Finding Genes With Similar Sequences
(Blast Search)
1. Open your Web Browser such as Internet Explorer and type in the following address
http://www.ncbi.nih.gov/
2. From the above website choose BLAST which is in the toolbar above the search box.
3. You will then need to choose the appropriate databases to search depending on what type of
DNA you have sequenced. (DNA isolation is genomic) If you are searching using a
nucleotide sequence from a known organism and this organism is listed under “Genomes”
select that organism.
4. Once you have chosen your database you will be given search options. Select proper
database (Genome for most samples collected from genomic DNA) and program (blast n if
you are using a nucleotide sequence).
5. Copy your DNA sequence and Paste it into the Search box.
For an example copy the following code and paste it into the search box:
gtcaactgggctccattcattctttccatttctctaacacgtgccaggtggtctcatctccgggcctttgcccttgctgtt
ccctgtcatcattcaggtctcacttgtcatttcctgaccatggtacttataaaagcagtgccgtctgccccatccatgtca
cctcgttcatctccttcacctccgaaatgatctcgcttttgggtttacggccggtctcttcacctggagcatcagccgggg
aggtcagggtcccctggctcgggcctgttcacattggggtcaaaggcacacattgggggctcaaccaaggcgagctcgttc
gcggggccgggtctttccgcacaggcggagggcggtggcgggcgcggaggcgtcgcgcgagccagggggcacgcacgggcc
gggggtacctagcgccacccgcttcgcttgcatcagctgcgcgccccatcccgaggaatggtagaggcagccccgcccccg
gcccgcccccgcctttccattggctgccgcgcggggcggggagcggggtcggctcagtggccctgagaccctagctctgct
ctcggtccgctcgctgtccgctagcccgctgcgatgttgcgcgctgccgcccgcttcgggccccgcctgggccgccgcctc
ttgtcagccgccgccacccaggccgtgcctgcccccaaccagcagcccgaggtcttctgcaaccaggtgcgta
6. Hit BEGIN SEARCH
7. Your search is put into a queue and estimated time is given for the completed search.
8. Hit Format! to see your results
9. A screen will appear updating you on the progress of your search.
10. When the computer is finished searching a list of results will be given. Select Genome View
to see the location and identity of your DNA sequence.
11. The red marks next to a chromosome indicate that the sequence in that aria is the same as
the sequence you searched. To see more information about that gene click on the
chromosome of interest.
12. A map will appear showing you the location of your sequence in red, and the known
genes in blue.
13. Use the zoom toggle on the left side of the screen to zoom in to see more detail, or out to
see surrounding genes. (As you zoom out the red line will turn into a dot. This is
because the region sequenced is significantly shorter than most genes, and corresponds to
only a portion of that gene.)
14. Click on the link next to the gene to see more information.
15. Next to “Display” is a pull down menu. Change “Default” to “Gene Table”. This will
give you a list of introns and exons. Click on the link to retrieve the sequence
corresponding to that intron or exon.
16. Click on the link for the “Locus tag” near the top of the Gene Table screen.
17. Select the “GENATLAS” link.
18. This will give you more information about the expression of the gene.