Problem Set 11, Fall 2015
8 points total
Name:
Student ID:
1. In your analysis of a particular chromosomal region, you find that it is highly polymorphic
between different individuals in the population. As an example, shown below is a Southern blot
analysis of DNA from four individuals. The DNAs were digested with the HindIII endonuclease.
1
2
3
4
2.5 kb
2.1 kb
a. Briefly outline the general steps
involved in this analysis.
Isolate genomic DNA, cut with
HindIII, separate DNAs by gel
electrophoresis, transfer to
membrane and hybridize.
1.7 kb
0.8 kb
1:
2:
3:
4:
b. Draw out a map for this chromosomal region from each individual. Please include the
location of the HindIII sites, and of the probe.
0.8
1.7
Several variations
2.5
on the scheme
shown at left are
possible.
0.8
1.7
2.5
2.5
2.3
probe
2. You wish to clone the nematode unc-79 gene, which you show is tightly linked to the mpk-1
gene, a gene that has already been cloned. Briefly explain how you would go about cloning the
unc-79 gene. What is the name given to the strategy that you will use?
You will use a positional cloning or chromosome walk to clone the gene. You will isolate
genomic DNA from nematodes, cut it with a restriction endonuclease, obtain plasmid and
cut with the same nuclease. Ligate genomic fragments to vector, transform bacteria and
select transformants. You will screen your library using mpk-1 DNA as the hybridization
probe. Study the clone you get, make a probe from the end and rescreen the library.
Repeat this until you find the clone that has unc-79. You must have some way of
recognizing the unc-79 gene.
1
Problem Set 11, Fall 2015
8 points total
Name:
Student ID:
3. Please describe how you would introduce a DraI restriction site into the following sequence:
TGCATTGCTCACTGTCAATTTCAATCGGATGCTACGCC
DraI restriction site is TTTAAA. Please be specific (i.e. give the sequence of the primer that you
would use).
CGTAGCATCCGATTTAAATTGACAGTGA
Could use this primer along with a second primer to the other strand of DNA in PCR to
produce mutation that creates a DraI site.
4. You have recently cloned the fuzzy gene from the Arabadopsis plant.
a. Explain how you would determine where fuzzy is expressed. (Include your choice of
reporter, method of transformation, etc.).
Fuse fuzzy including its regulatory sequences to a reporter gene like gfp. This could be
introduced into plants. Identify transgenic plants and determine where GFP is produced.
b. Define a transgenic organism.
An organism into which a foreign gene has been introduced.
5. You are interested in studying the mysterious disease SW that causes obsession with Star
Wars movies/memorabilia. You decide to clone the gene in order to further study the gene
function (with hopes of winning a Nobel prize for you work). You purify the protein and raise a
highly specific antibody to protein SW.
a. Please describe how you would clone this gene.
You would purify human mRNA, prepare cDNA, ligate DNAs that include some restriction
enzyme recognition sequence onto the ends of the DNAs, cut both the cDNAs and an
expression vector with the enzyme and ligate the DNAs together. The DNAs would be
transformed into bacterial host cells, grown on agar plates with an antibiotic (to select for
plasmid-containing cells), transferred to membrane, and cells lysed. Filters would be
incubated with primary antibody, followed by secondary and positive colonies detected,
perhaps by chromogenic enzyme activity coupled to the secondary antibody. The original
bacterial cells harboring the clone would be identified by finding the colony(ies) that
correspond to the antibody positive spots.
b. Once you have cloned the gene you realize that, amazingly enough, it is conserved all
the way from yeast to humans. You happen to have a SW mutant yeast strain. You want
to test if the human gene is able to function in yeast. Please describe how you would do
this.
Clone the human gene downstream of a yeast promoter in a yeast vector and transform
yeast mutant for SW. I would then ask whether the cells were rescued (i.e. phenotypically
wild type). If so, the human gene functionally substitutes for the yeast gene.
2
Problem Set 11, Fall 2015
8 points total
Name:
Student ID:
6. A virus that infects papayas, the papaya-crushing virus (pcv), has been discovered. It is
known that pcv can be prevented by over expression of the mutant form of protein S. How
would you produce papayas that resist pcv? You can assume papayas can be manipulated in the
same way as other plants, that the gene that encodes the wild-type protein S has been cloned, and
that you know the sequence of the wild-type and virus-resistant forms of the protein S gene.
Engineer a mutant form of S and place it down stream of a strong papaya promoter. Use
this construct to make transgenic papaya.
7. You wish to study the red gene from a hypothetical fungus, T. bastinae. Mutations in this gene
cause the cells to accumulate a red substrate, changing colonies from their usual white color to
red. To study red further you decide to clone the gene. Assume that T. bastinae are readily
transformed with a fungal plasmid and that the mutation is recessive.
A. Describe how you would clone the red gene.
Prepare a cDNA library from T. bastinae by isolating mRNA, generating cDNAs, ligating
linkers and cutting the cDNA and fungal plasmid with the same restriction endonuclease.
Then transform mutant T. athwalae with your library, plate the cells and look for colonies
that are now white. This is cloning by functional complementation.
B. After cloning red, you determine it’s DNA sequence. The autoradiogram
shows the sequence of a small region of red. What is the sequence of this
region of red. Indicate 5’ and 3’ ends.
5’-GATCGCTCAGCTCAA-3’
3
Problem Set 11, Fall 2015
8 points total
Name:
Student ID:
8. You are examining a species of rare slug. You decide to study the feature of eye color that in
a wild type for that trait is purple, but the trait is not true breeding. You have also found several
mutations in eye color. In performing test crosses you find that purple is dominant to all other
mutant phenotypes. You know that each of the mutant phenotypes is a result of a mutation on
the same gene.
a. You decide to analyze your wild types and mutants using Southern blot, Northern blot, and
Western blot, and obtain the following results. What are the 3 methods used for?
Used to examine
Southern Blot
the DNA
wt1 wt2 mt1 mt2 mt3 mt4
Western Blot Used to examine protein
wt1 wt2 mt1 mt2 mt3 mt4
Used to examine RNA
Northern Blot
wt1 wt2 mt1 mt2 mt3 mt4
b. What is the genotype of wild type individuals
1 and 2?
p+/p+
p+/p–
c. What can you say about the molecular nature of
the mutations in mutant individuals 1-4?
mt1: regulatory mutation (overexpresses protein)
mt2: normal RNA but smaller protein, perhaps
nonsense mutation
mt3: no RNA, perhaps regulatory mutation
mt4: shorter RNA and protein, maybe altered
splicing
d. Speculate about likely phenotypes for each of the mutants. Explain your rationale.
mt1: too much protein might produce darker color
mt2: either light purple or perhaps white
mt3: possibly white
mt4: either light purple or perhaps white
4