Chapter 13: Genetic Technology
advertisement
Chapter 14: The Human Genome Making a Pedigree Pedigree – a graphic representation of genetic inheritance Symbols of a Pedigree Male Female Death Married Children Twins Affected Individuals Carrier Analyzing a Pedigree I II III 1 Recessive Alleles Genetic Disorders – the harmful effects produced by mutated genes Most genetic disorders are caused by recessive alleles Some are common in certain ethnic groups Cystic Fibrosis Recessive disorder Carried on chromosome #7 Fairly common in white Americans 1 in 20 carrier the allele 1 in 2000 have the disorder A defective protein causes thick mucus to accumulate in the lungs and digestive tract Usually don’t survive to adulthood New drug therapies and special diets have raised the life expectancy Tay-Sachs Recessive disorder Affects central nervous system Lipids build up in brain Death in early childhood Common in US among Jews Phenylketonuria (PKU) Recessive disorder Carried on chromosome #12 Failure of brain to develop in infancy Phenylalanine is not broken down so it builds up and causes mental retardation Common in people whose ancestors came from Norway or Sweden Newborns appear normal until they drink milk PKU test is given at birth Infants are given diets low in phenylalanine until their brains are fully developed Dominant Alleles A single dominant allele inherited from one parent is all that is needed to show the trait Huntingtons Disease Dominant disorder Breakdown of certain areas of the brain Uncontrollable movements Onset usually occur between 30-50 Achondroplasia Dominant disorder dwarfism 2 Codominant Alleles Sickle Cell Anemia Recessive disorder Most common in black Americans 1 in 12 African Americans is heterozygous for the trait In homozygous individuals the oxygen carrying protein hemoglobin is defective This causes red-blood cells to be sickle shape and reduces there oxygen carrying capacity Heterozygous individuals have both normal and sickle shaped red-blood cells because they are codominant Sex Determination 23 pairs of chromosomes 22 pairs are autosomes 1 pair is sex chromosomes Female XX Male XY Sex-Linked Inheritance Sex-linked traits – traits controlled by genes on sex chromosomes Any allele on the X chromosome of a male will not be masked by a corresponding allele on the Y chromosome If a son receives a recessive X chromosome from mom he will express the recessive phenotype because he has no chance of inheriting a dominant allele from his father to mask the recessive allele More males have sex-linked disorders Red-Green Color Blindness Sex linked recessive Can’t tell the difference between red and green Hemophilia Sex linked recessive Failure of blood to clot Muscular Dystrophy Sex linked recessive Wasting away of muscles X-Chromosome Inactivation If one X is enough how do cells adjust to extra X in females? In females 1 X is randomly switched off Turned off X is called a Barr body Example: Calico Cat In cats the gene for fur color is on the X chromosome 1X could have the allele for orange and the other the allele for black So depending on which allele is turned off or on gives the different colors All cats with 3 colors are female 3 14-2 Human Heredity Karyotype – a chart of chromosome pairs that is valuable in pinpointing unusual chromosome numbers in cells A picture is taken of chromosomes in metaphase. Why? Because they are coiled up tightly and lined up so they are very visible. They are cut out and arranged in pairs according to length and location of the centromere Chromosomal Disorders Disorders caused by nondisjunction Down Syndrome – Trisomy 21 Some degree of mental retardation Incidence of down syndrome births is higher in older mothers especially over 40 3 chromosomes on pair number 21 Patau Syndrome – Trisomy 13 Multiple abnormalities Condition usually fatal by one year of age Edward Syndrome – Trisomy 18 Varying degrees of mental retardation Usually fatal by three months of age Sex Chromosome Disorders Disorders caused by nondisjunction Turner Syndrome X ____ Females Sterile Shorter, stocky Triple X XXX Females Usually fertile Abnormalities vary 4 Klinefelter Syndrome XXY Males Sterile May be mentally retarded Slight breast development Underdeveloped genitalia Sparse body hair Jacob Syndrome XYY Males Sterile Environmental Influences As an organisms develops many factors can influence how the gene is expressed or if it is expressed at all Temperature, nutrition, light, chemicals can all influence gene expression Ex. Leaves of different sizes Ex. Himalayan rabbit fur color Ex. Arctic Fox fur color 5 Chapter 13: Genetic Engineering 13.2 Manipulating DNA Molecular Biology DNA Fingerprint – a sequence of bands that shows a persons DNA sequence How to make a DNA Fingerprint 1. DNA Extraction Cell is opened and the DNA is separated from the other cell parts 2. Cutting DNA DNA is so long we cut it into smaller fragments Restriction Enzymes – cut DNA at a specific sequence of nucleotides Types of Restriction Enzymes EcoRI - C T T A A G GAATTC Bam I - C C T A G G GGATCC Hae III - C C G G GGCC 3. Separating DNA Gel Electrophoresis – a technique for separating DNA DNA is negatively charged Load DNA into gel Apply electric voltage to gel DNA will move through gel to positive Smaller DNA fragments move faster and further How do you end up with different size fragments that are unique to each individual? Tandem Repeat – region of a chromosome that contains multiple copies of a DNA sequence The origin and significance of tandem repeats is a mystery For forensic scientists they offer a means of distinguishing one individual from another through DNA fingerprinting 30% of human genome is composed of tandem repeats. Tandem repeats seem to act as filler or spacers between the gene regions of DNA 6 Polymerase Chain Reaction (PCR) PCR – the process of making many copies of genes Heat DNA to separate two strands As it cools DNA polymerase starts making copies Repeat this process and end up with millions of copies 7 13-3 Cell Transformation Transformation – one organism is changed by a gene or genes from another organism Genetic Engineering – method of cutting DNA from one organism and inserting the DNA into another organism Recombinant DNA – DNA made by recombining fragments of DNA from different sources Plasmid Extra circular DNA found in some bacteria Very useful for DNA transfer from one organism into another Process of Transformation 1. Cut out gene of interest with restriction enzyme 2. Use same restriction enzyme to cut plasmid This creates ends on each that will match up 3. Combine the gene of interest with the plasmid 4. Place the recombinant DNA into a bacteria cell 5. Bacteria will replicate this new DNA and make many copies of the gene of interest 13-4 Applications of Genetic Engineering When recombinant DNA is put into a host that organism will use the foreign DNA as if it were its own. Transgenic Organisms – contain functional foreign DNA Ex. Glowing bacteria 8 Application of DNA Technology Transgenic bacteria in agriculture A bacteria on strawberry plants promotes frost damage on leaves. The gene for this protein is removed and frost damage is prevented. A bacteria that lives in soil and in the roots of plants can be engineered to increase the rate of conversion of atmospheric nitrogen to nitrates, a natural fertilizer, to help cut back on fertilizer use and cost Transgenic bacteria in industry Used to clean up oil spills Extract valuable minerals from ores Transgenic bacteria in medicine The production of growth hormone to treat dwarfism Human insulin used to treat diabetes Transgenic plants Have been genetically engineered to resist herbicides, produce internal pesticides or increase their protein production. Produce rice with vitamin A In 2000 52% of soybeans and 25% of corn grown in US was genetically modified Transgenic Animals Make animals grow faster and produce leaner meat Trying to produce chickens resistant to bacterial infections that cause food poisoning Cows produce different human proteins in their milk Cloning Clone – genetically identical offspring produced from a single cell In 1997 Scottish scientist Ian Wilmut cloned first mammal, a sheep named Dolly 9 14-3 Human Molecular Genetics Human Genome Project Human Genome Project An international effort to completely map and sequence the human genome Started in 1990 and completed in 2000 How did they do it? First determined markers – a sequence of bases in widely separated regions of DNA Cut DNA into random fragments Determined sequences of the fragments Computers found areas of overlap between the fragments One surprise was how few genes humans have Fruit fly – 14,000 Tiny worm – 20,000 Human – 25,000 A human diploid cell contains more than 3 billion base pairs Only about 2% of the DNA in your chromosomes functions as genes The average human gene consists of about 3000 base pairs The largest gene in the human genome has more than 2 million base pairs Chromosome 22 and 21 were the first 2 human chromosomes sequenced Chromosome 22 Contains approximately 43 million base pairs 545 genes 1 causes leukemia 1 neurofibromatosis Chromosome 21 Approximately 32 million base pairs 225 genes Lou Gehrigs disease (ALS) – loss of muscle control due to destruction of nerves in the brain and spinal cord 10 Chapter 14: The Human Genome Making a Pedigree Pedigree – Symbols of a Pedigree Male Female Death Married Children Twins Affected Individuals Carrier Analyzing a Pedigree I II III 11 Recessive Alleles Genetic Disorders – Most genetic disorders are caused by _______________ alleles Some are common in certain ethnic groups Cystic Fibrosis Recessive disorder Carried on chromosome ________ Fairly common in __________ _______________ 1 in ________ carrier the allele 1 in ________ have the disorder A defective ____________ causes thick mucus to accumulate in the lungs and digestive tract Usually don’t survive to _______________ New drug therapies and special diets have raised the life expectancy Tay-Sachs Recessive disorder ____________ build up in brain Death in early childhood Common in US among ____________ 12 Phenylketonuria (PKU) Recessive disorder Carried on chromosome __________ __________________ is not broken down so it builds up and causes mental retardation Common in people whose ancestors came from Norway or Sweden Newborns appear normal until they drink ____________ PKU test is given at birth Infants are given diets low in phenylalanine until their brains are fully developed Dominant Alleles A single dominant allele inherited from one parent is all that is needed to show the trait Huntingtons Disease Dominant disorder Uncontrollable movements Onset usually occur between ______-______ Achondroplasia Dominant disorder 13 Codominant Alleles Sickle Cell Anemia Recessive disorder Most common in ____________ ________________ 1 in ______ African Americans is _________________ for the trait In homozygous individuals the oxygen carrying protein hemoglobin is defective This causes red-blood cells to be sickle shape and reduces there __________ carrying capacity Heterozygous individuals have both __________ and __________ shaped redblood cells because they are codominant Sex Determination ______ pairs of chromosomes 22 pairs are _______________ 1 pair is ________ chromosomes Female ________ Male ________ Sex-Linked Inheritance Sex-linked traits – Any allele on the X chromosome of a male will not be masked by a corresponding allele on the Y chromosome If a son receives a recessive X chromosome from mom he will express the recessive phenotype because he has no chance of inheriting a dominant allele from his father to mask the recessive allele More __________ have sex-linked disorders 14 Red-Green Color Blindness Sex linked _______________ Can’t tell the difference between red and green Hemophilia Sex linked recessive Muscular Dystrophy Sex linked recessive X-Chromosome Inactivation If one X is enough how do cells adjust to extra X in females? In females 1 X is randomly ____________ ________ Turned off X is called a __________ __________ Example: Calico Cat In cats the gene for fur color is on the X chromosome 1X could have the allele for __________ and the other the allele for __________ So depending on which allele is turned off or on gives the different colors All cats with 3 colors are ____________ 15 14-2 Human Heredity Karyotype – A picture is taken of chromosomes in metaphase. Why? They are cut out and arranged in pairs according to length and location of the centromere Chromosomal Disorders Disorders caused by nondisjunction Down Syndrome – ____________ ______ Some degree of mental retardation Incidence of down syndrome births is higher in older mothers especially over 40 ______ chromosomes on pair number 21 Patau Syndrome – ____________ ______ Multiple abnormalities Condition usually fatal by one year of age Edward Syndrome – ___________ ______ Varying degrees of mental retardation Usually fatal by three months of age 16 Sex Chromosome Disorders Disorders caused by nondisjunction Turner Syndrome Triple X Klinefelter Syndrome May be mentally retarded Slight __________ development Underdeveloped ____________ 17 Jacob Syndrome Environmental Influences As an organisms develops many factors can influence how the gene is expressed or if it is expressed at all Temperature, nutrition, light, chemicals can all influence gene expression Ex. Ex. Ex. 18 Chapter 13: Genetic Engineering 13.2 Manipulating DNA Molecular Biology DNA Fingerprint – How to make a DNA Fingerprint 1. DNA Extraction Cell is opened and the _______ is separated from the other cell parts 2. Cutting DNA DNA is so long we cut it into smaller fragments Restriction Enzymes – Types of Restriction Enzymes EcoRI - CTTAA Ex: ACTGCTTAAGGCATTGCCTTAACAGGCTA Bam I - CCTAG Ex: GCTTACCCTAGATGACGTTACTTACAGGC Hae III - CCGG Ex: CCGATACGCTCCGGACTACCGGATCCGGAT 3. Separating DNA Gel Electrophoresis – DNA is _______________ charged Load DNA into gel DNA will move through gel to _______________ _______________ DNA fragments move faster and further 19 How do you end up with different size fragments that are unique to each individual? Tandem Repeat – The origin and significance of tandem repeats is a mystery For forensic scientists they offer a means of distinguishing one individual from another through DNA fingerprinting _______ of human genome is composed of tandem repeats. Tandem repeats seem to act as filler or spacers between the gene regions of DNA Polymerase Chain Reaction (PCR) PCR – Heat DNA to separate two strands As it cools DNA polymerase starts making copies Repeat this process and end up with millions of copies 20 13-3 Cell Transformation Transformation – Genetic Engineering – Recombinant DNA – Plasmid Very useful for DNA transfer Process of Transformation 1. Cut out gene of interest with _______________ enzyme 21 2. Use same restriction enzyme to cut _______________ This creates ends on each that will match up 3. Combine the gene of interest with the plasmid 4. Place the recombinant DNA into a _______________ ________ 5. Bacteria will _______________ this new DNA and make many copies of the gene of interest 13-4 Applications of Genetic Engineering When recombinant DNA is put into a host that organism will use the foreign DNA as if it were its own. Transgenic Organisms – Ex. Application of DNA Technology Transgenic bacteria in agriculture 22 A bacteria on strawberry plants promotes frost damage on leaves. The gene for this protein is removed and frost damage is prevented. Another bacteria that lives in soil and in the roots of plants can be engineered to increase the rate of conversion of atmospheric nitrogen to nitrates, a natural fertilizer, to help cut back on fertilizer use and cost Transgenic bacteria in industry Used to clean up ______ __________ Transgenic bacteria in medicine The production of growth hormone to treat ____________ Transgenic plants Have been genetically engineered to resist herbicides, produce internal pesticides or increase their protein production. In 2000 _______ of soybeans and _______ of corn grown in US was genetically modified Transgenic Animals Make animals grow faster and produce leaner meat Trying produce chickens resistant to bacterial infections that cause food poisoning Cows produce different human _______________ in their milk 23 Cloning Clone – _______ Scottish scientist Ian Wilmut cloned first mammal, Dolly the Sheep 14-3 Human Molecular Genetics Human Genome Project Human Genome Project An international effort to completely map and sequence the human genome Started in _______ and completed in _______ How did they do it? 24 First determined markers – Cut DNA into random fragments Determined _______________ of the fragments Computers found areas of overlap between the fragments One surprise was how few genes humans have Fruit fly – Tiny worm – Human – A human diploid cell contains more than _______ billion base pairs Only about _______ of the DNA in your chromosomes functions as genes The average human gene consists of about _______ base pairs The largest gene in the human genome has more than _______ million base pairs Chromosome 22 and 21 were the first 2 human chromosomes sequenced Chromosome 22 Contains approximately _______ million base pairs 1 gene causes _______________ 1 gene causes _______________ Chromosome 21 Approximately _______ million base pairs Lou Gehrigs disease (ALS) – 25
