Distinguishing Bacteria by 16S ITS Sequencing
Purpose
Identification of bacteria by direct sequencing of 16S regions.
Materials
ABI GeneAmp 9700
OmniMix HS master mix beads (primary method, Cepheid) or 50x Titanium Taq DNA
polymerase (secondary method, Clontech)
Primers, primary method (Weisburg et al, 1991):
Forward primer fD1 (AGAGTTTGATCCTGGCTCAG, most eubacteria,)
Reverse primer rP1 (ACGGTTACCTTGTTACGACTT, enterics and most eubacteria)
Primers, secondary method:
Forward Primer U3 (AGTGCCAGCAGCCGCGGTAA, James, G. 2010)
Reverse Primer U4 (AGGCCCGGGAACGTATTCAC, James, G. 2010)
Forward Primer U515 (TGCCAGCAGCCGCGGTAATAC, Han, X. Y. et. al., 2002)
Reverse Primer U1087 (CGCTCGTTGCGGGACTTAACC, Han, X. Y., et. al. 2002)
Instructions
Sample preparation: Prepare an unquantified translucent suspension of a pure 3-day culture.
Primer preparation: Make 5 µM suspensions in 1x TNE buffer.
Primary Method:
Using one OmniMix HS bead per 50 µl rxn, add primers fD1 and rP1 to a final 250 nM
concentration and add sterile molecular-grade water for a 49 µl reaction volume, then
add 1 µl dilute suspended bacterial cells to the reaction.
Protocol name, primary method: Weisburg16s. rdna
Thermocycling settings, primary method:
 Initial hold at 95°C for 120 seconds
 35 cycles of 95°C for 20 seconds, 55°C for 20 seconds, and 72°C for 20 seconds
 8 to 20 minute extension step at 72°C.
Note: In our trials, most of our samples amplified well using an eight-minute final extension;
however, one bacterial amplicon did not amplify as efficiently as the others and would probably
benefit from the additional final extension time.
Secondary method:
Protocol name, secondary method: 16s-rdna
Thermocycling settings, secondary method:
 Initial hold at 95°C for 120 seconds
 30 cycles of 96°C for 15 seconds, 60°C for 90 seconds, and 72°C for 120 seconds
 Final 72°C extension for 300 seconds
 This is a 2.5 hour protocol.
Primer pairs used:
 U3 with U4
 U515 with U1087.
Using one OmniMix HS bead per 50 µl rxn, add primers to a final 250 nM concentration each,
add sterile molecular-grade water for a 49 µl reaction volume, then add 1 µl dilute
suspended bacterial cells to the reaction and amplify using the above thermocycling
settings.
Expected results
Primary method: Amplicon size is determined by running an agarose gel, and is expected to be
approximately 1500 base pairs.
Secondary method: Amplicon size is determined by running an agarose gel, and is expected to
be approximately 650 bp using primers U3 and U4 (this CAN yield an additional larger
band with some isolates, in addition to the primary band. The primer pair U515 and
U1087 yields a band of approximately 550 bp and no apparent secondary bands.
Sequencing of amplicons
Run a 5 µl volume on an agarose gel to verify amplification and product size. Run the
remaining 40 – 45 µl on a 1.5% gel and then excise the band. Clean it using QiaQuick gel
extraction kit (Qiagen, cat. no. 28704), taking care to follow instructions for direct sequencing.
Elute in 30 µl Buffer EB.
For amplicons generated using primers U3 and U4, sequence with U4 only (cost savings, better
sequence quality with this primer)
For amplicons generated using primers U1087 and U515, sequence with U1087 only (cost
savings)
Notes
Using the secondary methods, somewhat successful, but less so in our hands, a pair of primers
(U1 with U2) are also commonly used (James, G., 2010).
Resources
Han, X. Y., MD, PhD, Audrey S. Pham, PhD, Jeffery J. Tarrand, MD, Pramila K. Sood, MBA, and
Rajyalakshmi Luthra, PhD. 2002. Am. J. Clin. Pathol. 118:796-801.
James, G. 2010. Universal Bacterial Identification by PCR and DNA Sequencing of 16S rRNA
Gene. PCR for Clinical Microbiology. M Schuller et al. (eds.) DOI 10.10007/978-90-4819039-3_28, ©Springer Science+Business Media B.V.
Weisburg, William G., Susan M. Barns, Dale A. Pelletier, and David J. Lane. 1991. J. Bacteriol.
Jan. pp. 697-703.