Task 1
A) You have isolated genomic DNA including the gene you want to clone. You know
the sequence of this gene and of the flanking regions. The corresponding sequence
is given below: the gene is marked in bold. Explain why restriction endonucleases
are essential for your further work. Remember that you want to clone gfp into E.coli.
5’ 
CTTTGCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAACT
CTCTACTGTTTCTCCATACCCGTTTTTTTGGGCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATA
TAGATATGGCTAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGT
GATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAGCTTAC
CCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCTCTT
ATGGTGTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAGTGCCATG
CCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGA
AGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATG
GAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACACAATGTATACATCACGGCAGACAAA
CAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACATTGAAGATGGATCCGTTCAACTAGC
AGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGT
CGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTA
ACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAATAATGAATTCGAGCTCGGTACCCGGG
GATCCTCTAGAGTCGA  3’
B) Make a blast-search (http://www.ncbi.nlm.nih.gov) in order to double-check the
given gfp-sequence within the fragment.
C) Make a restriction map of the given fragment by using the webcutter-online
software (http://www.firstmarket.com/cutter/cut2.html). Choose the most appropriate
enzymes. Two solutions are acceptable. Explain your answers.
Task 2
The gfp gene has to be cloned into the cloning vector pUC19. In exercise 1 you have
chosen two suitable enzymes that cleave the gfp gene.
A) Describe the preparation of pUC19 for ligation with gfp for both solutions.
B) Which solution is more suitable? Give reasons for your answer.
Task 3
Describe how you can check if the cloning vector pUC19 is cleaved and the DNA
fragment is ready for cloning.
-
What is the suitable concentration of the Agarose gel?
-
Sketch roughly the result.
Task 4
After ligation and transformation you have to cultivate the transformed E. coli cells on
agar plates. Explain why.
-
Give a list of compounds you have to add to LB agar. Explain your choice.
-
How can you distinguish between transformed, non-transformed and
recombinant bacteria?
-
How can you distinguish between cells incorporating only religated vector
DNA and cells that incorporate the construct?
-
In exercise 1 you could have chosen two solutions in order to cleave gfp.
Which solution should lead to more transformed bacteria carrying the gfp?
Explain your answer.
Task 5
The blue / white shift experiment is a method of preselection. It may produce false
results: Sometimes the pale blue colonies carry the inserted gene, sometimes they
do not. Therefore putative transformants have to be double-checked. Suggest an
appropriate experiment and give a brief description of the main steps and possible
results.
Sketch roughly the result.