Michael Cochran-Boucher
Jane Russell
Genetics Spring 2010
Manipulating Recombinant DNA: Restriction Mapping
and Designing a Recombinant DNA Project Proposal
We present for your review, a proposal which utilizes Webcutter, “online tools to assist scientists working with
restriction enzymes and manipulating recombinant DNA for different applications, such as restriction mapping and
designing primers for PCR experiments,” presented by Klug et al. in their textbook Essentials of Genetics. Our
developing hypothesis will involve utilization of “early gene-expression tests,” as shown in the primary research
article Early Test for a Killer of the Sickest (Duke University Medical Center, 2010).
References List
Alby et al. Homothallic and Heterothallic Mating in the Opportunistic Pathogen Candida albicans.
Nature, 2009; 460 (7257): 890 DOI: 10.1038/nature08252
Brown University (2009, August 16). Fungus Found In Humans Shown To Be Nimble In Mating Game.
ScienceDaily. Retrieved March 4, 2010, from http://www.sciencedaily.com /releases/2009/08/090812163750.htm
Case Western Reserve University (2009, June 13). New Way The Body Fights Fungal Infection
Discovered. ScienceDaily. Retrieved March 4, 2010, from http://www.sciencedaily.com
/releases/2009/06/090611120742.htm
Duke University Medical Center (2010, March 4). Early Test for a Killer of the Sickest. ScienceDaily.
Retrieved March 4, 2010, from http://www.sciencedaily.com /releases/2010/03/100303141928.htm
University College London (2009, October 30). Genetic Links To Fungal Infection Risk Identified.
ScienceDaily. Retrieved March 4, 2010, from http://www.sciencedaily.com /releases/2009/10/091028192611.htm
The following three articles have good content on the topic manipulating recombinant DNA. Our intention is to
present the page in a scientific style, with a variety of text and visual aids to get out our message.
Minaeva NI, Gak ER, Zimenkov DV, Skorokhodova AY, Biryukova IV, Mashko SV.
Dual-In/Out strategy for Genes Integration into Bacterial Chromosome: A novel approach to step-by-step
construction of plasmid-less marker-less recombinant E. coli strains with predesigned genome structure. BMC
Biotechnol. 2008 Aug 12;8:63. PubMed PMID: 18699991; PubMed Central PMCID: PMC2532685.
Yao C, Luo J, Hsiao CH, Donelson JE, Wilson ME. Leishmania Chagasi: A
tetracycline-inducible cell line driven by T7 RNA polymerase. Exp Parasitol.
2007 Jul;116(3):205-13. Epub 2007 Jan 19. PubMed PMID: 17320870; PubMed
Central PMCID: PMC2231517.
Wheeler DA, Srinivasan M, Egholm M, Shen Y, Chen L, McGuire A, He W,
Chen YJ, Makhijani V, Roth GT, Gomes X, Tartaro K, Niazi F, Turcotte CL,
Irzyk GP, Lupski JR, Chinault C, Song XZ, Liu Y, Yuan Y, Nazareth L, Qin X,
Muzny DM, Margulies M, Weinstock GM, Gibbs RA, Rothberg JM. The Complete
Genome of an Individual by Massively Parallel DNA Sequencing. Nature. 2008
Apr 17;452(7189):872-6. PubMed PMID: 18421352.
The end result will be the completion of the wiki page at http://janeandmichaelsgeneticswiki.wikispaces.com/
Which will include the following:





description of the project
resources
data collected
data analyzed
discussion of the results
“These Web resources will enhance the concepts described by Klug et al. in their textbook Essentials of Genetics”
and will be included on our wikispace.
The Cloning Vector Collection This is an online resource for biologists that includes a comprehensive list of Recombination DNA
vectors to browse.
Southern Blot These lecture notes from Davidson College provide an excellent visual and textual description of the Southern blot
method.
PCR for Diagnosis Roche Molecular Diagnostics provides this resource that describes the utility of PCR for diagnostic medicine.
Human Genome Project Overview Mapping and Sequencing the Human Genome is an overview of the challenges faced by the
Human Genome Project. It includes a description of current sequencing technology as well as other techniques that are being
developed.
The following Genetics News RSS Feed will provide the up to the minute breaking news on current status of our
area of research: Chapter 17: Recombinant DNA Technology and Gene Cloning – In the News
ScienceDaily: Genetics News
“Your proposal should also include the answers to any text problems or
questions posed for your topic to demonstrate completion of those
activities.” – Dr. K
The following pages represent the start to solving the questions posed by our topic “Manipulating
Recombinant DNA”, but since it is found in Chapter 17, further research will be forthcoming in this area.
Exercise I: Creating a Restriction Map in Webcutter
Suppose you had cloned and sequenced a gene and you wanted to design a probe approximately 600 bp
long that could be used to analyze the expression of this gene in different human tissues by northern blot
analysis. Not too long ago, you had primarily two ways to approach this task. You could digest the cloned
DNA with whatever restriction enzymes were in your freezer, and then run agarose gels and develop
restriction maps in the hope of identifying cutting sites that would give you the size fragment you wanted.
Or you could scan the sequence with your eyes, looking for restriction sites of interest—a very time–
consuming and eye–straining effort! Internet sites such as Webcutter take the guesswork out of
developing restriction maps and make it relatively easy to design experiments for manipulating
recombinant DNA. In this exercise, you will use Webcutter to create a restriction map of human DNA with
the enzymes EcoRI, BamHI, and PstI.
1. Access Webcutter at http://rna.lundberg.gu.se/cutter2. Copy the sequence of cloned human DNA
shown below and paste it into the text box in Webcutter. (Hint: Access this sequence from the Companion
Web site so that you can copy and paste the sequence into Webcutter.)
Human DNA Sequence
CCCCAGGAGACCTGGTTGTGGAATTCTGTGTGTGAGTGGTTGACCTTCCTCCATCCCCTGGTCCTTCCCTTCCCTTCCCGAGGCACAGAGAGACAGGGCAGGATCCACGTGCC
CATTGTGGAGGCAGAGAAAAGAGAAAGTGTTTTATATACGGTACTTATTTAATATCCCTTTTTAATTAGAAATTAAAACAGTTAATTTAATTAAAGAGTAGGGTTTTTTTTCA
GTATTCTTGGTTAATATTTAATTTCAACTATTTATGAGATGTATCTTTTGCTCTCTCTTGCTCTCTTATTTGTACCGGTTTTTGTATATAAAATTCATGTTTCCAATCTCTCT
CTCCCTGATCGGTGACAGTCACTAGCTTATCTTGAACAGATATTTAATTTTGCTAACACTCAGCTCTGCCCTCCCCGATCCCCTGGCTCCCCAGCACACATTCCTTTGAAATA
AGGTTTCAATATACATCTACATACTATATATATATTTGGCAACTTGTATTTGTGTGTATATATATATATATATGTTTATGTATATATGTGATTCTGATAAAATAGACATTGCT
ATTCTGTTTTTTATATGTAAAAACAAAACAAGAAAAAATAGAGAATTTACATACTAAATCTCTCTCCTTTTTTAATTTTAATATTTGTTATCATTTATTTATTGGTGCTACTG
TTTATCCGTAATAATTGTGGGGAAAAGATATTAACATCACGTCTTTGTCTCTAGTGCAGTTTTTCGAGATATTCCGTAGTACATATTTATTTTTAAACAACGACAAAGAAATA
CAGATATATCTTAAAAAAAAAAAAGCATTTTGTATTAAA GAATTTAATTCTGATCTGCAGCTCAAAAAAAAAAAAA
2. Scroll down to "Please indicate which enzymes to include in the analysis." Click the button indicating
"Use only the following enzymes." Select the restriction enzymes EcoRI, BamHI, and PstI from the list
provided, then click "Analyze sequence." (Note: Use the command, control, or shift key to select multiple
restriction enzymes.)
3. After examining the results provided by Webcutter, create a table showing the number of cutting sites
for each enzyme and the fragment sizes that would be generated by digesting with each enzyme. Draw a
restriction map indicating cutting sites for each enzyme with distances between each site and the total
size of this piece of human DNA.
Table by Enzyme Name
Enzyme Name
No. Cuts
Positions of sites
Recognition sequence
BamHI
EcoRI
PstI
1
1
1
101
21
850
g/gatcc
g/aattc
ctgca/g
Every enzyme analyzed cuts this sequence.
EcoRI
ccccaggagacctggttgtggaattctgtgtgtgagtggttgaccttcctccatcccctggtccttcccttccct
ggggtcctctggaccaacaccttaagacacacactcaccaactggaaggaggtaggggaccaggaagggaaggga
base pairs
1 to 75
BamHI
tcccgaggcacagagagacagggcaggatccacgtgcccattgtggaggcagagaaaagagaaagtgttttatat
agggctccgtgtctctctgtcccgtcctaggtgcacgggtaacacctccgtctcttttctctttcacaaaatata
PstI
ttaaagaatttaattctgatctgcagctcaaaaaaaaaaaaa
aatttcttaaattaagactagacgtcgagttttttttttttt
base pairs
76 to 150
base pairs
826 to 867
Exercise II: Designing a Recombinant DNA Experiment
Now that you have created a restriction map of your piece of human DNA, you need to ligate the DNA
into a plasmid DNA vector that you can use to make your probe (molecular biologists often refer to this
procedure as subcloning). To do this you will need to determine which restriction enzymes would best be
suited for cutting both the plasmid and the human DNA.
Below is a plasmid DNA sequence. Copy this sequence into the text box in Webcutter and identify
cutting sites for the same enzymes you used in Exercise I. Then answer the following questions:
Plasmid DNA Sequence
TATAAATATAGAATAATGAATCATATAAAACATATCATTATTCATTTATTTACATTTAAAATTATTGTTTCAGTATCTTTAATTTATTATGTATATATAAAAATAACTTACAA
TTTTATTAATAAACAATATATGTTTATTAATTCATGTTTTGTAATTTATGGGATAGCGATTTTTTTTACTGTCTGTATTTTTCTTTTTTAATTATGTTTTAATTGTATTTTAT
TTTTATTATTGTTCTTTTTATAGTATTATTTTAAAACAAAATGTATTTTCTAAGAACTTATAATAATAATAAATATAAATTTTAATAAAAATTATATTTATCTTTTACAATAT
GAACATAAAGTACAACATTAATATATAGCTTTTAATATTTTTATTCCTAATCATGTAAATCTTAAATTTTTCTTTTTAAACATATGTTAAATATTTATTTCTCATTATATATA
AGAACATATTTATTAAATCTAGAATTCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCT
TGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTC
TCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCG
CCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAA
GGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTT
TCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATT
CCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCT
CAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAG
AGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCC
ATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCG
TTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGCCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAG
CTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAG
CGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGAT
CGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGA
AGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTG
CGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTAC
1. What is the total size of the plasmid DNA analyzed in Webcutter?
EcoRI
taagaacatatttattaaatctagaattctatagtgagtcgtattacaattcactggccgtcgttttacaacgtc
base pairs
attcttgtataaataatttagatcttaagatatcactcagcataatgttaagtgaccggcagcaaaatgttgcag
451 to 525
Table by Enzyme Name
Enzyme Name
No. Cuts
Positions of sites
Recognition
sequence
EcoRI
1
474
g/aattc
The following end nucleases were selected but did not cut this
sequence:
BamHI, PstI
2. Which enzyme(s) could be used in a recombinant DNA experiment to ligate the plasmid to the largest
DNA fragment from the human gene? Briefly explain your answer.
3. What size recombinant DNA molecule will be created by ligating these fragments?
4. Draw a simple diagram showing the cloned DNA inserted into the plasmid and indicate the
restriction–enzyme cutting site(s) used to create this recombinant plasmid.