACGCTAGATC
3’
3’ TTGCGATCTAG
5’
5’ AACGCGC
3’
3’ TTGCGCG
Deletion of four base pairs
5’
5’ AACGCTAGATC
3’
3’ TTGCGATCTAG
5’
5’ AACAGTCGCTAGATC
3’
3’ TTGTCAGCGATCTAG
5’ Addition of four base pairs
III. Consequences of Gene Mutations

Mutations in the coding sequence of a protein-coding gene can have various
effects on the polypeptide
o Silent mutations are those point mutations that do not alter the
amino acid sequence of the polypeptide
 Due to the degeneracy of the genetic code
o Missense mutations are those point mutations in which an amino acid
change does occur
 Example: Sickle-cell anemia (Refer to Figure 16.1 in Brooker)
 If the substituted amino acids have similar chemistry and the
protein’s function is not affected, the mutation is said to be
neutral
o Nonsense mutations change an amino acid codon into a stop codon
 Causes early termination of translation
 Protein is often non-functional
See Table 16.1, Brooker
o Frame shift mutations result from insertions and deletions
 If the number of nucleotides in an insertion or deletion is not
divisible by 3, translation of the gene’s mRNA will be adversely
affected
Page 3
Modified from http://www.mhhe.com/brooker
BIO 184

Fall 2006
LECTURE 4
All codons 3’ to the insertion or deletion will be read in
the “wrong frame” and the polypeptide will become
gibberish
o This usually also leads to a shortened polypeptide
because a stop codon is encountered fairly quickly
in the shifted frame
5’ – ATG ACC GAC CCG AAA GGG ACC … 3’
met thr asp pro lys gly thr
5’ – ATG ACC GAC GCC GAA AGG GAC C … 3’
met thr asp ala glu arg asp
IV. Mutations in Non-coding Regions that Affect Gene Expression
or Function

Mutations in promoters
o “Up” promoter mutations make the promoter more like the consensus
sequence
 They may increase the rate of transcription
o “Down” promoter mutations make the promoter less like the
consensus sequence
 They may decrease the rate of transcription

A mutation can also alter splice junctions in eukaryotes and cause exons to
be skipped or introns to be included in the mature mRNA
See Table 16.2, Brooker
V.
Trinucleotide Repeat Mutations

Several human genetic diseases are caused by an unusual form of mutation
called trinucleotide repeat expansion (TNRE)
Page 4
Modified from http://www.mhhe.com/brooker
BIO 184

Fall 2006
LECTURE 4
These diseases include (among several others)
o Huntington disease (HD)
o Fragile X syndrome (FRAXA)
See Table 16.3, Brooker

Certain regions of the chromosome contain trinucleotide sequences repeated
in tandem
o In normal individuals, these sequences are transmitted from parent to
offspring without mutation
o However, in persons with TRNE disorders, the length of a
trinucleotide repeat increases above a certain critical size
 It also becomes prone to frequent expansion
 This phenomenon is shown here with the trinucleotide repeat
CAG
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
n = 11
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
n = 18

In some cases, the expansion is within the coding sequence of the gene
o Typically the trinucleotide expansion is CAG (glutamine)
 Therefore, the encoded protein will contain long tracks of
glutamine
 This causes the proteins to aggregate with each other
o This aggregation is correlated with the progression
of the disease

In other cases, the expansions are located in noncoding regions of genes
o These expansions may decrease (or halt) expression of the gene or
result in changes in RNA structure that disrupt its splicing
Page 5
Modified from http://www.mhhe.com/brooker
BIO 184
Fall 2006
LECTURE 4
VI. Other Ways of Categorizing Mutations
A. Germ-line versus Somatic

Geneticists classify the cells of multicellular organisms into two types
o Germ-line cells
 Cells that give rise to gametes such as eggs and sperm
o Somatic cells
 All other cells

Germ-line mutations are those that occur directly in a sperm or egg cell, or
in one of their precursor cells

Somatic mutations are those that occur directly in a body cell, or in one of
its precursor cells
See Figure 16.4, Brooker
Example of a somatic mutation. The singer Bonnie
Raitt has a patch of gray hair in the middle of her
forehead. This is the result of a somatic mutation
during embryogenesis that disrupted a gene involved
in hair pigmentation in a single cell. This cell then
went on to divide to produce a patch of cells that
could not produce pigment. (Photograph from
http://www.imdb.com/name/nm0707248/)
B. Forward versus Reverse

In a natural population, the wild-type is the most common genotype
o A forward mutation changes the wild-type genotype into some new
variation
 If it is beneficial, it may move evolution forward
 Otherwise, it will be probably eliminated from a population
Page 6
Modified from http://www.mhhe.com/brooker
BIO 184

Fall 2006
LECTURE 4
A reverse mutation changes a mutant genotype back into its original, wildtype form
o Much less common than forward mutations because they must be much
more specific (undo the prior mutation exactly)
C. Survival Potential

Mutants are often characterized by their differential ability to survive
o Deleterious mutations decrease the chances of survival of the mutant
 The most extreme are lethal mutations
o Beneficial mutations enhance the survival or reproductive success of
an organism
o
Conditional

Some mutations are called conditional mutants
o They affect the phenotype only under a defined set of conditions
o Siamese cats are temperature sensitive conditional mutants
 They have a coat color gene that produces pigment only at
temperatures below core body temperature
 This causes the cooler parts of their bodies (face, ears, feet,
and tail) to be pigmented while their core body color is white
D.
http://www.animal-pictures.duble.com/pictures-photospics/cat-breed/siamese-cat
Page 7
/siamese-cat-pictures-photos-pics.htm
Modified from http://www.mhhe.com/brooker
BIO 184
Fall 2006
LECTURE 4
VII. Two Examples of the Effect of Mutations on Protein Function
The seriousness of the phenotype conferred on an organism by a mutation depends
on the type of mutation as well as the location of the mutation within the gene
sequence. Mutations within an intron of a gene may have no effect at the
phenotypic level while mutations within an exon coding for the active site of an
enzyme can be extremely serious.
Let’s explore two examples in depth:
A.
X-Linked Muscular Dystrophy

Two clinically distinct forms
o Becker Muscular Dystrophy (BMD)
o Duchenne Muscular Dystrophy (DMD).
o Both disorders arise from mutations within the same gene.

The gene involved is
o Located on the X chromosome
o Extremely large at over 2 million base pairs in length. (The average
size of a human gene is about 20,000 base pairs.)
o Codes for a muscle protein called dystrophin, which is part of an
interconnected system of proteins that extends from the F-actin
myofilaments in the cytoplasm of muscle cells to the rigid matrix that
surrounds each muscle cell. This network is critical because it
prevents stress-induced rupturing of the muscle cell plasma
membrane during muscle contraction.
http://www.novocastra.co.uk/mddgs.htm
Page 8
Modified from http://www.mhhe.com/brooker
BIO 184
Fall 2006
LECTURE 4

Because of the large size of the gene, it suffers about a 10-fold higher
mutation rate than average.
o In fact, given the production of 8 x 107 sperm per day, a normal male
produces a sperm with a new mutation in the dystrophin gene every 10
or 11 seconds!

Individuals who carry at least one “good” copy of the dystrophin gene are
protected from the disease.
o However, since the gene is located on the X chromosome and males
only carry a single copy of the X chromosome, boys who inherit even a
single mutated copy of dystrophin gene suffer from the disease.
o Females are rarely affected since they carry two copies of the X
chromosome.

DMD is a much more severe disease than BMD and accounts for about 85%
of all cases of X-linked muscular dystrophy.
o Affected boys are generally normal during the first year or two of
life but develop muscle weakness at age 3 to 5 years, when they begin
having difficulty climbing stairs and rising from a sitting position.
o The child is confined to a wheelchair by the age of 12 and is unlikely
to survive past the age of 20. Patients die of respiratory failure or,
because the myocardial muscle is also affected, heart failure.

BMB patients are clinically separated from DMD patients if they are still
walking at the age of 16.
o Muscle biopsies can also be used to make the diagnosis.
o Such patients show a significant variability in the progression of the
disease thereafter.

Experiments measuring the dystrophin protein levels in patients have shown
that DMD patients have little or no functional dystrophin, whereas almost all
BMD patients have protein levels that are much higher (though reduced
from the levels found in normal individuals).

Molecular studies of the dystrophin mutations of hundreds of patients with
DMD or BMD have revealed that most cases of X-linked muscular dystrophy
are caused by large deletions that involve exons. (The reason for this is not
known.)
Page 9
Modified from http://www.mhhe.com/brooker
BIO 184
Fall 2006
LECTURE 4
o Interestingly, some of the deletions that cause BMD are as large or
larger than those that cause DMD, even though the same general
region of the protein is involved.
Diagrams taken
from Genetics in
Medicine by
Thompson and
Thompson, 1991
dystrophin mature mRNA



Why do you think that this is the case?
What types of deletions do you predict DMD patients carry? BMD
patients?
What does this tell you about the way that dystrophin functions during
muscle contraction? Which parts of the protein are critical and which
are less critical for its function?
Page 10
Modified from http://www.mhhe.com/brooker
BIO 184
B.
Fall 2006
LECTURE 4
Cystic Fibrosis

Since the 1960s, cystic fibrosis (CF) has been one of the most publicly
visible of all human genetic diseases.
o It is one of the most common fatal childhood genetic disorders, with
an incidence of about 1 in 1,600 among Caucasians.
o One in every 22 Caucasians is a carrier.

The lung and pancreas are the major organs affected by the disease.
o Chronic obstructive lung disease develops as a result of thick
secretions and recurrent infections
 Intense management of lung problems has increased life
expectancy to about 30 years
o Deficiencies of pancreatic enzymes (lipase, trypsin, and chymotrypsin)
prevent normal digestion.

Digestion and nutrition can be largely restored by pancreatic
enzyme supplements.
 Interestingly, about 15 percent of CF patients have
residual exocrine function. These patients are termed
pancreatic sufficient (PS).
 These same patients also have better growth and
pulmonary function and a superior overall prognosis than
do the majority, who are pancreatic insufficient (PI).

The CF gene was isolated in 1989 and has been extensively studied since
that time.
o It lies on the long arm of chromosome 7
o It spans about 250,000 base pairs of DNA with 27 exons
o It encodes for a large transmembrane protein of about 170
kiloDaltons (kD) called the CFTR (CF transmembrane conductor
regulator) protein.

The polypeptide is composed of two repeated motifs, each of which has 6
membrane-spanning regions adjacent to a nucleotide (ATP) binding fold
(NBF).
The two motifs are separated by a cytoplasmic region that has a regulatory
function and is thus named the R domain.

Page 11
Modified from http://www.mhhe.com/brooker
BIO 184

Fall 2006
LECTURE 4
A diagram of the protein, showing its transmembrane crossings, is provided
below.
o Keep in mind, however, that the actual protein has a 3-D structure in
which the transmembrane regions contact one another to form a
round pore (channel) in the membrane.
Diagram from Genetics in Medicine

Defects in the protein disrupt the normal flow of chloride ions into and out
of epithelial tissues because the protein is a regulated chloride channel.

Binding of ATP to the NBFs apparently activates the channel. When the
channel malfunctions, salt accumulates inside the cells.
o This causes water to flow into the cells to relieve osmotic pressure,
leaving behind a thick mucous that clogs pancreatic ducts and creates
a breeding ground for bacteria in the lungs.
o The genital tract is also affected and only 2-3% of males and 10% of
females are fertile.

An individual must have two disrupted copies of the gene to have the
disease.
o Mutations of all types except major deletions and rearrangements
have been found throughout the coding region, including small
deletions and insertions and point mutations of all types.
o The types and locations of the most common mutations, along with
their associated phenotypes, are given below.
1. Deletion of phenylalanine 508 due to a 3 bp deletion
70% of all CF mutations are caused by a three base-pair deletion that
eliminates the 508th amino acid in the polypeptide, which is a
phenylalanine (F). This deletion is written as ΔF508 and, because it
Page 12
Modified from http://www.mhhe.com/brooker
BIO 184
Fall 2006
LECTURE 4
involves three base-pairs, does not change the reading frame during
translation. Nonetheless, the mutation is very deleterious. All patients
who are homozygous for this mutation have the more severe (PI) form
of the disease.
The missing phenylalanine is located within the first NBF (NBF-1) and
prevents the protein from properly inserting into the plasma
membrane. Patients have virtually no functional CFTR in the plasma
membranes of their epithelial cells and chloride ions remain trapped
inside these cells, leading to the disease.
2. Deletion of isoleucine 507 due to a 3 bp deletion
ΔI507 is also caused by a 3 base-pair deletion. This mutation results
in the loss of an isoleucine immediately adjacent to the phenylalanine
lost in the Δ508 mutation. As might be expected, this mutation also
confers the PI form of the disease.
3.
Missense mutations in the NBF
NBF missense mutations are also fairly common. Those that confer
the PI phenotype result in changes in amino acids that are highly
conserved in homologous ATP-binding domains of other proteins.
Those that confer the PS phenotype cause changes in amino acids that
are not highly conserved.
4.
Missense mutation in amino acid 117
117 arg → his is a less common mutation but is interesting because it
is associated only with the PS phenotype. This missense mutation
results in a change from an arginine to a histidine at amino acid 117,
which is located in a part of the protein that sits in the extracellular
environment (see diagram, next page).

Some individuals have a phenotype intermediate between PI and PS (e.g. PI
but mild lung disease). Many of these individuals are heterozygous, carrying
the Δ508 allele on one of their copies of chromosome 7 and a different
mutation that causes a milder phenotype on the other.
Page 13
Modified from http://www.mhhe.com/brooker
BIO 184
Fall 2006
LECTURE 4

There are probably many phenotypically normal people who have two mutated
copies of the CF gene. However, both their mutations are either “silent” or
confer such a mild phenotype that the disease is never diagnosed.

A diagram of the CF gene and CFTR protein, along with information about
various mutations and their associated phenotypes is given below.
Diagram from Genetics in Medicine
Page 14