SUPPLEMENTARY INFORMATION
Supplementary Materials and Methods
Generation of the minimal CMV promoter
The minimal promoter and enhancer sequences of the CMV were identified according to29-30, assembled (it
contains nucleotides from the start codon -635-614, -545-521, -210+3; nucleotides -613-546, -522-211
were deleted; nucleotides -117-114 and -14 were mutated to create EcoR V and Xho I restriction sites,
respectively).The minimal CMV promoter sequence is as follow (start codon in Bold):
GTTGACATTGATTATTGACTAGTACGGTAAATGGCCCGCCTGGCTGATGACTCACGGGGATTTCCAAG
TCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCG
TAAGATATCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGA
GCTCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTCTCGAGATTCCACCATG
Real-time quantitative PCR
Three weeks after injection, retinas from three different animals were dissected from the eyecup. RNA was
isolated using TRIZOL reagent (Gibco life technologies) according to the manufacturer’s manual, and after
the final precipitation dissolved in RNase-free water. After genomic DNA degradation with RNase-free
DNase I (New England Biolabs), 1 µg of total RNA was reverse transcribed into first-strand cDNA with
Superscript III Plus RNase H-Reverse Transcriptase (Invitrogen) and 50 ng random hexamer primers
during 50 min at 50°C in a total volume of 20 µl. To the resulting cDNA sample, 14 µl of 10 mM Tris, 1 mM
EDTA was added. From all samples, a 1/20 dilution was made and used for qPCR analysis. Forward
primer (5’ CCTCTGTGATGTTGCCTTTGC 3’) and reverse (5’ GTGGTGAAAATGTCGGAGATCAA 3’) for
human CRB1 transcript and forward primer (5’ CAGGAGCGCACCATCTTCTT 3’) and reverse (5’
CGATGCCCTTCAGCTCGAT 3’) for enhanced GFP transcript were designed, with a melting temperature
of 60°C, giving rise to an amplicon of 78 and 106 bp respectively. Real-time qPCR was based on the realtime monitoring of SYBR Green I dye fluorescence on an ABI Prism 7300 Sequence Detection System
(Applied Biosystems, Nieuwerkerk a/d IJssel, The Netherlands). The PCR conditions were as follows: 12.5
µL SYBR Green PCR 2x mastermix (Applied Biosystems), 20 pmol of primers, and 2 µl of the diluted cDNA
(ca 3 ng total RNA input). An initial step of 50°C for 2 minutes was used for AmpErase incubation followed
by 15 minutes at 95°C to inactivate AmpErase and to activate the AmpliTaq. Cycling conditions were as
follows: melting step at 95°C for 1 minute, annealing at 58°C for 1 minute and elongation at 72°C, for 40
cycles. At the end of the PCR run, a dissociation curve was determined by ramping the temperature of the
sample from 60 to 95°C while continuously collecting fluorescence data. Non template controls were
included for each primer pair to check for any significant levels of contaminants. Values were normalized by
the mean of the 3 reference genes hypoxanthine-guanine phosphoribosyltransferase, actin and ribosomal
protein S27a.
Western Blotting
HEK293T cells were plated at 30% confluence in 10 cm plates, 24 hours prior to transfection or infection
day in 10 ml DMEM media supplemented 10% BCS and Pen/Strep. The following day, HEK293T cells were
either transfected with 20 μg of pAAV2-CMV-GFP, pAAV2-CMV-hCRB1 or pAAV2-CMV-hCRB1Δ using the
CaPO4 method or infected with 5.1010 genome copies of ShH10-CMV-hCRB1 or 5.1010 genome copies of
ShH10-CMV-hCRB1Δ together with 5.1010 genome copies of ShH10-CMV-GFP.
72 hours post-transfection or infection, cells were harvested, homogenized and incubated for 30 minutes on
ice in 200 µL of lysis buffer (10% glycerol, 150 mM NaCl, 1 mM EGTA, 0.5% Triton X-100, 1 mM PMSF,
1.5 mM MgCl2, 10 µg/µL aprotinin, 50 mM Hepes pH 7.4 and protease inhibitor cocktail). Cell extracts after
centrifugation at 10.000 rpm at 4°C were fractionated by SDS-PAGE electrophoresis, using 4-12% precast
gels (NuPage Novex Bis-Tris Mini Gels, Invitrogen). After transfer to nitrocellulose membrane and blocking
in 5% BSA in T-TBS buffer (Tris-HCL 50 mM pH7.5, 200 mM NaCl, 0.05% Tween-20), the primary
antibodies rabbit CRB1 AK2 (1/500) and mouse GFP (1/1000) were diluted in T-TBS-5% BSA and
incubated overnight at 4°C. After washing, blots were incubated with goat anti-mouse and anti-rabbit
secondary antibodies conjugated to DyLight Dye-800, Li-COR Odyssey) diluted 1/5000 in T-TBS buffer.
After washing, the blots were then scanned using LI-COR Odyssey IR Imager. These experiments were
performed in independent triplicates.
Supplementary Figures and tables
Figure S1. ShH10Y-CD44 promoters drive GFP expression mainly in Müller glial cells. In vivo
scanning laser ophthalmoscopy at 830 nm (left panel) for native fundus images and at 488 nm for GFP
fluorescence (middle panel) of four Crb1-/- mice, at three 3 weeks after subretinal injection of 109 genome
copies of AAV2/ShH10Y-full length CD44-GFP, (a) showed just above detection level of GFP in the left and
bottom area of the retina. A representative transversal retinal section (right panel) showed low GFP
expression in Müller glial cells and fewer GFP-positive photoreceptor and retinal pigment epithelium cells.
Confocal imaging of Crb1-/- retinas, analyzed 3 weeks after intravitreal injection of 1010 genome copies of
AAV2/ShH10Y-full length CD44-GFP, and immunostained with glutamine synthetase (b), SOX9 (c), CD45
(d; a marker for activated microglia cells) and GFAP (e; a marker for stressed Müller glial cell and gliosis),
showed in affected areas stronger GFP expression associated with increased gliosis, ectopic localization of
Müller glia nuclei (c; arrowhead) and activated microglia cells surrounding the highly GFP-positive Müller
glial cells (d; arrowhead). Confocal imaging of Crb1-/- retinas, analyzed 3 weeks after subretinal injection of
1010 genome copies of AAV2/ShH10Y-full length CD44-GFP, showed also increased GFP expression colocalizing with strong GFAP expression in affected areas (g) in contrast to normal areas (f). GCL, ganglion
cell layer; GFAP, glial fibrillary acidic protein; INL, inner nuclear layer; ONL, outer nuclear layer. n = 4.
Scale bar: 50 µm (a-g).
Figure S2. Use of a minimal CMV promoter reduced the number of GFP-expressing retinal pigment
epithelium cells via the subretinal route. In vivo scanning laser ophthalmoscopy at 830 nm (left panel)
for native fundus images and at 488 nm for GFP fluorescence (middle panel) of Crb1-/- mice, analyzed 3
weeks after subretinal injection of 109 genome copies of AAV2/9-minimal CMV-GFP, (a) showed strong
GFP expression. A representative transversal retinal section (right panel) revealed many GFP-positive cells
mainly Müller glial, photoreceptor and retinal pigment epithelium cells. Confocal imaging of immunostaining
of glutamine synthetase (b; a marker for Müller glial cells), PKCα (c: a marker for bipolar cells), calretinin
(d; a marker for amacrine cells) and cone arrestin (e; a marker for cones) showed GFP expression mainly
in Müller glial cells, rods and cones and few bipolar cells (c; white arrowheads). Transduction profiles (f) of
four retinas injected with AAV2/9-full length CMV or minimal CMV-GFP at 109 genome copies revealed that
the minimal CMV promoter lead to a decreased proportion of GFP-positive retinal pigment epithelium cells
compared to the native CMV. GCL, ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer;
PRC, photoreceptor cells; RPE, retinal pigment epithelium. Data are presented as mean ± s.e.m and n =
3/promoter. *P<0.05. Scale bar: 50 µm (a, b, e), 25 µm (c-d).
Figure S3. No CRB1 expression from an AAV full length CMV promoter vector and potential toxicity
due to CRB1 vectors. Three weeks post-subretinal injection of 109 genome copies of AAV2/5-CMVhCRB1 (and 1/10 AAV2/5-CMV-GFP) in Crb1-/- retinas, CRB1 protein was barely detected only at the site
of injection in few photoreceptor segments and somata (a). Whereas Crb1-/- retinas injected subretinally
with CMV-hCRB1 109 genome copies (and 1/10 CMV-GFP) packaged with AAV6, ShH10 or ShH10Y
showed GFP but no CRB1 protein expression, hCRB1 transcripts were detected as well as GFP transcripts
(b). Efficient expression of CRB1 and GFP proteins were detected by western blotting after transfection of
pAAV2-full length CMV-CRB1 and pAAV2-CMV-GFP in HEK293T cells (c). After packaging in AAV2ShH10 capsids of the same plasmid and infection of HEK293T cells, GFP was detected whereas almost no
CRB1 protein was detectable (c). Three weeks after subretinal injection of AAV2/9-CMVmin-hCRB1,
AAV2/9-hGRK1-hCRB1, AAV2/9-CMV-hCRB1Δ and AAV2/9-hRHO-hCRB1Δ, a decrease of the ONL
thickness was observed in some areas of Crb1-/- retinas (d). Retinas injected with AAV2/9-CMV-hCRB1Δ
displayed the most severe damage, with loss of Müller glial cells (f) compared to non affected areas (e),
large vacuole of phagocytosis (autofluorescence) in CD11b-positive immune cells (g; arrowheads) and the
presence of T lymphocytes (h; arrowheads) in the most affected areas. INL, inner nuclear layer; ONL, outer
nuclear layer; RPE, retinal pigment epithelium. Data are presented as mean ± s.e.m and n = 3/capsid.
Scale bar: 25 µm (a, d-h).
Figure S4. Characterization of minimal human GRK1 and Rhodopsin promoters. A representative
transversal retinal section, 3 weeks after subretinal injection of 109 genome copies of AAV2/5-hGRK1-GFP,
showed that GFP positive cells were cones (a; cone arrestin) and rods (b; rhodopsin) and few retinal
pigment epithelium cells. A representative transversal retinal section, 3 weeks after subretinal injection of
1010 genome copies of AAV2/5-hRHO-GFP, showed that GFP positive cells were only rods (d; rhodopsin)
and not cone (c; cone arrestin). hGRK1, human G protein-coupled receptor kinase 1 promoter; INL, inner
nuclear layer; IS, inner segment; ONL, outer nuclear layer; OPL, outer plexiform layer; OS, outer segment;
hRHO, human Rhodopsin promoter; RPE, retinal pigment epithelium. n = 4/promoter. Scale bar: 25 µm (ad).