SUPPLEMENTARY EXPERIMENTAL PROCEDURES
Experimental use of the different foetuses
Fœtus age
Type of experiment
6.5 wg
RT-PCR on snap frozen tissue.
7.5 wg
Immunohistochemistry on cryostat sections.
7.5 wg
Immunohistochemistry on cryostat sections.
8.5 wg
Dissociation, expansion, long-term characterization, transplantation in nude and
shiverer mice.
8.5 wg
Dissociation, expansion, long-term characterization, transplantation in nude mice.
9 wg
Dissociation, short-term characterization, RT-PCR on freshly dissociated cells.
RT-PCR
RNA extraction was performed to characterize the phenotype of human cells under two
different conditions. A first sample consisted in non-dissociated tissue from Cortex, GE and
Thal, dissected as described above and snap-frozen without dissociation. The second
sample consisted in non-cultured dissociated cells from Cx, GE and Thal frozen immediately
after dissociation.
Total RNA was extracted using Trizol reagent (Invitrogen) according to the manufacturer’s
instructions, followed by treatment with RNase-free DNase RQ1 (Promega). cDNA synthesis
was performed using 1g of total RNA and Thermo Script RT reverse transcriptase
(Invitrogen). One microliter of the resulting cDNA was then used for each PCR reaction.
PCRs were performed as follows: primers (100 ng/l of each), 2.5 U Taq polymerase (HT
Biotechnologies) and 10 mM dNTPs mix with the following reaction cycling parameters:
94°C, 5 minutes; 94°C, 60 seconds; each gene corresponding annealing temperature, 60
seconds; 72°C, 60 seconds for 35 cycles. Relative expression for each gene was determined
using -actin gene as a standard. PCR products were resolved on 1% agarose gels and
analyzed using Bio-Rad Gel Doc 2000 system and its corresponding Bio-Rad Quantity One
software. Human primer sequences and the lengths of the amplified products are listed in the
following table:
Human gene
Forward primer (5’ – 3’)
Reverse primer (5’ – 3’)
Size (bp)
Nestin
CAGCGTTGGAACAGAGGTTGG
TGGCACAGGTGTCTCAAGGGTAG
388
GFAP
GCTCGATCAACTCACCGCCAACA
GGGCAGCAGCGTCTGTCAGGTC
426
NSE
CCCACTGATCCTTCCCGATACAT
CCGATCTGGTTGACCTTGAGCA
253
Olig1
GACGTTAAAGTGACCAGAGC
TTCTGCCTCTTGAGTTCCGGCA
387
Olig2
AAGGAGGCAGTGGCTTCAAGTC
CGCTCACCAGTCGCTTCATC
313
Sox10
CGGAAAACCAAGACGCTCA
GCCGTTCATGTAGGTCTGCG
350
Actin
TCACCACCACGGCCGAGCG
TCTCCTTCTGCATCCTGTCG
350
Lentiviral vectors
Production
Lentiviral vector plasmid was generated from pTRIP-CMV-GFP-WPRE plasmid as described
in Zennou et al. (Zennou et al., 2001). Lentiviral particles were generated by transient
transfection of 293T cells using the calcium phosphate precipitation method. Cells were cotransfected with the vector plasmid (pTrip-CMV-GFP-WPRE), the transcomplementation
plasmid (p8.9), and the envelope plasmid encoding the vesicular stomatitis virus envelope
glycoprotein (pVSV) as described previously (Charneau et al., 1992). The medium was
replaced 12h after transfection and collected 36 h later. Supernatants were treated with
DNase and passed through a 0.45-μm filter. Viral particles were then concentrated by
ultracentrifugation (90 min, 22,000 rpm, rotor SW28) and resuspended in 1X PBS. Total
particle concentration of viral stocks was quantified by HIV-1 p24 ELISA assay (Beckman
Coulter, Fullerton, CA).
Transduction
After 60 DIV (P6-P7), spheres from the Cx, GE and Thal were dissociated in ATV and
resuspended in 8ml NEF at the density of 106 cells/T75 flask. Forty-eight hours later, 300ng
p24 of the Trip-CMV-GFP vector was added in the flask. Cells were further amplified as
neurospheres as described above until use for transplantation in nude mice. Transduction
efficiency was evaluated at P7-P8. Dissociated cells were seeded in 24 well plates (30 000
cells/well) on glass coverslips coated with gelatin and laminin and fixed in 4% PFA 2 days
later. The proportion of transduced cells was evaluated by counting the number of GFP+ cells
on total Hoechst+ nuclei.
Cell counting
In vitro
Each staining was performed in triplicate on three independent glass coverslips. For each
staining, 10 independent fields were counted, consisting in at least 3000 cells. Positive cell
number was counted using the ImageJ software and expressed as a percentage of total cell
number, as determined by Hoechst-positive nuclei counting.
In vivo
Human cell migration was assessed by estimating the distance between the most rostral and
the most caudal sections containing GFP+ cells in each animal (number of sections
containing GFP+ cells x distance between two sections). Human cell dispersal within the
dorsal funiculus was assessed by estimating the density of GFP+ cells on transverse sections
at the injection site and at 3 different levels caudal (-1mm, -2mm, -3mm) and rostral (+1mm,
+2mm, +3mm) from the injection site. Cell density was expressed as the number of GFP+
cells per mm3 (area of dorsal funiculus on each section x thickness of the section). The
proportions of donor-derived mature OLs, astrocytes and neurons were estimated by
counting APC(CC1)+/GFP+, human GFAP(SMI21)+ and MAP2+/GFP+ cells, respectively, on
at least 5 sections per animal and counts were expressed as a percentage of total GFP+ cells
on the same sections.
Quantification of donor-derived myelination in shiverer mice
Donor-derived myelination was quantified at different rostro-caudal levels of the shiverer
spinal cord (-5.1, -3.4 and -1.7 mm caudal to the injection site; injection site; +1.7 and +3.4
mm rostral to the injection site) (n=3 sections per level), in the animal where the highest
amount of myelin was found. Human myelin was visualized by MBP staining and shiverer
white matter by MOG staining. Myelination was expressed as the ratio of MBP+ area on total
(dorsal+ventral) MOG+ white matter area. Areas were measured using the Image J software.
REFERENCES
Charneau, P., Alizon, M., and Clavel, F. (1992). A second origin of DNA plus-strand
synthesis is required for optimal human immunodeficiency virus replication. J Virol 66, 28142820.
Zennou, V., Serguera, C., Sarkis, C., Colin, P., Perret, E., Mallet, J., and Charneau, P.
(2001). The HIV-1 DNA flap stimulates HIV vector-mediated cell transduction in the brain.
Nat Biotechnol 19, 446-450.