SUPPLEMENTAL INFORMATION
SUPPLEMENTAL METHODS
Strains
Wild-type N2 variation Bristol, CB4856 Hawaiian wild-type isolate, OH110 lim6(nr2073) 1, JR1380 die-1(w34)/mnC1 dpy-10(e128) unc-52(e444), SU90 die-1(w34)II;
jcEx23[pPH12; pRF4; pJS191 (jam-1::gfp)] 2, OH988 lin-49(ot78); otIs114; him-5,
PS3410 cog-1(sy607) 3, OH153 cog-1(ot28) 4, OH2535 lsy-6(ot71) 5, OH1272 die1(ot26); ntIs1, OH1607 che-1(ot27); ntIs1, OH183 ntIs1, OH1779 die-1(ot26); otIs3,
OH351 otIs114; die-1(ot26), OH3199 die-1(ot100); ntIs1; otIs151, OH3200 otIs114; die1(ot100); him-5, OH3201 die-1(ot100); otIs3
All strains were grown at 20˚C and scored at room temperature as gravid adults if not
indicated otherwise.
Transgenes
Reporter gene fusions: otIs114: Is[lim-6prom::gfp; rol-6(d)], otIs3: Is[gcy-7::gfp;
lin-15(+)], ntIs1: Is[gcy-5::gfp; lin-15(+)], otIs131: Is[gcy-7::rfp; rol-6(d)]4, otIs151: Is[ceh36prom::rfp; rol-6(d)] 5, syIs73: Is[pBP164 (cog-1prom::gfp; dpy-20(+))], syIs63: Is[cog1::gfp; dpy-20(+)]3, otEx1389: Ex[lsy-6::gfp; unc-122::gfp], otEx1403: Ex[lsy-6::gfp; rol6], a 5' fusion, otEx1805-1809: Ex[ceh-36prom::gfp::unc-543’UTR] at 1ng/µL and otEx18101814 at 2.5ng/µL, otEx1755,1759-62 (1ng/µL) and otEx1781-85 (2.5ng/µL): Ex[ceh36prom::gfp::die3’UTR], otEx1791-95 (1ng/µL) and otEx1731-35 (2.5ng/µL): Ex[ceh36prom::gfp::die3’UTRmut1], otEx1797-1801 (1ng/µL) and otEx1736-40 (2.5ng/µL): Ex[ceh36prom::gfp::die3’UTRmut2], otEx1714-18: Ex[mir-273prom1::gfp; unc-122::gfp], otEx1744-49:
Ex[mir-273prom2::gfp; unc-122::gfp], otEx1750-54: Ex[mir-273prom3::gfp; unc-122::gfp],
otEx959: Ex[pPH12 (die-1resc::gfp); rol-6(d)]. The rescuing otEx959 array was
chromosomally integrated to yield otIs159. Besides ASE expression, consistent and
strong expression of gfp from the otIs159 array is also observed in the ASH, ADF and
AWC neurons. We note that upon generation of extrachromosomal lines expressing die1resc::gfp more than 30 transgenic lines fail to rescue the lsy phenotype of ot26 and also
1
show no expression in ASE(L/R) (data not shown). We ascribe the failure to obtain a
significant number of rescuing lines to die-1 gene dosage effects which are difficult to
control using multicopy extrachromosomal arrays.
Misexpression constructs: otEx1191-5: Ex[gcy-5 prom::die-1; unc-122::gfp],
otEx1196-7, otEx1211: Ex[gcy-7 prom::die-1; unc-122::gfp], otEx1705, otEx1724,
otEx1741-3: Ex[ceh-36prom::mir-273].
PCR fusion reaction
Most constructs were generated by PCR fusion, in which two or more separate
primary PCR products were fused by PCR 6. For site-directed mutagenesis, mutations
were introduced via the PCR primer sequences and fused together by PCR. Templates
were either genomic DNA, subcloned ceh-36 ::gfp ::unc-543’UTR or the pPD95.75 vector
(for gfp coding sequences and/or the unc-54 3’UTR).
ceh-36prom::gfp::unc-54 3’UTR  same as Johnston and Hobert, 2003.
ceh-36prom::gfp::die-1 3’UTR otEx1755, 1759-62, otEx1781-85
ceh-36 A - caaagcagtgaagtgaagg
ceh-36 C - caaagtagagcactgagggtg
die-1 X - cggaagcttgagtcgtcgtc
die-1 X* - ctcacgatctgcccaacaga
die-1 3’ UTR link - gaactatacaaatagcattcgtagatttggtccactacctcaaaaatgc
rev gfp stop - ctatttgtatagttcatccatgcc
ceh-36prom::gfp::die-1 mut 1’UTR  otEx1791-95, otEx1731-35
ceh-36 A – as above
ceh-36 C – as above
die-1 X - as above
die-1 X* - as above
die-1 3’ UTR link - as above
rev gfp stop - as above
2
die-1 M1 forward - tctcccagttagcagtaactcc
die-1 M1 reverse – ggagttactgctaactgggaga
ceh-36prom::gfp::die-1 mut 2’UTR  otEx1797-1801, otEx1736-40
ceh-36 A - as above
ceh-36 C – as above
die-1 X - as above
die-1 X* - as above
die-1 3’ UTR link - as above
rev gfp stop - as above
die-1 M2 forward - ctacgccaaatgttccggaacc
die-1 M2 reverse – ggttccggaacatttggcgtag
mir-273prom1::gfp  otEx1714-18
mir-273prom A—atggttgttggggcatccaaa
mir-273prom B—cctcgaatctccaacatcacc
mir-273prom1.link—agtcgacctgcaggcatgcaagctcattaaatatacatctgagattttgc
C - agcttgcatgcctgcaggtcgact
D - aagggcccgtacggccgacta
D* - ggaaacagttatgtttggtatattggg
(C, D and D* are according to reference 6)
mir-273prom2::gfp  otEx1744-49
mir-273prom C— gctaatgaacaaggaactgc
mir-273prom D— cttcgagccgtcaccatgtt
mir-273prom2.link— agtcgacctgcaggcatgcaagctcatgattcgaggtttggatgcctg
C – as above
D - as above
D* - as above
mir-273prom3::gfp  otEx1750-54
3
mir-273prom E— gtgcttctacatgagcacaa
mir-273prom F— atttgggccacctacaccga
mir-273prom3.link— agtcgacctgcaggcatgcaagctcatatcggcgataagacccttc
C - as above
D - as above
D* - as above
ceh-36prom::mir-273  otEx1705, otEx1724, otEx1741-3
ceh-36 A—caaagcagtgaagtgaagg
ceh-36 B—caaaaatgaggctaccaag
mir-273 A--ttcgcctgcccccgcatgcaca acctcgttttgggagcagccggc
mir-273 B--gccggctgctcccaaaacgaggt tgtgcatgcgggggcaggcgaa
mir-273 C—gtcggctgctcggtgtagattg
mir-273 D— accgaaattttcaaagcagccg
Genetic screening and mapping
To isolate mutant animals in which ASE laterality is disrupted, transgenic strains
that contain either a lim-6 prom::gfp (otIs114), gcy-7 prom::gfp (otIs3) or gcy-5 prom::gfp
(ntIs1) transgene were mutagenized with EMS and F2 offspring were examined under a
dissecting stereomicroscope with a fluorescent light source, as previously described 4.
For mapping of mutants, we made use of single nucleotide polymorphisms (SNPs)
present in the Hawaiian C. elegans isolate CB4856 identified by the Washington
University Genome Sequencing Center
(http://genome.wustl.edu/gsc/CEpolymorph/snp.shtml) and by Ronald Plasterk and
colleagues 7. SNP mapping placed the ot26 allele within a 160 kb region on
chromosome II, covered by 6 cosmids (C18D1 and T01E8 being the left and right
border). Since this region contains three previously described transcription factors for
which mutant alleles are available, namely die-1 2, daf-19 8 and ref-1 9, we tested each
of these for a potential lsy phenotype by mating the respective mutants with gcy-5 and
gcy-7 prom::gfp transgenes (ntIs1 and otIs3). daf-19(m86) and ref-1(mu220) animals
display no defects; since the latter is only a hypomorphic allele, we also performed
4
complementation tests and found that ot26/mu220 transheterozygotes display no lsy
phenotype. die-1(w34) mutants, which die as embryos, in contrast, display a lsy
phenotype. ot26 also fails to complement w34 (tested with the ntIs1 transgene).
Chemotaxis assays
The chemotaxis assay was based on assays developed by Bargmann and
Horvitz, 1991 and Bargmann et al., 1993. As a control, che-1 mutants, in which most or
all of the genetic markers for ASEL and ASER are completely and specifically
eliminated 4,10,11, was used. To test the effect of Na+ or Cl- sensory inputs, we paired
these ions with counter-ions (ammonium and acetate). While animals are attrachtd to
ammonium acetate, the observation that ASER-defective che-1 mutants were severely
impaired in chemotaxis to NaCl but not in chemotaxis to NH4Ac (Fig.1d) indicated that
ammonium and acetate regulate chemotaxis by neuronal pathways that do not include
ASE neurons.
Assay plates were 10 cm tissue culture dishes containing 20g/L agar, 5 mM
potassium phosphate (pH = 6.0), 1 mM CaCl2, 1 mM MgSO4. Assay plates for
discrimination assays additionally contained 100 mM Na-acetate (“100 mM Na+”) or 100
mM NH4Cl (“100 mM Cl-“). To set up the chemical gradients on the assay plates a 10 L
drop of attractant was placed 15 mm from the edge of the plate at the “attractive spot”.
20
was placed diametrically opposite and was considered the
“negative control spot”. The attractant was allowed to diffuse for 14-16 hours at room
temperature. To increase the steepness of the chemical gradient, 4 to 4.5 hours prior to
chemotaxis assay 4 L attractant was added to the “attractive spot” and 4 L ddH20
added to the “negative control spot”. The peak of the gradient was estimated to be on
the order of 10 mM with a fall-off to less than 1 mM at 20 mm from the peak, based on a
model assuming no borders (Pierce-Shimomura et al., 1999). Attractants NaCl, NH4acetate, NH4Cl and Na-acetate (Sigma, MO, USA) were dissolved in ddH2O to a
concentration of 2.5 M and were adjusted to pH = 6.0 with either NH4OH or acetic acid.
Nematodes were grown at room temperature on nematode growth medium
seeded with the Escherica coli strain OP50 (Brenner, 1974). Synchronized adult
cultures were rinsed off culture plates with ddH20. To remove bacteria and other
5
potential attractants animals were washed three times with 15 mL ddH20 and pelleted
loosely in a table top centrifuge. Animals were transferred using glass pasteur pipettes.
Rinse and wash procedure took less than 10 minutes.
Before placing animals on assay plates sodium azide (2.0 - 2.5 L, 0. 25 M) was
pipetted onto the “attractive spot” and onto the “negative control spot” to anesthetize
animals reaching either spot. The azide anesthetized animals within approximately 10
mm. Animals were placed in the center of the plate equidistant from the “attractive spot”
and the “negative control spot” in a minimal drop of ddH20. Excess ddH20 was removed
with Whatman filter paper (Whatman, NJ, USA). Chemotaxis assays were performed at
room temperature for 60 minutes and assay plates were subsequently placed in a
refrigerator (5C) to immobilize animals.
The chemotaxis index for an assay plate was calculated as:
Number of animals at “attractive spot” – Number of animals at “negative control spot”
Total number of animals in assay
The chemotaxis index could vary from 1.0 (perfect attraction) to –1.0 (perfect repulsion).
Animals closer than 10 mm to the “attractive spot” and “negative control spot” were
counted and all other animals on the plate were counted toward the total number of
animals in assay. Each day, assays were done in duplicate or triplicate and the
chemotaxis index was calculated as the mean of these and counted as one
independent trial. On average, each plate had between 100-200 worms and plates with
less than 50 animals were discounted.
Statistical analysis. Differences in chemotaxis index between wild-type and ot26
mutants were tested with a Bonferroni post hoc comparison corrected for multiple
comparisons within the same plate background. One star (*) indicates p < 0.05 and two
stars (**) indicate p < 0.01. One data point was discarded based on Grubb’s test, since
that data point was more than three standard deviations away from the mean and we
suspected an experimental error.
6
SUPPLEMENTAL FIGURE LEGENDS
Supp.Fig.1: ot26 is an allele of the Zn finger transcription factor DIE-1 which acts
in ASE to affect gcy gene expression
a: Mutant alleles of die-1. w34 was described by Heid et al., 2001, ot26 by screening for
animals affecting lim-6::gfp (otIs114) expression and ot100 by screening for animals
affecting gcy-5 (ntIs1) expression. ot100 was kindly provided by Celia Antonio. ot100 is
phenotypically indistinguishable from ot26. The canonical, embryonically lethal die-1 null
allele w34 also displays a lsy phenotype in embryos.
b: Transformation rescue of the ot26 mutant phenotype with the indicated die-1
expression constructs (otEx959 = die-1resc::gfp; otEx1196-7, otEx1211: Ex[gcy-7
prom::die-1]
Numbers indicate numbers of transgenic lines. As control, point-mutated
die-1 was expressed under the same promoter.
Supp.Fig.2: die-1 controls lim-6 expression
Adult ot26 animals were scored for lim-6 expression using an otIs114 lim-6::gfp
transgenic reporter array.
Supp.Fig.3: Identification of mir-273 complementary sites and the structure of the
mir-273 precursor.
a: Alignment of the C. elegans and C. briggsae die-1 3’UTRs. The last two codons of
each gene are boxed. The two regions of highest similarity that also share
complementarity with mir-273 are boxed in red. Another region of 13 nt identity shares
no obvious complementarity to known miRNAs in the miRNA registry
(http://www.sanger.ac.uk/Software/Rfam/mirna/index.shtml). Note that no other
conserved regions of >10 nt identity are observed.
b: mir-273 stem loop 12.
Supp.Fig.4: Bilateral expression of mir-273 disrupts ASE laterality. ASE laterality
was assayed with the ASER-specific gcy-5::gfp ntIs1 transgene. 5 transgenic , ceh36::mir-273 expressing lines were assayed.
7
REFERENCES for Suppl. Information
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
Hobert, O., Tessmar, K. & Ruvkun, G. The Caenorhabditis elegans lim-6 LIM
homeobox gene regulates neurite outgrowth and function of particular
GABAergic neurons. Development 126, 1547-1562 (1999).
Heid, P. J. et al. The zinc finger protein DIE-1 is required for late events during
epithelial cell rearrangement in C. elegans. Dev Biol 236, 165-80 (2001).
Palmer, R. E., Inoue, T., Sherwood, D. R., Jiang, L. I. & Sternberg, P. W.
Caenorhabditis elegans cog-1 Locus Encodes GTX/Nkx6.1 Homeodomain
Proteins and Regulates Multiple Aspects of Reproductive System Development.
Dev Biol 252, 202-13 (2002).
Chang, S., Johnston, R. J., Jr. & Hobert, O. A transcriptional regulatory cascade
that controls left/right asymmetry in chemosensory neurons of C. elegans. Genes
Dev 17, 2123-37 (2003).
Johnston, R. J. & Hobert, O. A microRNA controlling left/right neuronal
asymmetry in Caenorhabditis elegans. Nature 426, 845-9 (2003).
Hobert, O. PCR fusion-based approach to create reporter gene constructs for
expression analysis in transgenic C. elegans. Biotechniques 32, 728-30 (2002).
Wicks, S. R., Yeh, R. T., Gish, W. R., Waterston, R. H. & Plasterk, R. H. Rapid
gene mapping in Caenorhabditis elegans using a high density polymorphism
map. Nat Genet 28, 160-4. (2001).
Swoboda, P., Adler, H. T. & Thomas, J. H. The RFX-type transcription factor
DAF-19 regulates sensory neuron cilium formation in C. elegans. Mol Cell 5, 41121 (2000).
Alper, S. & Kenyon, C. REF-1, a protein with two bHLH domains, alters the
pattern of cell fusion in C. elegans by regulating Hox protein activity.
Development 128, 1793-804 (2001).
Ward, S. Chemotaxis by the nematode Caenorhabditis elegans: identification of
attractants and analysis of the response by use of mutants. Proc Natl Acad Sci U
S A 70, 817-21 (1973).
Uchida, O., Nakano, H., Koga, M. & Ohshima, Y. The C. elegans che-1 gene
encodes a zinc finger transcription factor required for specification of the ASE
chemosensory neurons. Development 130, 1215-24 (2003).
Grad, Y. et al. Computational and experimental identification of C. elegans
microRNAs. Mol Cell 11, 1253-63 (2003).
8