Identification of Fungi by Direct Sequencing of ITS Regions
Sample preparation
One must have a pure culture for this technique. Grow culture in V8 or potato dextrose
broth (or some other suitable liquid medium) at room temperature in the dark for 48-72
hr. Tear off approximately 100 mg mycelium, rinse well in sterile Nanopure water, drain
off excess water aseptically, and add to a bead-beater tube containing two 5-mm diameter
beads. Hold on ice until ready for lysis. Add Buffer AP1 and RNase A, beat tube for 30
sec at 2500 rpm, incubate at 65°C as indicated in instructions for DNEasy Plant Mini Kit,
and follow remaining kit instructions.
PCR Master Mix (per 25 µl reaction; prepare sufficient mix for 12 reactions)
Nanopure water
sufficient to bring to 12.5 µl
Primer ITS1 or Primer ITS5, 5 µM
2.5 µl
Primer ITS4, 5 µM
2.5 µl
DNA polymerase*
0.5 µl
Sample genomic DNA
volume necessary to add 10 to 20 ng DNA
*I have successfully run this protocol with Failsafe PCR Enzyme Mix, but according to Dave
Zaitlin, that is not necessary for most targets. Therefore, although I have not yet tested it, I
suggest substituting Titanium Taq.
Mix 12.5 µl of Master Mix with 12.5 of each Epicentre Failsafe® PCR 2X Premix
(designated Premix A through L).
Primers
Prepare to a concentration of 5 µM (5 pmol/µl) in TNE buffer:
ITS1 (White et al, 1990)
5’- TCCGTAGGTGAACCTGCGG-3’
ITS5 (White et al., 1990)
5’-GGAAGTAAAAGTCGTAACAAGG-3’
ITS4 (White et al, 1990)
5’- TCCTCCGCTTATTGATATGC-3’
Cycling Protocol
Name of Protocol (GeneAmp 9700, max ramp rate): ITS1-ITS4
1. 95ºC for 120 sec
2. 35 cycles of: 95ºC for 30 sec
55ºC for 30 sec
72ºC for 60 sec
3. 72ºC for 600 sec
Duration of protocol: 2 hr 3 min
Expected Results
Amplicons from the primer pair ITS1-ITS4 commonly are from 600 to 650 bp.
Sequencing Amplicon
Pool amplicon from 2-3 successful reactions, and run 40-50 µl of reaction mixture in
three lanes joined together in a 1.5% agarose gel. Excise band and clean it using the
QiaQuick gel extraction kit or equivalent, paying special attention to instructions in the
kit which relate to direct sequencing. Elute in 30 µl Buffer EB, quantify, and submit for
sequencing.
Notes
If the reaction mixture given above fails to amplify a product, an alternative is to try
amplifying using the following primer pairs: ITS1 or ITS5 with ITS2 (5’GCTGCGTTCTTCATCGATGC-3’), and ITS3 (5’- GCATCGATGAAGAACGCAGC3’) with ITS4; ITS1 through ITS5 are from White et al. (1990).
Also, two primers exist which can be paired with ITS5 of White et al (1990) to amplify
the full ITS region of fungi that are not readily amplified using ITS1/ITS4 (Bertini et al.,
1999). One of these is “ITS6” (note that several published primers exist with that name)
and has the sequence 5’- TAC TGG GGC AAT CCC TGT TG -3’; the other is ITS7 and
has the sequence (5’-ACT CGC CGT TAC TGA GGC AAT-3’ (Bertini et al., 1999).
When either of these two primers is paired with ITS5, they have less of a tendency to
form dimers, hairpin loops and other interactions as compared to the primer pair
ITS1/ITS4 (Bertini et al., 1999).
For some basidiomycetes, use of the primer ITS1F (5′ CTTGGTCATTTAGAGGAAGTAA - 3′) with ITS4 is useful (de la Cerda et al, 2007;
Gardes and Bruns, 1993). Additional primer sequences useful for rust fungi, mushroomforming fungi, and other basidiomycetes can be found at
http://plantbio.berkeley.edu/~bruns/.
Be aware of the possibility of ITS primers which follow the naming convention
established by White et al (1990) which are taxon-specific rather than universal. For
example, there is a primer called “ITS6” (5′-AGGTAATCCCGGTTGGTTTC-3′) which
is designed to amplify Oidium species (Matsuda et al., 2005).
Resources
Bertini, L., Amicucci, A., Agostini, D., Polidori, E., Potenza, L., Guidi, C., Stocchi, V.
1999. A new pair of primers designed for amplification of the ITS region in Tuber
species. FEMS Microbiology Letters 173:239-245.
de la Cerda, K. A., Douhan, G. W., and Wong, F. P. 2007. Discovery and
characterization of Waitea circinata var. circinata affecting annual bluegrass from the
western United States. Plant Dis. 91:791-797.
Gardes, M., and Bruns, T. D. 1993. ITS primers with enhanced specificity for
Basidiomycetes - Application to the identification of mycorrhizae and rusts. Mol. Ecol.
2:113-118.
Matsuda, Y., Sameshima, T., Moriura, N., Inoue, K., Nonomura, T., Kakutani, K.,
Nishimura, H., Kusakari, S., Takamatsu, S., and Toyoda, H. 2005. Identification of
individual powdery mildew fungi infecting leaves and direct detection of gene expression
by single conidium polymerase chain reaction. Phytopathology 95:1137-1143.
White, T. J., Bruns, T., Lee, S. & Taylor, J. (1990). Amplification and direct sequencing
of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols : A guide to
Methods and Applications (ed. M. A. Innis, D. H. Gelfand, J. J. Sninsky & T. J. White),
pp. 315±322. Academic Press : San Diego, U.S.A.
http://www.biology.duke.edu/fungi/mycolab/primers.htm