QUESTIONS ABOUT PROTEINS
A. What happens to proteins once they are made?
http://www.stolaf.edu/people/giannini/flashanimat/proteins/protein%20structure.swf
B. What do proteins do?
http://biology.about.com/od/molecularbiology/a/aa101904a.htm
C. What happens to proteins when we change the DNA?
Do DNA: Our Blueprint of Life activity
http://chroma.gs.washington.edu/outreach/genetics/sickle/worksheet.html
D. What is the relationship between DNA, genes, and chromosomes?
http://learn.genetics.utah.edu/units/basics/tour/
Video Clip from Biology: The Science of Life: DNA: The Master Molecule of Life
E. How do genes (DNA) affect who we are?
 Genes and traits
Student surveys

Genes and disease
http://www.ncbi.nlm.nih.gov/books/bv.fcgi?call=bv.View..ShowTOC&rid=gnd.TOC&depth=2
A Hairy Situation
Scenario
As a geneticist, you have been presented with the following problem. A set of
identical twin boys have been born and are now two years old. The problem is that one,
and only one, of the twins is completely bald and has no eye brows or other body hair.
They have come to you to help them understand what is going on.
Tasks (complete on a different sheet of paper)
1. What is your hypothesis regarding this problem?
2. How would you test your hypothesis? What tests would you run on the boys?
Describe what you would be looking for.
3. Below is some data from genetic tests for you to use in your analysis.
4. Having analyzed the given information, draw a conclusion regarding the case.
Was your hypothesis correct?
Include a written explanation to the parents that describes why the two
identical boys have a different trait. The father is a science teacher, so
don’t worry about the vocabulary – he can handle it.
Data from genetic tests
1. Chromosomal analysis found a variation on chromosome 8
2. Sequencing analysis of chromosome 8 found variation on Gene 12. (HR gene)
3. Variation in gene 12 (HR gene) sequence shown below. The rest of the gene is identical.
Boy without condition
TACTTTCGTGGCTGCAAACGTACCGTCCAAGGTCGAAGGTCATGGGCTCTA
TCCTGC
Boy with condition
TACTTACGTGGCTGCTTTCGTACCGTCCAAGGTCGAAGGTCATGGGCTGTA
TCCTGC