shRNA FAQ
1. Why do I need to use a Non-targeting control shRNA with my SMARTchoice Inducible
shMIMIC microRNA?
It's a good idea to use a non-targeting control even if there is little of no shMIMIC microRNA
expression in the absence of doxycyxline. Although doxycycline is generally accepted as “inert,”
some cellular phenotypes, such as reduced growth rate, may be observed upon exposure to
doxycycline. In addition, fluorescent reporters such as TurboGFP and TurboRFP can cause some
subtle changes in cellular phenotypes. To rigorously control for both of these effects, it is
to use a vector-matched Non-Targeting Control shRNA to identify true mature
microRNA-dependent phenotypes.
2. Can/should I linearize your viral vectors for stable integration?
Linearizing the DNA reduces the uptake into the cell, as circular DNA has a 4X greater chance of
cellular uptake. However, once in the cell, linearized DNA does show better integration than
circular DNA. pLKO.1 - NcoI - based on our current map, this should cut just downstream of the
polyA signal. pGIPZ - FspI at base 10,755 (cuts inside ampicillin marker) NOTE: Was changed
from the previously recommended PmeI since it cuts in the poly A signal which might not be good.
pTRIPZ - PmeI at position 8404 should work. This lies just downstream of the 3' LTR so it will
cut the entire viral transcript (LTR to LTR). pSMP** - NdeI at position 6149, which is outside the
LTRs pSM2** - ApaI at base 5055. It lies between the 3LTR and the RK6 promoter. ** Please
note the pSM2 and pSMP libraries, constructs, gene sets and families and RNAintro kits have
been discontinued. Note: We do not linearize our vectors in house, but offer the above suggestions
as to which sites to use. All these sites should linearize the respective plasmid in an area that is
inconsequential to those components that function post integration into the mammalian genome.
The maps used to determine these sites are of EMPTY vectors. Since each shRNA clone contains
a unique target sequence as well as a unique barcode there is a small chance that any one clone
could contain a second restriction site for the enzyme given. Therefore, when the digest is done a
small aliquot should be run on a gel to ensure a single cut occurred, linearizing the vector.
3. I have made virus with pGIPZ and I need to resuspend the viral pellet. How do I do this?
Actually you cannot see a virus pellet. What you are seeing are the serum proteins that get spun
down from the media. There may also be some genomic DNA from disrupted cells, which does
not go into solution. Resuspend the "pellet" in DMEM, no serum, by letting it sit for 10 minutes
then gently pipetting up and down 20-30 times. Then transfer this into a microfuge tube and spin
in a microfuge full speed for 3 minutes to pellet the protein debris. Aliquot the supernatant and
store in a -80C freezer.
4. Is betaine essential to use in the PCR protocol for shRNA?
Betaine is not essential, but highly recommended. It reduces the melting temperature (like DMSO)
and greatly improves your chances of a successful PCR reaction.
5. Is protein made from the shRNA template?
Protein is made from the GFP, IRES, and puromycin cassette but since the shRNA is non-coding,
no protein is made from that.
6. Is the EG5 control in pGIPZ specific for only human?
Yes, the EG5 control we have in pGIPZ is specific for human ONLY. It will not work in mouse.
aligns to: NM_004523.2 Homo sapiens kinesin family member 11 (KIF11), mRNA Length=4908
Query 1 GGCCATGCTAGAAGTACATAA 21 Sbjct 1811 GGCCATGCTAGAAGTACATAA
1831.
7. What kind of yields are normal for the pLKO.1 vector?
Doing 96 well mini-preps, we obtain ~7-8ug of DNA
8. Is it true that transfecting 293T cells with shRNA plasmids results in the formation of
retrovirus and that this is true for all mammalian cells with large T antigen?
No, the shRNA constructs must be made into virus using full packaging systems as the shRNA
constructs themselves do not include the needed genes (gag, pol, vsv-g, etc.) as provided by the
packaging systems. For pSM2 constructs you will need a retroviral 293-packaging system. For
pGIPZ, pTRIPZ and pLKO.1, you will need our Trans-Lentiviral Packaging System that is useful
for 2nd and 3rd generation vectors (link:
https://www.openbiosystems.com/Viral%20Packaging/TransLentiviral%20Packaging%20Syst/)
9. For the TRC collection, what restriction sites on the pLKO.1 vector were the hairpins
clone into?
The TRC hairpins were cloned in at AgeI and EcoRI, but the AgeI site is usually destroyed upon
ligation
10. Where can I get a TurboGFP antibody?
Our anti-GFP antibody will not work with TurboGFP. We are working on making anti-TurboGFP,
but for right now, you have to buy it directly from Evrogen:
http://www.evrogen.com/products/antibodies/AB-TurboGFPd.shtml
11. What are the diagnostic TRC pLKO.1 restriction digests?
BamHI digest gives 7032 band (linearizes the plasmid). BamHI/NdeI double digest gives 6238
and 794 bands. Note - BamHI is susceptible to Star Activity. If digests looks smeary, this could be
the culprit. New Engand Biolabs website has some guidelines for Star Activity.
http://www.neb.com/nebecomm/default.asp
12. Can you get expression from a CMV promoter in mouse cells?
Yes. The reference below shows CMV expression in mouse 3T3 and X63-Ag8.653 cells. Human
c-fos Promoter Mediates High-Level, Inducible Expression in Various Mammalian Cell Lines.
Biotechnol Bioeng 81: 848–854, 2003. Bi, et al.
13. How can I make/design my own shRNA?
At this time we do not offer a custom design/synthesis service for shRNA constructs. However,
there are a couple of resources available to design shRNA constructs. One is the RNAi Codex
website: http://cancan.cshl.edu/cgi-bin/Codex/Codex.cgi We don't guarantee the results, but you
may also refer to the following paper detailing the protocol for cloning shRNA into pSM2. This
protocol can also be used for cloning shRNA into the TMP, LMP, pSMP and pTRIPZ vectors as
the cloning sites (XhoI, EcoRI) are the same: Paddison, P et al (2004) 'Cloning of short hairpin
RNAs for gene knockdown in mammalian cells' Nature Methods Vol 1:2, 163-167 Please note
that the protocol in the Paddison publication is different from our protocols for subcloning
shRNAmir (available in the TMP, LMP, pSMP, pGIPZ or pTRIPZ product manuals).
14. What is the U6 promoter termination sequence?
The termination sequence for the U6 promoter is a series of T's (5-6) in a row.
15. Should I assay for knockdown using individual colonies or pools of colonies after
puromycin selection for shRNA?
With puromycin selection, it is best to pick individual colonies that are puromycin resistant and
test several colonies in knockdown experiments. The reason for this is depending on the site of
integration there could be variable levels of knockdown in different clonal populations. If you
select with puromycin and use a heterogeneous population for your knockdown experiments, you
may be diluting the rate of knockdown. However, this does not mean that knockdown cannot be
detected using a heterogeneous population.
16. Is the U6 promoter PolII or PolIII?
The U6 promoter is a RNA Polymerase III promoter . An example of a RNA Polymerase II
promoter is CMV.
17. In the shRNAmir vectors, how much extra sequence is present beyond the 97 nucleotides
of hairpin sequence after digestion with EcoRI and XhoI?
There will be 110bp fragment resulting from an XhoI/EcoRI double digest. XhoI cuts about 15nt
upstream of the hairpin. EcoRI cuts about 4nt downstream of the hairpin.
18. Is there a hygromycin marker in pGIPZ, pTRIPZ, and pLemiR and can it be used for
selection?
There is a hygromycin marker on the pGIPZ, pTRIPZ, and pLemiR vectors. It was present on the
parent plasmid that they were constructed from but its function has never been tested in house.
The hygromycin in the TRIPZ vector was specifically inactivated so it will not work. In theory
you could use the hygromycin marker for selection of cells transfected with the pGIPZ or pLemiR
plasmid but the hygromycin takes longer to have the desired effect than puromycin. You would
not be able to use hygromycin for selection of transduced cells because only what is between the
LTRs of the vectors would be packaged and the hygromycin marker lies outside of the LTRs.
19. What are the differences between the phenotypic effects of the GAPDH and EG5 positive
controls for pGIPZ?
Between EG5 and GAPDH, only EG5 causes a change in phenotype. This was seen by silencing
of the human EG5 (KIF11) gene in HEK293T cells (data shown in the pGIPZ technical manual:
http://dharmacon.gelifesciences.com/uploadedfiles/resources/gipz%20lentiviral%20shrna%20tech
nical%20manual.pdf). The cells were transduced using an EG5 lentiviral shRNAmir and stained
for DNA (DAPI, blue), tubulin (anti-tubulin, green), and EG5 (anti-EG5, red) 48 hours later. EG5
knockdown results in disruption of normal cell division and causes the formation of half spindles.
Cells transduced with EG5 shRNA are arrested in mitosis and show monoastral microtubular
arrays. By contrast, control cells show normal bipolar spindles and microtubule networks in
mitosis and in interphase (cell on the bottom left). GAPDH should not affect the cellular
phenotype or proliferation rate except as an off target effect. However, if GAPDH were to be
knocked down completely, it would likely kill the cells.
20. What is the E. coli host of the TRC shRNA clones?
The E. coli host strain of the TRC shRNA clones is DH5alpha.
21. Is TAT needed for packaging the pLKO.1 vector?
No TAT is not needed because transcription is still possible with CMV ( 5' LTR of the vector has
been modified by deleting U3 and adding CMV). However the presence of TAT in the packaging
plasmids enhances transcription by binding to TAR which is present in the chimeric 5'LTR.
22. Is the TRC lentiviral vector (pLKO.1) 2nd or 3rd generation?
The pLKO.1 vector is a 3rd generation vector because of the chimeric 5' LTR (U3 replaced with
CMV) which makes it TAT independent. Researchers can use second or third generation
packaging systems. However, second generation packaging systems are used and recommended
by the TRC and give much higher titers. This is because even though transcription can be driven
by CMV, the presence of the TAT transcativator in the second generation packaging system
enhances transcription by binding to TAR (element present in the 5' LTR).
23. Is there a link for protocols, vector, recommended lentiviral packaging systems and
general information for pLKO.1?
Please see this TRC link for protocols, vector, lentiviral packaging systems and general
information for pLKO.1: http://www.broad.mit.edu/genome_bio/trc/publicProtocols.html Please
see this link for protocols for cloning into the pLKO.1 vector:
http://www.addgene.org/pgvec1?f=c&cmd=showcol&colid=170&page=2 Please see these links
for general information on The RNAi Consortium: http://www.broad.mit.edu/genome_bio/trc/ or
trc_info@broad.mit.edu
24. Where can I get Gene Ontology (GO) data? Can I buy a set of products based on a GO
relationship?
You can find GO data for genes from a variety of web based sources. *GO
(http://www.geneontology.org/) *GOA (http://www.ebi.ac.uk/GOA/) *NCBI's RefSeq
(http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene) General resource for GO http://wiki.geneontology.org/index.php/Main_Page We can prepare a list of available expression
or RNAi resources based on your GO terms of interest! We also have many pre-defined sets
already available: http://www.openbiosystems.com/GeneSets/GeneFamiliesAndPathways/
Contact us for additiional information: http://www.openbiosystems.com/Support/
25. Why am I seeing non-specific knock-down?
Keep in mind that other associated or downstream genes can play a role in non-specific
knock-down. Ensure that you are using positive and negative controls. Also bear in mind that
some genes have mRNA that stays in the cell for a longer period of time than other genes. This
can affect the time it takes to observe gene knock-down. Another option is that the gene may be
temporally expressed, which can cause a false-positive for knock-down.