Supplementary Information 410 475
Supplementary methods
Isolation of human, mouse, Xenopus, zebrafish and chick TSG sequences.
Text searching of the databases for 'twisted gastrulation' located five human EST clones. Two of
these, 1747- and 990-bp EST’s (GenBank Accession Nos. AA486291 and AI222228, respectively)
were obtained from Genome Systems and sequenced in their entireties on both strands. The 1747bp clone encoded the 3'-portion of the open reading frame and complete 3’-UTR, extending to a
poly(A) tail. The overlapping 990-bp clone included 30-bp of additional 5’-sequences plus 344-bp
of sequences unrelated to TSG at its 5’ end, suggesting chimerism. Thus, nested primers were
designed, just 3' of the 344-bp of unrelated sequences, for 5' RACE PCR to obtain remaining TSG
coding and 5’-UTR sequences. The primary reaction was with primer 5'GTATCTCCTTCTGTGAGTGCCCGGAAG-3', the nested reaction with primer 5'CTCCACTGTGCTCTTTGAAGTTGGAGG-3', and template was human aorta Marathon-ready
cDNA (Clontech). The product contained 430-bp of additional 5' sequences including 281 bp of
additional coding sequences and 149-bp of 5'-UTR. The Accession No. for the full-length human
TSG sequence is AF196834.
To obtain chick TSG sequences, a 597-bp NheI-NotI restriction fragment of mouse TSG
cDNA was used to screen a Hamburger-Hamilton (HH) Stage 20 white Leghorn chick embryo
(bodies only)
Filters were washed at low stringency (55 0C), yielding 6 positive clones that contained
overlapping TSG sequences, yielding a composite sequence comprising 814 bp of 3’ UTR and 647
bp of coding region, but lacking sequences encoding the first nine residues of the signal peptide.
Subsequent PCR with nested TSG-specific reverse primers 5’GCAGAGCATGCACTCCTTGCAGCAGG-3’and 5’-CACTGACACAGCTCCTGGATGAGG-
3’, a forward T7 primer, and DNA extracted from the
product containing the remaining 28 bp of 5’ TSG coding sequence and a portion of 5’ UTR. The
Accession No. for the full-length chick TSG sequence is AF255731.
Text searching of the databases for 'twisted gastrulation' identified one zebrafish EST
(Accession No. AW153603), which was obtained from Genome Systems. The ~3.2 kb insert was
sequenced on both strands revealing a full-length open reading frame of 651 bp, 64 bp of 5'UTR
and 467 bp of 3'UTR. The Accession No. for the full-length zebrafish TSG sequence is
AF261692.
A full-length Xenopus TSG cDNA clone was obtained from a Xenopus gastrula
cDNA library28 using previously described low-stringency screening conditions29 and a 315-bp
NheI-PvuII restriction fragment probe from the 5’-portion of the murine TSG cDNA clone. The
Accession No. for the full-length Xenopus TSG sequence is AF279246.
Gene mapping. The human TWSG1 gene was radiation hybrid mapped30, via PCR analysis of the
Gene bridge 4 radiation hybrid panel (Research Genetics) with primers 5'TGGTCATATGAGAAGCAGGTGCG-3' (forward) and 5'AATTCCTGTCCCATCAGCCGTCTGC-3' (reverse), that amplified a 760-bp product from
human genomic DNA. Scoring was submitted to the WICGR Mapping Service (Whitehead
Institute/MIT Center for Genome Research), which mapped TWSG1 to chromosome 18p11, 6.61
cR from WI-5607 and 5.13 cR from D18S464 (Lod 0.11 relative to most likely). The mouse
Twsg1 gene was mapped by PCR analysis of 94 progeny of the C57BL/6J X Mus Spretus (BSS)
backcross31, using primers 5'-GTAAAAGCAGCGGGACTGTAGGCG-3' (forward) and 5'AAGAGACAGGTGTAGACACGTAGG-3' (reverse) to amplify 199- (C57BL/6J) and 223-bp (M.
Spretus) products corresponding to 3'-UTR sequences. Segregation of these products in the BSS
backcross progeny showed linkage of Twsg1 to distal chromosome 17, and cosegregation with the
gene Rip1 offset 38.0 from the centromere. This region has several loci with cognates mapping to
human chr. 18p11 (eg. Lama1, Ptprm, and Zfp16). The zebrafish gene was mapped with a
zebrafish/hamster radiation hybrid panel (Research Genetics) by PCR amplification of the most 3'
24-bp of the TSG open reading frame and 293-bp of 3’-UTR, with primers 5'GAACTGCCTGATCTGAGGCTCCAC-3' (forward) and 5'-GCCGCATCCTGACCAAAACC-3'
(reverse), which amplified a 317-bp product from zebrafish genomic DNA. Data were submitted
to the Tubingen zebrafish radiation hybrid database which mapped the gene 63.9 to 75.2 cM from
the top of linkage group 2.
Production of recombinant proteins. Mouse TSG coding sequences (with or without a
COOH-terminal Protein C epitope tag), without signal peptide sequences, were generated by PCR
using a full-length mouse TSG cDNA (the kind gift of Dr. Michael B. O’Connor, University of
Minnesota, Minneapolis, MN) template, forward primer 5’ACTGTCAGCTAGCATGTAACAAAGCACTCTGTGCCAGC-3’ (includes NheI site for
cloning) and either 5’-GTCAGCGGCCGCTAAAACATGCAGTTCATACACTTGAC-3’ (no tag)
or 5’GTCAGCGGCCGCTACTTACCATCGATTAACCGTGGATCTACCTGATCTTCAAACATGC
AGTTCATACACTTGAC-3’ (includes Protein C epitope sequences) as reverse primers, both of
which include a Not I site for cloning. After digestion with NheI and NotI, PCR products were
inserted between the NheI and NotI sites of expression vector pCEP-Pu/BM40s32 downstream of,
and in the same frame as, sequences for the BM40 signal peptide, used to maximize secretion
efficiency.
To produce Flag-tagged proteins, or non-tagged mRNAs for Xenopus embryo injections
(see below), corresponding to Chordin cleavage fragments, PCR was performed using a full-length
murine Chordin cDNA10 template. For the 15-kDa NH2-terminal fragment containing CR1 the
forward primer was 5’-GCTAGCTAGCAACTGGCCCTGAGCCCCCAGCACTGCC-3’ and
reverse primers were 5’-GCTAGCGGCCGCTAACTGTAACTGCGATGCTCTGGATCC-3’
(non-tagged) or 5’
GCTAGCGGCCGCTACTTGTCGTCATCGTCCTTGTAGTCACTGTAACTGCGATGCTCTG
GATCC-3’ (Flag-tagged). For the 29-kDa fragment containing CR’s 2 and 3 the forward primer
was 5’-GATAGCTAGCAACGTCACCCATGCTGCCTGCTGGCCC-3’ and reverse primers were
5’-GCTAGCGGCCGCTAAGCCTGCATGGGGTCTCCCAGCTTGG-3’ (non-tagged) or 5’GCTAGCGGCCGCTACTTGTCGTCATCGTCCTTGTAGTCAGCCTGCATGGGGTCTCCCA
GCTTGG-3’ (Flag-tagged). For the 65-kDa internal fragment containing no CR’s primers were
5’-GATAGCTAGCAGATCGAGGGGAACCCGGCGTTGGGGAGC-3’ (forward) and 5’GCTAGCGGCCGCTAAGCCGCCTCTCCATTTGGAGCCAAGGGC-3’ (reverse, non-tagged).
For the 13-kDa COOH-terminal fragment containing CR4 the forward primer was 5’GATAGCTAGCAGATGGGCCTCGGGGGTGTCGCTTTGC-3’ and reverse primers were 5’GCTAGCGGCCGCTAGGAGTGCTCCGCTTCTTTCTCCAGC-3’ (non-tagged) or 5’GCTAGCGGCCGCTACTTGTCGTCATCGTCCTTGTAGTCGGAGTGCTCCGCTTCTTTCTC
CAGC-3’ (Flag-tagged). 5’ and 3’ primers contain NheI site and NotI sites, respectively, for
cloning. Tagged versions were inserted into pCEP-Pu/BM40s for protein expression, while nontagged versions were inserted into a modified pCS2+ vector (see below) downstream of and inframe with BM40 signal peptide sequences. Fidelity of all constructs was confirmed by
sequencing of inserts and junctions on both strands.
293-EBNA cells were maintained and transfected, as described10. After 48 h cells were
selected and grown to confluence in the presence of 5
cultures were washed 3 times with PBS and then switched to serum-free DMEM containing 40
/ml soybean trypsin inhibitor (SBTI) (Sigma). After 24 h, medium was harvested and leupeptin
and PMSF added to final concentrations of 10 /ml and 0.4 mM, respectively. Fresh serum-free
medium was added to cells and similarly collected after additional 24 h. Media samples from 24
and 48 h harvests were pooled and centrifuged to remove debris.
Recombinant Flag-tagged Chordin, BMP-1, mTLL-1, mTLD and mTLL-2 were produced
and all Flag-tagged proteins were affinity-purified as described10. Affinity-purification of Protein
C-tagged TSG was at 4 oC. Conditioned medium, adjusted to 1 mM CaCl2, 0.2% Brij-35, was
recirculated over an anti-Protein C affinity column (Boehringer Mannheim), washed with 20 mM
Tris pH 7.5, 1M NaCl, 1 mM CaCl2 and equilibrated in 20 mM Tris-HCl, pH 7.5, 0.15 M NaCl, 1
mM CaCl2. TSG for enzymatic assays was eluted with 20 mM Tris-HCl, pH 7.5, 0.15 M NaCl, 1
mM CaCl2 containing 1 mg/ml Protein C peptide. TSG for immunoprecipitations was eluted with
20 mM Tris-HCl, pH 7.5, 0.15 M NaCl, 5 mM EDTA. Concentrations of purified TSG were
calculated by comparing intensities of stained bands of serial dilutions to those of serially diluted
protein standards of known concentrations. Staining was with the Gelcode E-Zinc Reversible Kit
(Pierce) and/or Coomassie Blue.
Supplementary Figure:
Supplementary Figure 1 Legend
Comparison of vertebrate TSG amino acid sequences. (A) Alignment of TSG amino acid
sequences for human (hTSG), mouse (mTSG), chick (cTSG), Xenopus (xTSG), and zebrafish
(zTSG) with Drosophila TSG (dTSG) amino acid sequences6 and those of two recently reported
gene products of the Drosophila genome (dCG11582 and dCG12410). Cysteines are circled,
residues that are identical in at least four of the different gene products are shaded, potential Nglycosylation sites are boxed, and arrows mark the signal peptide cleavage sites predicted by the
method of Nielsen et al. (1997). Alignment was performed using the program PILEUP, from the
Genetics Computer Group. (B) Percentages of similarity and percentages of identity
(parentheses) between the various TSG sequences were obtained by alignment using the GAP
program (Genetics Computer Group). The Drosophila melanogaster genome contains a gene
product (CG12410) highly similar in sequence to TSG. Thus, vertebrate species are also each
likely to contain more than one gene for TSG proteins. Although all characterized vertebrate TSG
sequences are slightly more similar to TSG than to CG12410 (Fig. 1B), it is not possible at this
time to conclude that any of the vertebrate sequences presented here correspond to one or the other
Drosophila protein. Finally, another Drosophila TSG like sequence, CG11582, is truncated in
relation to other TSG sequences, but has high sequence similarity to both TSG and CG12410 (Fig.
1B). The human TSG gene, TWSG1, was mapped to chromosome band 18p11, while the murine
TSG gene, Twsg1, was mapped to a region of distal chromosome 17 syntenic to human 18p11, it is
likely that these are the human and mouse homologs of the same gene, rather than genes for
related but genetically distinct gene products. Despite the possibility that defects in TSG might be
associated with developmental abnormalities or other disease states, candidate diseases and
abnormal phenotypes have not been mapped to the same chromosomal regions as TWSG1 or
Twsg1. The same is true for the zebrafish TSG gene, which was mapped between 63.9 and 75.2
cM from the top of linkage group 2.