Problem Set 11, Fall 2015
8 points total
Name:
1. In your analysis of a particular chromosomal region, you find that it is highly polymorphic
between different individuals in the population. As an example, shown below is a Southern blot
analysis of DNA from four individuals. The DNAs were digested with the HindIII endonuclease.
1
2
3
4
a. Briefly outline the general steps
involved in this analysis.
2.5 kb
2.1 kb
1.7 kb
0.8 kb
b. Draw out a map for this
chromosomal region from each individual. Please include the location of the HindIII
sites, and of the probe.
2. You wish to clone the nematode unc-79 gene, which you show is tightly linked to the mpk-1
gene, a gene that has already been cloned. Briefly explain how you would go about cloning the
unc-79 gene. What is the name given to the strategy that you will use?
3. Please describe how you would introduce a DraI restriction site into the following sequence:
TGCATTGCTCACTGTCAATTTCAATCGGATGCTACGCC
DraI restriction site is TTTAAA. Please be specific (i.e. give the sequence of the primer that you
would use).
1
Problem Set 11, Fall 2015
8 points total
Name:
4. You have recently cloned the fuzzy gene from the Arabadopsis plant.
a. Explain how you would determine where fuzzy is expressed. (Include your choice of
reporter, method of transformation, etc.).
b. Define a transgenic organism.
5. You are interested in studying the mysterious disease SW that causes obsession with Star
Wars movies/memorabilia. You decide to clone the gene in order to further study the gene
function (with hopes of winning a Nobel prize for you work). You purify the protein and raise a
highly specific antibody to protein SW.
a. Please describe how you would clone this gene.
b. Once you have cloned the gene you realize that, amazingly enough, it is conserved all
the way from yeast to humans. You happen to have a SW mutant yeast strain. You want
to test if the human gene is able to function in yeast. Please describe how you would do
this.
2
Problem Set 11, Fall 2015
8 points total
Name:
6. A virus that infects papayas, the papaya-crushing virus (pcv), has been discovered. It is
known that pcv can be prevented by over expression of the mutant form of protein S. How
would you produce papayas that resist pcv? You can assume papayas can be manipulated in the
same way as other plants, that the gene that encodes the wild-type protein S has been cloned, and
that you know the sequence of the wild-type and virus-resistant forms of the protein S gene.
7. You wish to study the red gene from a hypothetical fungus, T. bastinae. Mutations in this gene
cause the cells to accumulate a red substrate, changing colonies from their usual white color to
red. To study red further you decide to clone the gene. Assume that T. bastinae are readily
transformed with a fungal plasmid and that the mutation is recessive.
A. Describe how you would clone the red gene.
B. After cloning red, you determine it’s DNA sequence. The autoradiogram
shows the sequence of a small region of red. What is the sequence of this
region of red. Indicate 5’ and 3’ ends.
3
Problem Set 11, Fall 2015
8 points total
Name:
8. You are examining a species of rare slug. You decide to study the feature of eye color that in
a wild type for that trait is purple, but the trait is not true breeding. You have also found several
mutations in eye color. In performing test crosses you find that purple is dominant to all other
mutant phenotypes. You know that each of the mutant phenotypes is a result of a mutation on
the same gene.
a. You decide to analyze your wild types and mutants using Southern blot, Northern blot, and
Western blot, and obtain the following results. What are the 3 methods used for?
Southern Blot
wt1 wt2 mt1
mt2 mt3
mt4
Western Blot
wt1 wt2 mt1
mt2 mt3
mt4
Northern Blot
wt1 wt2 mt1
mt2 mt3
mt4
b. What is the genotype of wild type individuals
1 and 2?
c. What can you say about the molecular nature of
the mutations in mutant individuals 1-4?
d. Speculate about likely phenotypes for each of the mutants. Explain your rationale.
4
Problem Set 11, Fall 2015
8 points total
Name:
5