MATERIALS AND METEODS Followins eat nats wcrc ued in thb nudy BACTERTAL STMTN; AND PLASMIDS Ths A,.t/i6 slrliD a-myl6e d.ticic purpose ed for rhis sludy ircluded strain (14289), Erc, ,acitas rdrrlis 163 (tAl) ed a g€ne@u gin frem $e BGSC for only. Simildly, the Ecol, st.6ins w€r. obiained Aon rhe Raeh culnE cotletion al CEMB. VECTORS . pHB2ol Ghunle.xp6sion vftror) . pCR 2.I (TA clonins v4rot Obtaided from .ulturc @llecdon ar CEMB. ENZ}A'[S AND REAGENTS Ari chicrion .ndonrctees ad ihc T4-DNA tigase c@yhe, Eed in this sMy vec puchas.d frch tb. New Engldd Biolabs (NEB) Cambridsc, pobneEe wos obrained frcm the ne production lab ar CEMB. The Hindttl dieesled lubda DNA siardtds CEMB. All @genc chemicals !$d in .E we sle pFpaFd th€.ow The culrurc of by $e Eoz)me p,oduction of this sirdy wed fton Si8lla Bidhenicars, USA USA. Taq D\A pGped lion €srh uft al 8ftde or M€rck BiocheEicah, G€many. a,cr46 sp.cic R2 ured in 49 rhis study $.6 ierated fron t6.l PII METER fd A pH nerd of EEL (Mod.l 234) \l1!! ur.d thc ddqbinadd of PH i! tti! SEAKER A reta.y sh'L.r LAMIN of'rrb [E iE$do! 3h!tc/ w u!d. R AIR FT.OW CAEINET LmiM .irflow of'"rahnicho S.i.ntili. SuPplt rc khoe" us.d Cf,NTRIFUGE csEifue of "B@k'N" (Mo&l 12-21) B se4 SPBCTROPIIOTOMEIER sp€{rD ploroNt r of P.*i! EIF Uv/vtu 0rEbd! l0) E tlcd lhlughotd f,(X'D trUME A nlm bood of'T-b.i@ Sciatific SuPpl/'t L@. srARcH sl!fth 3olubb A@ Mftt ot log No l-01252.1000 w u$d a subGtale MNNG N-@t[yl-N{itcN-nitrco $&idifl (MNNC) bouelt &@ "si8Ea chdic.ls" DTALYSIS MEMBRANE Steta/Pd Mcnhae t of\petun Mdiql bd'lrtries I&" .[ow rbe tui6ul6 to !4s tNing nd.cdr stiSbl of6E KD4 50 m E d tdict MDTIIODS MICROORGANISM 'Ite ,a.ill6 sp€.i* for ftc plod@tio! of d@yla* babitat imhrding oI eil smplc $il, flou, w induti.l ed slashy, added lo a w iel.l.d qnte CAMB fiom diffe@l @llcction. O@ gu qtr. The elN iub. @ lining lod st€rili*d dhiill.d ! w.Li balh al 80'C for 15 minut s AfFr lhe oryletion of 15 oinu|s fte t61tut6 g4 innedialely @led in ic.sld waler,50d lesl tube of th€ M sh.kd ed pL.ed in splc w 1?.c for 48 pLt d our hom. on tbe Ntri.trl .g8r The €oloni€s foming st€5ked on the n xt plsles of rhe sme @c fotrDion. cle n.diu 'ftd lh* i$lat s {4 lorS-€d dnes The Nbd lo gd the d!!at.d **.ror.d al4'C. Cly@l st@&s veE de 20Pc for nediu. on lhe pEparcd pldd wd i.cubdqt dEn {@ picked up pw cultw tid sletj of at ed io contrm LB age Eedim in 15% glycDl dd &d LePt at - stoage, CIIARACIERIZATION OT BACIERIA MorpholoSrcal @rding b thc n dd lhods physioloeical deqib.d popcdi4 ofrsctrldlp R2 w.F in Bcr8.]\ Maual of svn ddic B&ldiologv 1986'. NUTRIENT AGAR MEDITJM (t'TI-6,9) S.No. I 2 1.5 3 3.0 2_0 5 18 5l investi8ated GRAM SIAIMNG A d$p ofdisliucd erlrd lctcd tom wid rh€ ft$h.ulie on lhe slide M pb..d on. cl@ \,4 @d drv gla slid.- B4tdir ld.led d ftc m air dried sd hdt sd fd l-2 nidrB' ix.d an &i.d and ok€ned positirc bod.na v@ viola i! udo of droF rdl wta' l-2 $lmion for I-2 minutes Agrin whcd {ith fl@ded with *6 3_4 v8b€d eith mLr 'odine wer added on thc sm€d, washed with wder of safteine soludon drcp! Th. slid. v4 wilh rhe h.lp of si.rili4d l@p ald nix€d in thc dtlP of gotly to fon s sne& ll .rys1d violer $lution thcn it u the micosope in tier I -2 midute oil ilm€Eion G@- @loE, *hjlc Srd_reeatiw blctqi. w pinfirh td in SPORUI"ATTON sporularioq E ttqlcd on rhe pelri plat6 of T-3 dcdiu fd plal6 l|@ incub6r.d at 3/C for 72 ho6 A dDp of disiilled Mrd s pla.ed on a clu ed dry gla$ slirlei vdy shall sired @lonv lloh T'3 plale M TIE bocte.ial cdt@ wirh tlE help of st riliucd loop &d rha nixcd qilb mler pl&.d or lhe slide &icd rrd har fix€d. Fl@dcd th€ slid. *ith "Md&hite etdn" elurion md renained on the *.td utrl Fu.h5in hs b.d all stee Renoved thc fiher papa slriPs sd tb. slidc f ERMENTATTON TECHNIQT'F-S INOCULUM DEVELOPMEM 20 ninul6 flooded with "Cdbol ud.i la! wtd u6l $5shed our. Air dled the stidc .nd obs€Ned llwaair washed $e slid's wiilt gen coloq hB ben wh.d oul- ILen it @ . Aftq om ninurc, Mhed fd pjck'd urdd th. thc entiE r'd @loE nicmsF in !d oil 25 in bl ofm.diu M-l mntaining in 250 nl m.!tocl . f@ |5 nirutcs at lslbs p6@- inoculsled wilh s conical It B flsk, *a sldilized al l2l'c @lcd lo @m t mpenftE ed lmp tull of the mioodgdiln fiom a frcsh sl&1. The fls*s l^@ incub.ted ar 37'C for l8 hoB and agihted at 250Am n' & incubslor shlls. FERMENTATION 2% (v/O of l8 ho$ old veseralire in@ulM ofbaclod culnE vs tdsfen d in 50ml of fmenialion medi@ (M-9) co lin€d in 250n1 flstl. nF flats w€t€ ho6 dd !8it t\d at 250rpm in s condoll€d flvircm.n incubated !t l?'C incubdto. sh,kq. Aner 48 hos of ircubaioq @ncnrs ofln€ fl6kl w€E dEituScd ar 8000rpn for 15 for 48 oiNtcs, The $pdatot w u$d for th€ q@litalive ad qlatitaiive ANAIYS$ QUALITATIVE In qualilative ealysis, wlls werc nsde qith the p.ui plar6@ aining nurridi aeo nedim. l00d wll tlacr uddq sreriliz.d condilios. *ft roud cnd oflhe glss Pip.tie oftbe sup.nata.t E incub6ted at 37'C for 24 jt poNd in th€ ho6. ZoDc dimctcs ir th€ plat s w@ nesu€d. Fomaiion ofzone doud tlE well showd ilE QUANTTT.ATIVE 3, 5 DINITRO SALICYLIC ACID PREPARAIION An altalin€ $lution of followine relhod. A soluiion of 32 20 gtas l, 5 dinitrc salicylic gr@ of DNs of Nlolt w cid (DNS), M pEpaed by ilt sNFnded in atpoxi@t ly 400m1 in 300n1 of wter 5l w added drop oa q.ls. wiF uder efficicnl siring. h *6 Cdtly hdlcd on a Po&ssim sodi@ lartml€ (600sn, added 10 @e si mste rhe 6nal qr.. *s barh @dl idd.d h volM. of 21. Th. DNs qld glas od s:Lrd d ! .ld slution w obtain d. w snall Ponioa md lh.n $a1er solution wu filtercd threud en anFolw in rhc dt*. It m $.bL fd a ldge at l4n ENZYME ASSAY Eizyhc agys fo. &d the rcle.sed ceyle ** P..fom.d uin8 eluble sr!rch redlcing sugd *€r€ 6iiDaled by dinil,! a salicvlic &id (DNS) slbstrale esdr AMYINSE ACTIITTY Amyle &tivity (196i) 6 uder. w d.tcmjned la.oiding to the nclhod of Fisha, drd Stein' Enzyme lolution ircuborat !r 3?'C for S 3, 5 dinitrc salicylic lnl ws mirur6- Ile @lio! rcid. Colou de stl,led 10 *s lDl of l% @ dd.loFd bv h€alirg th. E&tart iD boiling Mter bath for 5 miNt€s, lhcn npidlv ooled cbFd@. Pdtin Elmq Th. qlirrrioo valE wvis w dd teminrLd bv the additior of 2Dl of Edwiog sugs libcnied 1o silrch solurion lhd to md i.r dctcmined at 550m bv sPocnoPlDtoE (Lmbds l0). ANfYLASE UNIT On myl* uil libddr6 td*irg suga €quiv.t. lo l.0nc hdtos hvdnle uder @ndition of$sys. MALTOSE STANDARD CURVE Thc diffddt m @ stand.rd cwe B concenteadoB of rullose !!6orbe. pFpaEd silg n.llos 0 i3.0 w.e pFpd€d in ng/ntl. Th'F a Na-K phosphai. bufid ofsbovc dnutios 9@ mesur.d at 550nm sinS tboE bufld a 54 I1l€ ! bldL PROIEIN CONCTNIERATION Pbt io @llmraldon ws detemiD.d by uinS 'Bdtlfo.d n lhod', 2pl of lh. protein spl. nix€d with 2O0Fl dye in ?98 Fl of PBs (lX), 20081dt! in E00Fl PBs CULIIJRE MEDIA dill.dt nedi. fodulatiod sd In it@ ShaL 0asl, nine @yls. t@'16.Fci€ R2 prld@iion by llt cmF$ton of r[* u€d for d- m.dit in Fqt MEDIA INGREDIENTS MN -t;;;-lv" Y@t Exiieci 0.5"/" 4d Nscl0 5vo (LB-nediu) M-2 Peptorc 0.6% C&*in Hydmlyzi. 0.4vo B€ef Exlr&l Ycrst ErdB.l 0.3Y. ald $eh M-3 bM lwldt 0.05% | I M-4 2% cacl, o.o2% Kcl bru t s"" o te* *ct 0 lsolo o'ItL),H?oa 2 5% and 0 5vc 198') sovbcm t'leal 0 I I 0 2Yo Sovb€ Merl l 5% C@ sllich 2% Mssoi tsto$. (G!Ww,.r sl, | nice 0.15% o.tr",t -a toi {NtLhHPoa o 74% ' a( l: [4cso,0 05"4 (DimibBli. dd Dotena. | ,,,,, M-5 I Tryptone I M.o Mol'* I lsorb* 0.08"/" M_? 05% Slcroe 0l% D.xrin 05% CSL 4% md 3",6 (Hdilq.t al. delt 1.5% l9E4) tue b@ 35"4 \r'hed btu 2% Mssol cucl, o.le" 0d KH,Po. o r"; | lst.Fh t% CuCb O,OOrn6 lvtsso. 0.05./0 55 tm.Nor 0.t6% rtrd I C@i! 0 2% I M-8 CSL M.9 4olo I Stash I (vatrubi, ct Sllth % 2ol0 CgCI2 195) '1-, 0.2% KHTPO4 0 l % ed Nacl 0 04% Ye{$ E*atd 0 loz P.flore 0.2% ISOLAIION AND PT'RIIICATION OT THE CRUDE ENZYME ft. 10 fm.ntcd btolh wG cmlritueed.t 80oo rpm for 15 s move ells. Th. crde .Eyne satuntion) M 4d.lloNed to ddtueed .r E{bslved in agliin se oinut 24 s ar nirut s 414'C !olu. a minimm aMonih in od'r stphatc (Ee,4 ov€Fddi at 4'C with constet slidng nE nixtuE 8ooorpm fm 20 b!fid for 800orpm for 20 stand F*ipitaled widt ninoca.t 4'c ho$ of lo nM a! 4'c- The *w pdipirrrd Phosph.le Th. tlialvzcd @lle€d od bulla {!H6 9) and disl}z'd nixtw *6 4'C ed the supemalmt ws colle.ted fo. mtdnr8cd at fltho puilicatio!' PERCENTACE OF GAMYLASE PRODUCED AS INIIIaCELLUi-{R AND EXTRACELLULA&BY,,{CItr US.IP. 10449 loonl of fcd€ntation nedid (M-9) wa ircculated v.g.brive imculm lrd 250 (2oZ rpn. Aff4 48 ninul6- Tle suF@&nl v/v) of8d.id,s sP ssay€d for rrslEd rbe tin6 wirn lonl of resusp€nd€d in 4 nl 2mgld. rd.ubltqd 18 R2ina250hlndk- ltuublted hoc, cdtN n diM ts {ith w c.nEitueed .l a'@vle (exlt@llule) Na_K Phospb.t brlld (!H 6 7000 old tnis at 37qC ryh fot The @ll 9) ho$ 15 Fllei wa Ihe pelld B of abov€ buffe. Lysozyne ws 5dd.d with Iinal @ndleraiior of this at l?.c for 3Dinols h g.v. 56 rhc appa|2@ of8'Larin lla6 subjeted lo enication eith micotip for 20 tj. with int t.mFBtuc, w I niNl€. dal of Ai* s. tbe sdc p!@s dE tib6 ws ple.d or ie Th€ slution soricslio4 the g€lalb EFli.d !pp.ti@ to @.ltol th. high of lhe $lution wN diePpdred. @tlitug.d, the @tl debds \re *nled doM &d th. suFmr.nt w etad It for tr- POLYACRYI IMIDE GEL ELEC'TROPIIORESIS SDS polt?crybDde gel 12% w€ls Mlving wE sd smpls of ihc and 5% sla.ling 8.1 of vlshed wilh i! lx sptc @frit .tdtophoGis 1.5m bufld, T}!. spLt *6 h ! niri Pdfomed thich* Er u.d of crude loaded 6 it the g€l 3lop9€d botiom. Th. gel w6 ltd a voliaSe of 8OV And polvn dztiotr oz}de sd BSA bufl4 with ber shoct in boiling H,O fm 5 ditrut wD kepr g€l aPpalatu s wt Abo* consllnl diselved 30 d of th. The aPplicrtion *ncn lhe trekl.8 dve @h.d ro aboul V4 irch ton rhe cooMi€ s Ell s 3ilv.r slained io delt t the prct€in bdds SILI'ER STATNING silvd slainins w @fud fix.d b iin€s. ! out rccodins b fixing $lution for 3H0 minut6. lt Thcn it qs *6 Ili. sel w6 Mshed with dislillad wter l*o Bl@D, d al ' (1987) lr€ated with 0.02% NarSrO3 solulion for 2-5 minu16 shalilg. An6 sL,hinS Arin wilh distil.d wtd, it B sled *ilh in 0 lv"AeNOr Sentlc eluli@' Aier lo-20 ninut4, thc silvcr niidte solutior ws Emoved foltowed bv wahi,8 sittl di$ild wt r, Aesh &vcloping slulion wad€qul.. Mditiod of 5nl of 2 3M s c'tic added agi|.Ld slovly atil acid slopped the @clion. 57 b.Dd irteNity CEEMICAL MUTACENESIS l8 hous old vegelativ. i!@ulm of ra.l/16 5tu1 of nediu LB mt ircd in a culiw tub.. Ir E&hed to about L?- l.8 i... I x 2 ho6 i! Esp&tively) gently M suFnendl vs E disc&ded. Cclls wft wirh re&n nl. TIF neairn€nt s i! OD !t 600 i.e. with 000rPb w 5fu1 of MNNG (N_ q<l incubatcd fo! I hor .nd fd esNpended in I label.d for find conentqltion 375P8/nl. l0 lhl nh to Fltd dE ells. 2 The of the mcdium LB As6ir dom sinilu Flced@ wE dorc eith 2 siven in tum€ lDod .lMinjM foil. nE dpqid@t e.h) two wrc @h reaitndl t@ th. siet shon inteNais d@ al ld cdtiftealion foUowcd by esLtFsion hous .dd.d wra) sh*oi ata how.t l?'c. ccoritugni@ uril th. $d oib6 two for @!irol, {?.5mg/ml E6hly pep6red in disiilled vd. lraisf.ded (l%v/v) in incuhdql 6 epFDdods (1Dl in n.thyl-N-nitrGN-nitroe guddiE) The cppodo.fs w m 1o"cft/nl. AboE @lk R@ lako rrst'not (l & sr'. R2 ed etpendorf! w€E ondwr€d in dr(l dE ro th€ mpp.d lidt @iriviiv of MNNG. CELL SURVIVAL cqlls of Bacils sp. R2 at a l75t€/nl dos of MNNG foi I & 2 d.sity of lrlor cMnl how The cell suspdso. *w ch,llengcd wil! w! dihied uplo lo' rin6. 50dof ehdilution*6pla&donlh.nuEidlage+sttrchplal6. Ealdilution @ sprad on th@ plates, Plates apFd.d w 6d trssl4,Ed *et @uled for cell swivallo th€ incubtl€d at M ors nutiol m.dim sbtis 58 l7'C for 24 hoN. foming cl4 6rc3 wE Colonies pickcd up SCREENING OF MTIIANTS Elq.n mulanb vw s wcE slrencd qudit rively 9. The tine of incubaliotr el€ded non well M 6 q@rit tivcly. Ihc cultft mediM ho6 48 hoB lqtrnol of MNNG 2 qt Th* mut3nb w again M_ 3?'C. ENZYME PURIflCATION USING GEL FILIERAIION Eutme puificalon wN do@ ar . t supedatal of ih. qntw thli peipiat d at di$hd in ! brolh 80% wd treatcd w amoniu h s6tll volMe of lobM bufld phoslhale s€ buffd S.ph!d* bufrd. 'IlE 6tlm ws c(i1mlenr€d wiih lo ws t.Da washed S€phadex buf€r. PHT o€ |hc ficn applied to a a Gcphldq) M b@ eqlilibedlcd sith lonM *ith $e .quilibFiion bufcr' md crule The *6 collm .quilihdtid bufiq, dd prciN 9w elurcd ir l50d in't bad bd.quilibd'd combincd and ulm6lterEtion tbe fom of turile tetions pml.d oln in fiv. diffemt p.als Bilg qtri@n 30 ed chet d wilh idtially wlshed with l00nl of dt' a. a flow of25nlh'. FtutioN ofl2.5hv30nin w@ collected in.eh lub.- Ih. etive m. pbi'i! filts h n dim dlE filt 6tion cell Th. @rederd' pur or a @lu@ or selhldex (G-?5-l2o), of lomM siLlPhde, drd the &z.tion Thc retotale of s.ph.da{ (c'?5-l2o {l0tDa{0tDal) rh't hld @llm The .entritugrl salslioq ws coll*ted Th. praiPilatcs fom.d w.e couse of 16 hous againsl 50 vol ofthe s oFmtd b.bw aqc. ud nr' tactroro cotcflteEted o. sDs PAGE aner dzJmc bv .sv- USING ION EXCEANGE RESIN To c@fim ihe .tDvc puifieriol! crude enzto€ r.npdatr below 4oc. The enlii€d *6 puili.d ag.in at supcdaitnt of rh. cutr@ bmlh 59 w a har'd {iih smoniM s'nphale, &d Th. Frcipitat* fom€d pH ?,5 or pl 1's, dd 50 vol of lhe sme lhe the r* t&tid dislv.d in. 3D![ volM. of l00bM $lltion (carion-qcbdg.O ih.t ?-6. Thc @llm ws ellule pH?.6 firr coll€cl€d Pboslblr. buffs dialy4d twie over rh. @uM of 16 Loc .g!i!sl equilitdted with l00ntv1 P-l I buffs or pH tcn llc eqoilibtslion bufrd, .ttd the mn-adsorbcd had b€n.qfibEt lind efdidt o3756vnir FE rios of flirc dtzfilteFtioo (atrtriconJo; 30,000 cutoffi Ani@4 M loa.Ld. The co.ccntol. ws initially wh€d sith 9008r *ith 350E had eEsh.d wilh crude potein, con@ntaied by Mdt @ M w bufiei. The etentd. ws! th€n applied to 5 .ollm ot phosphate eIdG Dmvds, th.t Pt€ciPiHed at 80% sturation, d put o a with l00nl\4 P-l I butrd pE?-6 Thc @lum or rhe .quilibnlion buffd, of o to lM KCI in fie 5.6Du15bin @lum of ?-l I photphde_ tr4 ed tr. @[61!d th€ poteia wF cluted buffet, at a flow ratc tilF lhe st tt of of the glddic.t. .sv ald @rcnlcdl.d bv ulbaliltdd,on or a eniricor 30. Tlc concoteote *s dialv*d ovmigltl egdmt loonM P-ll (!ll ?.6), ft. EsdtinS Et dsre rc !$d.tclsiY€lv for irrhd qFitu ssdE frEl pEplratiotrofth. FFfi€d e.ztre Th. &tive fractiotr lN@ @obined an t @zlde ENZYME ASSAY d-Amyle etivity @noined ls w a1 3?"C in 6 2ntl Eelion nixnw rhal of a l.oq. (*r/wl) $luti6 of eluble sr,rch (fron lot to; M.ak) in 0.02M pho+hal€ buff.r pH6.9 rcd@ing rcutiftly measwd swd fomed ed lml rc n6u€d of a suilallv dilut d sldion by th. dinidosalicvlicacid SLiI! l96l; Mitlq, 1959). Ot€ @il of lh. GDzyme 60 a.livily a ofdrrm. Th€ pocedw (Fishei' ed dclined a rh. Doul of pbtein ilEt prcd@d tmg of Ed@i4 sugd s naltxe in 3 ninut r undct th. @ndinom ELECTROPHORETIC ANALYSIS OR ZYMOGRAPEY sodiM dodayl sulphate'Polyarylmide gel daLophocis (SDS-PAGD done senrillly &rylmide, ?O as dceribed by Lmli, (1970), by 5Om, l-5nn thiclnBt, i. ed wples w@ Fplica plat for . @yl&se aciviry tun rcnF.atre' sls een $ cl6 M Moleuls @3 low-@s€ nolFuls (9?.4kDa), lelm trlsb bhibitd mvle b Thc sLb 8el offq SDS-PAGE wd lad or rh€ svenl hous.t slab g€ls eplio The b&d of prctein that il wirh wd doG sh.d wd ed leri ovd ss@iated with d&r blue backgrcud on th. Eplie sh4t @ne on a Elimsted by SDS'PAGE IlA sbincd fo. prot with a€rr shel @trt inin! starch (sigm) Mda[y s desdib.d by Hrladad al., t95, 6 fom of slab e€h (10% [s/vol] rhe Col)ltNi. brilli4t blw R-250. Acriviry sllining of M (loeldv/loll ervldide 8'l) witb stard4& (BicRad), shich iiclud€d Phosphoryle b albumin (66.2kDa), ovslbMin (45kDa). carbonic envdrae (31tDa), (21 .skDa). and Ly$zym€ (l4 4kD.) EXTNACIION OF CENOMIC DNA FROM BACTERIA Tord gmmic DNA sltai!, 6i.g th. mcthod M (c az.,il6 colo.y spp.ndix). Allowed c.lb to sre* O.Do @hcd O-8. Thc eU! wE pelLt rc sh.d with r!r,,lir 158 (BGsc .lesibed by KJomt.d, d al. 1983; Sdito, ed Miua ovemisbr cultu€ frcm a sinel€ D€dim isold.d from thc ,acttl6 hd.n mh $luti@ d !t @ !t dilnLd (lrl00) 37'C in ?,000 ii & in ub.ror 6l 1963 50nl of LB shaka +m tur l0 bit\ d 4'C floo'nM N.cl, lonr{ TneHcl (!H lAl) 7 9), util @d the 100ftM EDTAI ard Buspend.d i! EsusFDr'on solulion I forl bour. To this odded 6,25 ootnMT.isHCl(!H7.9), 2%sDsl ro bRlk 60FC til n ba,m cl@, rho ir w nl of !4w$ l,ts *s @tully (2411) aspiFted otn .bslule ethdol. Ana aitiryine, il oncdt€niion w PREPARATION $tim.Ld visually A of 025b8/nl dd duact d nixtw, sd one timc in €q!.ll volme Mov€ th. tr@s of to piPp€t€d with 2,5 tim€s th. ieub6Ld.1 tm rin s with cqutll volw. of w €sPddd agoiost M Phenol. Th. rclme of ie'@ld Lw 2nl ofHro (DNA* fre, 'n 0.8% asarce gel tshds/titd/ dd its r.l 3i.nd.rds OI PLASMID DNA Pl6mid DNA 1979). (!tl dou celk. Th. spcNion &d altoclaved). TIE DNA *&s ch4ked on ! E.C TrisHCl lonlt Lysis sluiion [loomMNdcl, ph.rcvchlNfondleuyhl@hol (25:24:l) mixtw, od sith Chlomfomn$mylolcohol NaCl, ! ftal oc.nrcdiio! 7,9), loobl,t EDTAI. Addcd Ly$zync io incubaled at 37"C 050nll *6 prpaed by sinsle bacteiiat @lony $. sltalift lysis method (Binboin dd Dolv, w6 uFd io inocul.t€ 5ml ot LB nediw Gee dpp.tdix), onhining th. appopnate elibiotic 4d ercm al 37'C wilh vig@u shddng fd 12-16 ho6 (ovmisbt)- shined nicrccdcituse $bc (.pFndorD l.5nl of the d.didl culrw inro ! l sht ed c€itiitus.d D@eled the supemrant md rcsupod.d the at 14,000 rpm (l4K) for I nitut Fll.t in 200d of ie{old. .ell dusFBion elulion (z5nMTrisHcl{pH8.0}, IoDMEDTA), incubdql for 5dhut on i@.nd tho added 2o0rrl Mixed rhe conte s cld e!.nl ofAB . y pEp€r€d ceU ttsis elurion times by inv€ning fie tub€ g6dy, (l lotil s vosDs, o2MN.CU the solulioh b.cmc .nd ad.led 20qrl of ie{old N.utdizriod $luiion (1.32M PolrsiM A@Lt {pH4.8}. Mix€d by ev.td iNdioN dd incuborql @ 62 i€ for l0 oilut6 The ssp.Dion rc sup.tuiant orce, wirh cqurll on@ wirh 6 CblorcforE minures, follow€d by Hhdol vol@ 2.5 lim6 minut€s (4'!C), Exl@r.d lle clcu of ph@vchlotufom^stmylal@hol nixnlE edyld@hd rbd p@ipira&d wirn with 70% fo. l5 harested at 14,000 rpn to movc rdu. c{nifuatio..t and aA.t aiFd.ying, of 14,000 ph@ol iaold rffi. dd T[e cl@ a4@a phts sbellde e0ts@l ar - 20pC rpn for l5 minu16. nE p€ll€l for 15 va rinsd ws sspended in 25Fl of nEle@ Ii.e w.tq. JIT'I'IIS TRANSFIORMAI'ION OF COMPETENT CELI-S '4CIZIUS COMPEIENT CELL FORM AT \ON \'A CILL US) Cotup€l.nt elh of r.rrrt{ir wF Hom(1990). 2nrof spiI c'nnE w *irh 200rpn sbabng The follooiig Spil !d @nrinued a dsnb€d miDuc supmaiali moming rhc culnE phe (i..; m lignifiMt cultN (1& ) w nix.d &d enriituged .t @ ed Vand.r i!@ulsLd ov€nisltAm at$h@lonyar l?'C at 9a diluted eith l8r iish eved ed (80009) or 7K ihe FnaioioS change i! @ll de@ly ovd 2G lhs ir.8. witb l80rl of pr4m€d Spill dd continEd incubalior at 3?oC for addiriord 90 minut l0 by Cutling iMhodon !l l7'C with vi8oreB shaking (180r!m)- whorbc 6r. of eU Smvrh l@hed s&rio.rry 30 min), th€ pEpdFd - The .ulte G for 15 minulA lt wa cNtully de@led. kepr on icc for 0-4 "C. l6nl of The cell pellel was 86tly EsFnded in 16n of th. sv.d suFmatar with arldition of 2trrl of stdile abelute ely@l or 4ml of $dile 50% sly@bl. Aliqrcb of @mpetdt *w tansfm.d 1.0 drl) irro srqilc tub.s, liead opidly al-80pc- NOTE: Ia l8 ml suptur fiq 2 mlof(abaolur.) 8lyerel 6l ells (0.2,0.J & in liquid niirog@ and stor€d . Tubc! tutor ad cpFndorfs lNd k.pt cold udq rleril. @ndiio$ d l€a.r fq e TRANSFORMATION ft€ omFtenl cells w€rs thaw.d r.pidly by inmding frcrcn tub.s in s 37'C water balh. 200p1 of Spilll was added io 200!l thawd celb, mned genily wilh 10td DNA elution (0.5-5pg) md thc for I hou nixtm m wiLh shaldns mixie w incubet d al 30oC for 90 ninutes or l1"C (l50am) in a $raiory incubalor shak€r. Ibe tlsfomaiioo plal€d or LB 5g& plat e wiih el.dive &libiolics, TRANSEORMAT]ON OF PLASMID DNA INTO ACOT' COMPETENT CILL FORM TION (E.ori) e.ot onpelan alh \r@ pr.p.Fd Hdrld, 198q @lony in 2L 1983)- 2 of,'coli. flak 2 nl of u nl ofllis sd for abour 3 wirh the C!Cl, hethod owniSht LB c!lt@ culnG hoE erd 30 s \'@ ituulst O.Dm |@hed at 0,,1-4.5. The cultw wa! k enrritugrtiotr dt 4000rpn for l0 niru|s d in l?.c, 200rph at F 04'C at *a in on icc for in a (Subek, in@ul.led liob a et al., iq! 200d oft6h LB culrN r gtFtory l0 shakd unil fie minules md peue!.d by JA'l4 rctor od tub6 (pfc@l.d) w@ lruh€d twice by Esspoding ed rccotrifugation with 20ml ie<old o.lM CaCl, solulioq 50% dd g.nlly @ susp.nded in cly@Dl. 100!l of @h pFchill€d nictutuge lubes. 4nl ic{old suspcnsion of 0. lM Caclr, l.5Toglyccol i.er ] 2nl of conpetot cells w6 i.mfomed to a sterile Th€ comp.r.nr @lls wer. stor€d dirccdy at -80'C. TRANSFORMAIION Ior trsrsfolmtio4 plMid DNA ircuhsted on ie for 30 nh.!d b han shek mixcd wi|h l00pl @mpetfrt sa givo tt a2"C in a Mre. ells and ba0! for 9{) 5@n&, ed or ie for I minut . aoq{ of LB Fcdim '6 &ld.d sd imublr€d !r 3?'C Itr.rory incubotor shal.r for 30-60 Din e5, l5qrl oftelfonaiion mixtr 9E pbtcd onto d agd LB pl.t with ad (Mrtin appDpriat stibioiics i.e; lui!-B.rt ri 37C for ore d.y on strrch d (LB) .gd plates tdfod€d ells w@ crcM.t $pPlclMt d with l9n(qi/toD (25|re/ml). AMPLITTCAITON AND ST,QUENCING OF DNA fd lh. mpli8c.tion of lp!reFiol€ Egios bctw@ speifc sitd h thc gelomic DNA 'nE F* ""qld6 shon oligorelotid€ equmes wE d€siened CCCAACCnCCGITCACTCITCAACTTOTTT1CAl. Hf?o, t- pi'net HRPO 5T sEQr, tr CCCAACCIICCGCATCCT"ICCAGCCTATOTT'TC.]', TGATTTGTATTCACTCTGCCiAC-I', SEQ2, 5ITCCCTCrCATTTTTATT(CTG3 sEQl. SEQ4, 5'-CACGCGGTCATCAATCATAC.S" . 5L TAGTGCCTCCACAOATGCTCI', SEQ5, 5ICCCCCAOTGCT'ITATTTCAA.]'' CCTCCCTTTGATTACCTCCT-I'. 11 om@ially (lDT). PCR PTC200, 100), with each Aa.il6 er,t/,s m pind y wE I DNA svnihsid lheffil cvcLr (ABI, 2700' pEporcd p€.fom.d with a DNA on (l0pmolctFl), plus cBnomic DNA (50l00ns), fton 168, (95qc for smin, cycl6 dd zqc tor 94'c loi I oin, 55'C for lmin, lonir). Ile @don mirE ph6phai6, 25nM MgCl:, 2.5 uirs of Tlq prcduction Lab) sEQ7, 5'-GACAGGCGTTTAACGATCjCA-3', SEQ6, dd lx Td$HClbufr{ 2nin fot 15 ontained 200FM d€oxv'nEl@lid. Ei polynew (CAMB, Rcstliction (!H8.8) in 65 ?2qC for a r&tior !olM. wFe of 20d- Prcd@is wG Frif.d witl r of PCR f.. cldios .rd 0n sl., (1986), by BioS pcrfotutd ly w crti! ldtir.tio! tlF didcoxy 3lr.nd of lh. DNA of Aa.i?(t 3.$dcd !n r TA cloiDs dd !trdr5tu B ut d EFttbd ofsnih,a fluot!$4t t@iDto6 .!d e.doolncd DNA !.qu.nc.i (Mod.l ll00i ABI, PRISM). Sir'8L B lhtu .u!-cloning. B S.qwi.8 Frdfc.li@ tit (QIAOEN), lDd PCR Foduct r! &nc uirg Gxl6siotr onlit|c ChEE$ d rctl& ddyL$ @lt LB+Sl!rc! pbl!, !!d gpn coinF a pre8ru. NUCLEOTIDE SEQUENCE TIF uEl6ti& lcqueacc &L, rbocld 98% bo@losy witl @yhe so., ! lorch i.gnding qE B. (EC &c/lB n,lli6 3r.l.l). PNEPARATTON OF DIALYSIS TTJEIIIC ltc B rubins cul i Dirurg ir I lasc volue of ritr!.d lbo$ur y in B.for! pies 2% e, hrodlc ds fubilg wirb io cooHidl l@gll (lc2ocdr. Boil.d for l0 A8sin boilils @l .d rb. rubiDs slo6. of $dim bic.ftondc dd dinil.d HO. lbM EDTA, Allored sbD6d. o N (s@btlolq cr al EDTA. Ttt n$ing M dolc for l0 minulB i! 0.001M 3rd!d rr 4"C. B. w ruu l! 3w th.l th. i$id. .rd o|' *itb @ld tubin8 d it alsf! D.tllo. Alsry3 l5a9) PROTEIN TRAIISAI,oTTING PnDPaRATION OF P'OLWTNYLIDEIIE TLUORIDE (r1'Iln MEMBnANE (0lrr) a im.n d in 10094 tutuel for . fcw rccood4 undl tlc eott t!@b.o. *.! ltlldEot I! EcO4l, it wts iEEcdi.t ly. Wcn d lmbtu E r.Bft.Ed !o . t!*l co rininS Etaf6 b!fia d M6bnF w clr of d!.t iiz. of gcl. Ii 6 water' Incubat d in Towbin butr€r s mdbtuc @ It bd Mt 6ily it is .quilib6ted ('2-3 minut€d rhe membme bulfr uril flosting on th. surface of thc equilibrar.d it @uld tE h6 ulil completely €quilibdt $bturged irro lbe dy to bind pbEins in sy aqEu eltiion d. va Affer it t!. Al this loitt, blonine appl'@riot And th. n@bEE $ill fom wheE th€ d w'th bufer, do nor allow it b dry (while spols ment{ae is dry). Potein will not bind to th. dtied ndbrd€ ed dry spols qill nol Fset in .q@ut el!|ion, TR NSBT,OTIING I}. fotlo*ing prcto@l *s for use with a for holt prci.iu, ue a trmbl4 prcto.ol i! stDutd be thc d@ .nd rcBhuc Towbin bufter with neth&ol tF weding of si.kl6. eslern bloting lsfd 6@bre s6tior Mr]. @ mehbrde for the tin6 (5 I hoE rnd z@ lO m n nbm€ slain. lrd lhft rct1age no1 wt .- (M.OH). P\IDF Shinine D.slsining folo*itrg lLe should be no bubbld also soaked in Towbin shi dry buffa 4 tdsf€r etl w imb'4 B donc for wd for l0l5 rinscd t niru&s wilL ninutes, or uiil ba.kgrewd is light blE, with PVDF dcsbin solurion Avoid eetc acid in the ttain d€s&i., 6 it might clN in boF the t lvolts for Pdein oinut6- An r tEsfq, ninut s @h) wilh distill.d PVDF CBB R-250 surE md bloni!8 pdp€ts on @ *l- CuMl B Ttffi- s wl Meobl@ b€tq@ lhe nembtr6e ud the gel. Blotijng pdpq wlDle sysreD i.e; eel the lslk blol appostB !@h d &d blctrge ofthc anino teEinB Pl&.d th. air&ied blot in 67 MhbIffi slFlld b€ dry in air .nd ndb@e iGtocli@ baNal bloftad Cat0, &s1aining (PVDF (BIO-RAD), C.1 4 152{184 d r polyvilylid@ diAldid. mmbtue liicl had IE Pnkin *qFrcing spl. B enzvn (Poerb; P.rkin-Elm6, Foslr citv. ben Ell€n wih nedlml. The diFt miEl s€q@@ of tltc potcin wc mr y€. detemjned. ROTOFOR Isoel4tric points of diflernt pot iN weF foud with the help of Rotofor sF1eh (BIO-RAD) lollowing lhe Rolofor R eystcm lnslruclion IMud according lo dE lab SAMPI,E TRDPARATION Sdpl6 9ft ilesalt€d by dialFis. In lh. crud. smpl€ 02% ls-Octyl ptEdy poly (oxtrthyltr) elleot oCEPAL}0.1% Ch4s 13- (3-Cholamidotopyl) din lhylamonioll-Prcpmesulfonic Acid (i,ci no! elubility or the feus€d pm&i6)), shM DTT (1 io.i. detqgdt ,+Dilhaofieitol ), 0 l% cly€ine od Anpholin€ (b naintain the solubility ofth. @plc ed prcvid. bufqirg). SETTING TJT maintain rh. l* dd.d FOR A ROIOTOR RUN Anode md €thode ele.tolt'le chMb.s were fitst Ndbl€d. Prior b 6edbly, th. ion€xchang€ m€nblffi w€e equilibdt d ov@ighl in th. apptopriate ele.trollt slulion i,e; in o.lM NaOH &d o,lMItrPO3 for eion ard @tio! 4ch,4p m.mbtu6 rlsp.clivcly. 'IAa elet$d6 w.c .s*nblcd. F@sing chdbd spl6 *@ F@rionarion lmded. @ t ading pon! wc sal.d. sbned. Mdimm sFcili.d 68 An bubblE ops ingDatderss Fdcrio$ V@ @[dt€d aftcr rh. @nplction of Rolofor 6 M. UeFIld re fo.rhe and moecd, ell wE Ft SIIDDIRECTED MTITAGEIIESIS To pr.pe singl€-nutdt two muiag.dc pnnd lr@ in d oP.dor synlhdiz.d r€giot of myE qith +5G+A nutaiion' 6 follo$ usirg oiline Stralagen snse B8{r 5 grgangrSekattt@d g@ gcAn@!@tlclccrgtacel eng84a 5'$gr.ea.eeag@ftgneTgctt €tn@trarc!@tcrc3' Si|.nietcd nut4edis vs done followbS th. S!!&goe XL iilrtudion tmu.l with lligltmodin@tioN. Firl slepvs . Pl6mid pr€pdari@ i-e.,8.ne h . T.mperalde cycline i.e., to plffiid wi$ d.mtw th€ tar8.r sii€ for mutation plMid &d m€al the oligonwl@tide prin€$ containing lhe d€sied nutation Ning quck chdg€ XL sitnire.t d dultgddis ldt alonryilh t mPld. DNA Prin6 @d H,O Using thc rc!- stdd{bpla.i4 a.tion of ptu Tubo DNA polvlffie, €xld'on ard imtpoddng . The &recl lhe murag.dc prin6, tick d circde stredr w.E Pap€t d. nulalio! in pcR2,l clone (i4ptate), catrvirS dvE, ws ceicr' oui wi0r PCR mplificstion prcsmne of 95t fot lnin (fiBt deDalMiion)' 25 cycl* cosistirs of 95'c for 50s.. (d.@t@tion), 60'c for 50s (enn'6ling)' 6E c fot lonii The ncn scp (eloDsation) *s ed t&( cv.t. at 68'c digenion eirh Dp,/ io drgd fd Tnin (fiuins) ed 4'c tbe meihylar€d, mn Du|,r.d pqcltal DNA templare. So id th. PCR prodE! Dp,l appDxirutely I hod dd 45 s4 al 37t. for s a<lded for T@1ed DNA (PcR Poduct) ws on nqr d.y DNA To the podDct, add€d 75% RT iftubaliotr v6 w6 prccipilalion isopFpsol. Mi&d rell fd 20s givcn for at ldt Sup€mtart dd pellet m by piFttjlg s .d 20din. spin doM th. prodDd at 14000ryrn E fo.20mjr' .nd at RT- SUF@ra pelLt snd v.sbing ispDp&ol which is done drcugh q@tully Mor€d withoul disruling lhc doE ag.i, with ?5vo w4.gai! cGnrly d.cet d i$pnp.nol for ed !n 5min at 14000 dri€d for dt le.s1 4m. lonin at RT wa reswFnded in I IrO. TrsfomEtion i.e.. uesfods uE circuld. nicked dsDNA into XLlo€old ulE@nper€nt cells. Ai R6lsFded ie peu€i w fii! mixcd sr.p Toplo @mpetent *ith for al l.a.t 3omin. Heal sh@k @mpetcnl s ells els dd wc iha*ld !t RT. ilcubatiotr gim d 42t fo 30-a!$., 6 aad dorc on lo ii add.d Soc (n€dim). Incubaio. ws giv.n at 37t sldory ircubald shsld for appbximtety 2 hoN dd 30 s thd sprcading eEoed after plenid isolslion. dorc on LB+sr.Eh+Ku or (fq contro!). Mulantr ADp plal€s and LB+X-GaI+IPTG+Anp v4 M r€sis1a.t 1o Doubl€ $reded plasnid DNA tpa] w6 ued for atl seq@cinc @tions again lsine didexy chain tqni@tion m.thod of Smiih et al.. 1986 by uinS flldeat scqEM (Mod.l 3l00:All, PRISM). inro rmimloB &d Mut nts \,@ e aulon sub.lo.Ed ad ton pCR2.l pHB2ol ald rnEfomcd inb E..oli, Arcills &.brilis aalletn B@illu 70 DNA sp.