Supplementary information: detailed protocols for in vitro p53 degradation and
ubiquitination assays and mRNA quantitation by quantitative PCR.
In vitro p53 degradation and ubiquitination assays
p53, E6 or F47R proteins were produced and labeled with
35
S Met in rabbit
reticulocytes lysates by using the Quick T7 coupled transcription/translation kit
(Promega). MBP-E6 and MBP-E6 F47R fusions proteins were produced as previously
described (Zanier et al., 2007) and adjusted at 20 M concentrations in buffer A
(Phosphate 20 mM pH 6.8 , NaCl 200 mM, DTT 2 mM, 10mM maltose). For the
degradation assay, 5 l of labeled E6 or F47R and 2 l of labeled p53 were mixed in
Tris pH 7.5 25 mM, NaCl 100 mM, DTT 3 mM and incubated at 25°C for 2 hours. For
figure 1D, E6/p53 mixture was incubated at 25°C for two hours with 2 l of Buffer A or
2 l of MBP-E6 or MBP- E6 F47R protein (or dilutions in buffer A). Proteins were
loaded on a 12% SDS polyacrylamide gel and visualized by autoradiography.
For the ubiquitination assay, 2.5 l of in-vitro translated 35S labeled E6 and p53 proteins
were incubated in 30-l reaction mixture containing Tris pH 7.5 25 mM, NaCl 100 mM,
DTT 3 mM, 9 l of rabbit reticulocytes lysates, and 4 mM of ATP-S (Sigma) for 30
min at 25°C. The reaction mixture was then incubated with anti-p53 monoclonal
antibodies (Ab-6, Calbiochem). The proteins were collected on protein-G sepharose
beads (GE Healthcare), washed with LSAB (Tris pH 8 100 mM, NaCl 100 mM, NP40
1%, DTT 2mM, anti-proteases cocktail) and released from the beads by boiling in Tris
pH 6.8 60 mM, SDS 2%, glycerol 10%, -mercaptoethanol 1% for 7 min. The beads
were pelleted and the supernatant was diluted into 400 l of LSAB buffer and
immunoprecipitations were performed with anti-ubiquitin antiserum (Sigma). Proteins
were collected on protein G-sepharose beads, resolved on a SDS-12% polyacrylamide
gel and visualized by autoradiography.
mRNA quantitation by quantitative PCR
Cells (100-mm dishes) were transfected with pNKA, pNKA-E6 or pNKA-E6 F47R
plasmids. Twenty-four hours after transfection, cells were trypsinated, diluted to 1/6,
split and selected with 0.4 g/ml of puromycin. At day 6 post-transfection, total RNA
was prepared using RNAeasy Plus Mini kit (Qiagen) by following the manufacturer’s
instructions. Total RNA (400 ng) was reverse-transcribed into cDNA using random
primers p(dN)6 with Superscript II Reverse Transcriptase according to the
manufacturer’s instructions (Invitrogen). Each real-time PCR reaction was performed in
technical duplicate with cDNA from transfected cells by using Quantitec SYBR Green
PCR kit (Qiagen) according to the manufacturer’s instructions. The 18E6 primers (sens
5’-TGGTGTATAGAGACAGTATACCCCA,
reverse
5’-
GCCTCTATAGTGCCCAGCTATGT) were designed to amplify a 251 pb fragment
within the full-length 18E6/E7 cDNA (corresponding to sequence 265-516 in HPV18
genome, the E6 sens primer hybridized with a sequence in the 18E6 intron). The 18E7
primers
(sens
5’-CCGAGCACGACAGGAACGACT
and
reverse
5’-
TCGTTTCTTCCTCTGAGTCGCTT) were designed to amplify a 174 pb fragment
present both in 18E6*/E7 cDNA and full-length 18E6/E7 cDNA as previously
described (Bernard et al., 2003) (corresponding to sequence 531-705 within the HPV18
genome). The hPBGD (human phosphobilinogen deaminase) gene was used as an
internal control to normalize the variations in mRNA amounts (sens 5’TGCACGATCCCGAGAC
and
reverse
5’-CGTGGAATGTTACGAGC).
The
efficiency of each primers set was determined by standard curve experiments : 95% for
E6 primers set, 100% for hPBGD primers set and 100% for E7 primers set. For E6
reaction, the PCR cycling program consisted of denaturing at 95°C for 15 min and 58
cycles at 94°C for 15 s, annealing at 58°C for 25 s, and elongation at 72°C for 25 s and
contained cDNA and 1M of final concentration of E6 primers. For E7 and hPBGD
reactions, the PCR cycling program consisted of denaturing at 95°C for 15 min and 55
cycles at 94°C for 15 s, annealing at 56°C for 20 s and elongation at 72°C for 20 s and
contained cDNA and 0.5 M of final concentration of E7 primers or hPBGD primers.
Gene expression levels were shown relative to hPBGD mRNA levels. The relative
quantification of target transcripts was calculated by the two Ct method (Livak and
Schmittgen, 2001).