Sanger Sequencing Student Activity
Prepare for Activity:
1. Using a color print, print a set (3 pages) of the activity print outs for each student
group.
2. Prepare the sequences: Cut apart the four rows of sequence nucleotides. Tape or
glue together the corresponding color ends. You should have one set of
complementary sequences.
3. Prepare Primers: Cut out the two sets of primers.
4. Prepare the nucleotides: Cut apart the set of nucleotides (A, T, C, G) pages. Place
corresponding letter in 4 different envelopes with letters labeled on the outside of the
envelope. (Example: Write A on an envelope, then put all the cut out of A in the
envelope.) Each group will need a set of 4 envelopes.
5. Have several (10-12) long strips of paper (receipt paper rolls work great) available for
each group.
Directions to Teacher:
1. Split the groups into two. Have half the groups do the top strand (reverse primer)
and the other half to the bottom strand (forward primer).
2. Give students the supplies and the below directions.
3. Once you see groups of each strand have several compliments created stop the class.
You need strands at each length for students to be able to read the entire sequence
without skipping a nucleotide.
4. Now have all the groups with the top strand and all the groups bottom strand
combine their complimentary strands into one pile.
5. Have the two large groups each order their pile of strand into size order (simulating
electrophoresis).
6. Have students write the entire complimentary strand by reading the colored
nucleotides from the smallest strand to the largest. This will be 5’ to 3’ order. Let
them know they are acting as the “reading laser”.
Extension (modeling the editing process):
Have a representative from each group bring their strand to the front of the class.
Have them match the strands together and fill in additional information by using the
complimentary strand.
Activity Instructions to explain to students:
1. Place DNA strands on the table. Listen for instructions to see which strand your
group will work on.
2. Lay a strip of blank paper next to your DNA strand.
3. Now find the appropriate primer that will bind to your strand and place it in the
correct spot on your strand (each strand will have a different primer). You will use
this primer over and over again.
4. Using the envelopes of nucleotide cut-outs, start pulling the appropriate nucleotides
to create a complimentary strand. Tape or glue the nucleotide to your blank strip of
AGTATTTGGTGCCTGAGCCGGTATAGTAGGCACAGCCCTCAGCCTACTCATTCGAGCAGAACTAAGCCAACCGGG
CGCTCTCCTTGGAGACGACCAAATTTATAATGTAATCGTTACAGCACATGCCTTCGTAATGATTTTCTTTATAGT
AATGCCAATTATAATTGGAGGTTTTGGAAACTGATTAATCCCCCTAATGATTGGAGCCCCAGATATAGCATTCCC
TCGTATAAATAACATAAGTTTCTGACTTCTGCCCCCTTCCTTCCTACTATTACTCGCCTCTTCTGGGGTAGAAGC
AGGTGCCGGAACCGGGTGGACAGTGTATCCACCCCTGGCCGGTAATTTAGCCCACGCAGGAGCATCAGTCGACCT
GACAATCTTTTCACTTCACCTAGCAGGTATTTCCTCAATCCTCGGGGCAATCAATTTTATCACCACAATTATTAA
TATGAAGCCCCCGGCCATCTCTCAGTACCAGACACCCCTATTTGTATGAGCTGTCCTAATTACCGCTGTTCTTCT
CCTTCTTTCCCTGCCAGTTCTCGCTGCCGGCATCACAATGCTCCTTACCGACCGAAATCTTAATACCACCTTCTT
TGACCCGGCCGGAGGAGGAGATCCAATCCTTTACCAGCACTTATTCTGATT
paper. Remember: You must add nucleotides to the 3’ end in order. Continue to
add nucleotides until you get a colored nucleotide. The color presents a ddNTP, so
you can no longer add nucleotides.
5. Set this strand aside and repeat steps 2-5 until your teacher tells you to stop.
Background Informatin
Where the sequences we are using came from!
Sebastes Dolly Sequence
The portion of the Sebastes Dolly Sequence students will use for the activity with the primer
binding sites in red.
5’ATCGCAGTATTGGCACAGTATT TGGTGCCT GAGCCGTTCTGATTGCCAT TAG3’
3’TAGCGTCATAACCGTGTCATAAACCACGGACTCGGCAAGACTAACGGTAATC5’
The original primer sequences.
Forward primer sequence: tgtaaaacgacggccagtcaaccaaccacaaagacattggcac
Reverse Primer sequence: caggaaacagctatgacacttcagggtgaccgaagaatcagaa
The portion of the primer sequence students will use for the activity
forward primer 5’ATTGGCAC3’
reverse primer 5’AATCAGAA3’ OR 3’AAGACTAA5’