Appendix S1. Detailed experimental procedures for construct design and RT PCR
The CVL1 genomic clone was amplified from BAC clone F22D24 (provided by
ABRC) as template DNA using the primers F22D10 (5’-CAATGTTGTGAGTGATG -3’)
and F22D2 (5’-CGTAAAGAAGAAGGCTTTTC -3’). This clone was introduced into the
plant transformation vector, pCAMBIA2300, transformed into cvp2 cvl1 doubles and
found to restore the double mutant phenotype to a cvp2 mutant phenotype, indicating
that we had isolated a fully functional CVL1 transcriptional unit. CVL1 promoter (1 Kb
upstream of translational start site) was isolated using the primers F22D10 and F22D11
(5’-CTTGCTCTTATTTGATTCACTG-3’), which was subsequently cloned into pBI101
(Clontech, http://www.clontech.com) for GUS localization studies. A 1.55 Kb CVL2
promoter was amplified using F16M1 (5’-CGTTGCAATAATAAAGTTGGG-3’) and
F16M2 (5’-CCATCTCTGTATGAAGCTGAAG-3) from BAC F16M2 DNA and introduced
into pBI101 for GUS localization analysis. CVL1 cDNA was generated from DNAsetreated 7 day-old seedling RNA (isolated with TRIZOL, Invitrogen) with oligo dT as a
downstream primer, according to the manufacturer’s protocol (SuperScript II Reverse
Transcriptase, Invitrogen). The CVP2 clade of 5PTases are expressed at low levels
requiring at least two rounds of PCR for amplification (28 cycles each). PCR was
performed with the primers F22D7 (5’GGATGGATTGAGTCTCAAG-3’) and F22D6 (5’CCTCAAGGCTTCAACATTCG-3’). The reaction was purified and diluted and used in a
second round of PCR with nested primers F22D8 (5’-GAGCAACAATGAGAGACG-3’)
and F22D2. The protein predicted by the At2g32010 cDNA and by our isolated CVL1
cDNA was in agreement with the annotation found at TAIR Sequence Viewer nucleotide
view. To determine the transcript level in SALK_029945, floral bud RNA was purified
with RNA mini elute columns (Qiagen, http://www.qiagen.com) and DNAse-treated prior
to oligo dT primed first-strand cDNA synthesis. First round PCR (28 cycles) was
conducted with 5% of the first-strand reaction using F22D13A (5’-
GGATCAATCTCAATTAGTATG-3’) and F22D6 and purified with QIAquick PCR
purification (Qiagen). Second round PCR (28 cycles) was conducted with the primers
CVLSA-1( 5’-CGGATAGATATGCAGGAGG-3’) and ESCCVL-R (5’GAAAAATGTTAGCTCGGTGTA-3’). Primers TubulinF (5’CCTGATAACTTCGTCTTTGG-3’) and TubulinR (5-‘GTGAACTCCATCTCGTCCAT-3’)
were used for the tubulin control (28 cycles).
SFC/VAN3 cDNA was generated from DNAse-treated 7 day-old seedling RNA using
oligo dT as a downstream primer followed by amplification with the primers SFC-8 (5’GAGGAAGTAATAAATTAGCTG -3’) and SFC-10 ( 5’-GCCTATGCATCTTTATCAGCA3’). SFC/VAN3 promoter (1.5 Kb) was isolated using the primers SFC14 (5’GACCGCCTTTCGTGTGATCC-3’) and SFC15 (5’-CCTCTTCTTCGACACAAACAGC-3’)
primers and subsequently cloned into pBI101 (Clontech, http://www.clontech.com) for
GUS expression analysis.