Supplementary Methods
ShRNA library construction
To construct an shRNA library which can be expressed in bacteria, we first generated a T7
promoter expression vector. The T7 terminator sense oligo 5'AATTCGTTTAAACCTTCTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGT
TTTTTAGATCTATTA-3' and antisense oligo 5'TAATAGATCTAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAG
AAGGTTTAAACG-3' were annealed and inserted in the pCEP-Pu vector (vector information
available on request) at EcoR I and EcoR V sites. The resulting plasmid containing the T7
terminator, termed pT7-term-Pu, was digested with EcoR I and Pme I, and a T7 promoter
sequence generated by annealing the T7 promoter sense oligo
5'AATTAATAGATCTAATACGACTCACTATAGGGAATTGCTTGTGCAGCTGCACAGTT
T-3' and antisense oligo 5'AAACTGTGCAGCTGCACAAGCAATTCCCTATAGTGAGTCGTATTAGATCTATT-3' was
inserted in these sites. The resulting plasmid contains both T7 promoter and T7 terminator, and a
recognition sequence for Bsg I between the promoter and the terminator for convenient cloning of
shRNA library. An Ase I site and a Bgl II site were also positioned in front of the T7 promoter
and behind the T7 terminator respectively for shuttling the T7 promoter-driven shRNA
expression library between vectors. The resulting plasmid is termed pT7-Pu.
The shRNA library constructs were derived from correspondent cDNA sequences. To do
so, a 1.2 kb-cDNA fragment encoding the N-terminus of the major vault protein (MVP) was
amplified by PCR and the PCR product was partially digested by DNase I into 100-200 bp
fragments in the presence of 1 mM MnCl2. After their ends were repaired with T4 DNA
polymerase and DNA polymerase I klenow fragment, the DNase I-cleaved fragments were
ligated to a self-annealed hairpin linker, 5'GTCGGAACGTCTTCGACTGCACGTGCAGCAGCAGTCGAAGACGTTCCGAC-3'. The
hairpin linker has a recognition sequence for Mme I (TCCGAC) at its open end and two
recognition sequences for Bsg I (GTGCAG) at its loop region. A nick between the 5' end of the
hairpin linker and the 3' end of the DNase I-digested DNA was repaired with E. coli ligase after
phosphorylation with T4 polynucleotide kinase. The ligation product was then digested with Mme
I. The resulting extended hairpins (90 nucleotides (nt), 40 bp of stem, 8 nt of loop and 2 nt of 3'overhang) containing 20 bp of variable MVP cDNA fragments were purified by agarose gel and
ligated with an extension linker comprised of three oligonucleotides: a sense strand
oligonucleotide (AdapterS), 5'-CAGAGTCGGTCTCGCAGTGGGNN-3'; an antisense strand
oligonucleotide (AdapterAS), 5'CCCACTGCGAGACCGACTGACAGACAGTGTATCAGAGTCGGG-3' and an extension
priming oligonucleotide (Priming1), 5'- GACTCTGATACACTGT-s-C-s-T-3'. AdapterS and
Primering 1 are complementary to the 3'-terminus and 5-terminus of AdapterAS respectively. The
extension linker has a recognition sequence for Bts I (GCAGTG) and a 3'-NN extension that is
compatible with the overhangs left by the MmeI digestion. After reparation of the nick between
the 5' end of the Mme I digestion products and the 3' end of the extension linker, the ligation
products were converted into double-stranded DNA (dsDNA) by Bst DNA polymerase large
fragment at 65ºC. The extension products were digested with Bts I, leaving a 5'-CC overhang at
both ends. The cloning vector pT7-Pu was cleaved between the T7 promoter and T7 terminator
with Bsg I and a 5'-GG overhang was created at both ends of the vector. The Bts I-digested
products were isolated from agarose gel and ligated to the pT7-Pu vector. The ligation reaction
was transformed into bacteria. After overnight cultivation on plates, the library plasmid DNA was
purified and digested with Bsg I to remove most of the original hairpin linker sequence. Digestion
with Bsg I created a 5'-AC overhang at one end and a 5'-GT overhang at the other end. Selfligation of the Bsg I-digested product generated an 8-bp loop (GTCGGAAC) between the two 20to 21-bp cDNA palindrome sequences.