MECHANISMS OF HYPERTROPHY AFTER 12-WEEKS OF
AEROBIC TRAINING IN ELDERLY WOMEN
A THESIS
FOR THE DEGREE
MASTERS OF SCIENCE
BY
ADAM R. KONOPKA
ADVISOR: MATTHEW P. HARBER, PHD
BALL STATE UNIVERSITY
MUNCIE, IN
MAY 2009
ABSTRACT
THESIS:
Mechanisms of Hypertrophy after 12-weeks of Aerobic
Training in Elderly Women
STUDENT:
Adam R. Konopka
DEGREE:
Masters of Science
COLLEGE:
Applied Sciences and Technology
DATE:
May 2009
PAGES:
117
The primary focus of this study was to determine basal levels of myogenic
(MRF4, myogenin, MyoD), proteolytic (FOXO3A, atrogin-1, MuRF-1), myostatin, and
mitochondrial (PGC-1α & Tfam) mRNA in elderly women before and after aerobic
training. This approach was taken to gain insight into the molecular adaptations
associated with our observed increases in whole muscle cross sectional area (CSA)
(11%, p<0.05), knee extensor muscle function (25%, p<0.05) and aerobic capacity
(30%, p<0.05) with training. Nine elderly women (71±2y) underwent muscle biopsies
obtained from the vastus lateralis before and after 12-weeks of aerobic training on a
cycle ergometer. Post training biopsy samples were acquired 48 hours after the last
exercise session. Aerobic training reduced (p < 0.05) resting levels of MRF4 by 25%
while myogenin showed a trend to decrease (p = 0.09) after training. FOXO3A
expression was 27% lower (p < 0.05) while atrogin-1 and MuRF-1 were unaltered
after training. Additionally, myostatin gene expression was decreased (p < 0.05) by
57% after training. Lastly, aerobic training did not alter PGC-1α or Tfam mRNA.
i
These findings suggest that aerobic training alters basal transcript levels of growth
related genes in skeletal muscle of older women. Further, the reductions in FOXO3A
and myostatin indicate the aerobic training induced muscle hypertrophy in older
women may be due to alterations in proteolytic machinery.
ii
ACKNOWLEDGEMENTS
I would like to thank my parents for all of their support throughout my life. I am a
product of your success. Also, thanks for your constant interest in the research that I
am doing in the laboratory. You always care to read an abstract and are excited to
read through this thesis.
Dr. Harber, you demonstrate your remarkable enthusiasm and passion for exercise
physiology everyday you step foot in the lab. The constant positive energy you
exhibit day in and day out creates an extraordinary environment. Thank you so much
for helping me through this masters program. Last but not least, the opportunities
that you have provided me within the laboratory are second to none and I feel very
privileged.
To my committee members, Dr. Scott Trappe and Dr. Todd Trappe, thank you for
your guidance and advice. You have supplied many resources to learn and expand
my knowledge of exercise physiology.
To Matthew, you have graduated and since become successful in your professional
career, but your hard work and dedication to this project does not go unnoticed. You
played an integral role in the organization and commencement of this project.
John, Ritch, Brett and Franklin, I am very grateful for your friendship. This year was
a roller coaster ride making my time with you limited. However, I greatly appreciate
your understanding of the circumstances and your constant desire to have fun and
enjoy life at all times.
To all the subjects. Thank you for your great stories and your hard work during this
very challenging training program. Your dedication was demonstrated with a 100%
exercise attendance.
This investigation was supported by NASA grant NNJ06HF59G.
iii
TABLE OF CONTENTS
ABSTRACT..............................................................................................................i-ii
ACKNOWLEDGEMENTS..........................................................................................iv
LIST OF TABLES.......................................................................................................v
LIST OF FIGURES.....................................................................................................vi
CHAPTER I: INTRODUCTION...................................................................................1
CHAPTER II: REVIEW OF LITERATURE..................................................................5
CHAPTER III: METHODS.........................................................................................42
CHAPTER IV: RESULTS..........................................................................................54
CHAPTER V: DISCUSSION.....................................................................................67
REFERENCES..........................................................................................................79
APPENDIX A: INFORMED CONSENT................................................................... 90
APPENDIX B: WESTERN BLOTTING PROCEDURES AND SUPPLIES.............100
APPENDIX C: WESTERN BLOTTING RAW DATA..............................................108
iv
LIST OF TABLES
Table 2.1 - Adaptations of whole muscle size to aerobic exercise in elderly…........11
Table 2.2 - Myogenic gene expression in response to acute aerobic exercise........26
Table 2.3 - Proteolytic gene expression in response to acute aerobic exercise.......37
Table 3.1 - Aerobic exercise training program……..…………………………………..46
Table 3.2 - PCR primer set sequences and amplicon information............................52
Table 4.1 - Subject Characteristics………………….......………………………………57
Table 4.2 - Whole body functional parameters..……………………………………….58
Table 4.3 - CSA of the Quadriceps Femoris and single
fibers in the Vastus Lateralis.................................................................61
Table B-1 - Working reagent...................................................................................102
Table B-2 - Western blotting supplies.....................................................................105
Table C-1 - FOXO3A protein expression data........................................................109
Table C-2 - HSP70 protein expression data...........................................................110
Table C-3 - PGC-1α protein expression data..........................................................111
v
LIST OF FIGURES
Figure 2.1 - AKT-FOXO3A signaling........................................................................33
Figure 2.2 - Potential pathways regulating muscle hypertrophy after
aerobic training....................................................................................40
Figure 4.1 - Percent change in whole muscle knee extensor function before and
after 12-weeks of progressive aerobic exercise training.......................59
Figure 4.2 - MHC distributions before and after 12-weeks of aerobic training.........60
Figure 4.3 - Percent Change of basal gene expression after 12-weeks of
aerobic training......................................................................................62
Figure 4.4 - Myostatin mRNA expression before and after 12-weeks of
aerobic training.....................................................................................63
Figure 4.5 - FOXO3A mRNA and protein levels before and after
12-weeks of aerobic training.................................................................64
Figure 4.6 - PGC-1α mRNA and protein levels before and after
12-weeks of aerobic training.................................................................65
Figure 4.7 - HSP70 mRNA and protein levels before and after
12-weeks of aerobic training.................................................................66
vi
Chapter I
INTRODUCTION
Aging is associated with a substantial decrease in muscle mass, which has
been termed sarcopenia (27). Sarcopenia is the origin of a milieu of detrimental
effects that include diminished muscle function and aerobic capacity as well as an
elevated risk of cardiac, pulmonary, and metabolic diseases. Sarcopenia affects
over 20 million Americans with an economic impact approaching $20 billion annually
(55). These alarming healthcare statistics highlight the importance of developing
interventions that reverse the negative consequences associated with aging.
Therefore to prevent these financial and health related burdens, a large focus of our
laboratory over the past decade has been to characterize the alterations in skeletal
muscle with aging and to develop exercise countermeasures to improve function and
mobility in older adults.
Skeletal muscle is a highly malleable tissue in individuals through the 8 th
decade of life. Muscle mass is regulated by the balance between protein synthesis
and protein breakdown. The cellular processes that result in hypertrophy or atrophy
are not simply the mirror image of each other but instead both processes have
distinct cellular control mechanisms. Resting mixed muscle synthesis does not
appear to be altered in older men (155), therefore a diminished protein
2
synthesis may not be associated with age related atrophy. Conversely, there is
evidence that the proteolysis of myofibrillar (contractile) proteins is elevated in elderly
men (147). Our laboratory has recently shown that older women exhibit greater basal
proteolytic gene expression in skeletal muscle, suggesting the potential to possess
more machinery for protein degradation (110). Collectively, it appears that the
balance between synthesis and degradation, as well as their regulatory control
mechanisms, is altered in aging skeletal muscle, which results in dramatic reductions
in muscle mass and reduces quality of daily living for millions of Americans.
Developing effective interventions to combat the debilitating effects of
sarcopenia is an area of intense research. Exercise is a proven tool to increase both
muscle mass and function in old individuals. Resistance exercise (RE) is a largely
investigated countermeasure because of its known ability to stimulate muscle
hypertrophy in elderly individuals. Resistance training has been shown to result in 510% increases in muscle mass in addition to the observed increased in muscle
function in older individuals (34, 81, 143, 146). Therefore RE is an effective
prescription to attenuate age-related sarcopenia.
In addition to RE, aerobic exercise (AE) is also a widely recommended mode
of exercise for elderly individuals. Although many older adults are advised to perform
AE due to the cardiovascular health benefits, there has been very limited scientific
inquiry about improvements in muscle function and size. Due to lack of scientific
examination, the effects of AE on muscle size are not well understood. It has been
reported that performing AE acutely increases muscle protein synthesis in old
3
subjects (126). In addition, when AE is performed chronically, resting muscle protein
synthesis, muscle function and aerobic capacity can be increased in both young and
old subjects (96, 128). Further, we have shown that AE training alters contractile
function at the cellular level in young subjects, demonstrating this mode of exercise
remodels the contractile properties of skeletal muscle (46, 47, 144). Our preliminary
findings have recently shown that progressive aerobic training can dramatically
increase muscle size, function and aerobic capacity in a small cohort of older women
(n=3) (28). These improvements in whole muscle size and function are astonishing
since they rival the enhancements seen in a known hypertrophic stimulus (i.e.
resistance training) within our own laboratory. Likewise, raising the aerobic capacity
in elderly women is another critical component in expanding the functional range that
these women can perform daily activities.
The relationship between muscle oxidative capacity and skeletal muscle
protein balance has been highlighted recently. Elegant animal models have
examined the potential role of oxidative capacity in the prevention of muscle atrophy.
Sandri et al. (121) examined the cellular processes in mitochondrial biogenesis,
which is one component for increased aerobic capacity and reported PGC-1α has
direct effects on inhibiting protein degradation during a potent atrophic stimulus.
Additionally, the family of heat shock proteins (HSP’s), which are responsive to
aerobic training, also appear to play a role in preventing skeletal muscle protein
breakdown (26, 125). Mechanistically, these factors appear to decrease muscle
breakdown by inhibiting FOXO signaling (26, 121, 125). While these links have not
4
been examined in human skeletal muscle, they represent a potential means for the
muscle hypertrophy induced by aerobic training. Therefore, the purpose of this
project is to examine the cellular factors within skeletal muscle that may explain these
alterations in muscle size, function and aerobic capacity we have recently observed
in an expanded cohort.
The following hypotheses will be examined in muscle biopsy samples from older
women (n=9) that recently completed 12 weeks of progressive aerobic training.
Hypotheses:
Hypothesis 1: Diameter of the slow-twitch muscle fibers will be increased after
progressive aerobic training. Also, muscle fiber type distribution, determined by the
myosin heavy chain (MHC) composition of single muscle fibers will shift towards an
oxidative phenotype.

Previous data from our laboratory have demonstrated that slow muscle fibers
from older women are more responsive to resistance training, which appears
to be an age specific response (143).
Hypothesis 2: Resting levels of proteolytic gene expression (FOXO3A, MuRF-1,
Atrogin-1) will be reduced after 12 weeks of progressive aerobic training in older
women. Further, we hypothesize that the protein content of FOXO3A will be reduced
with training.

Based on data from Raue et al, demonstrating the basal gene expression is
elevated in older women (110), we propose that aerobic training will reverse
these processes which are likely related to the exercise-induced muscle
hypertrophy we have observed.
Hypothesis 3: The mRNA expression and total protein content of PGC-1α and
HSP70 will be increased with aerobic training in older women.

We will investigate the potential link between factors associated with the
exercise-induced increase in muscle oxidative capacity with the factors
involved in muscle protein breakdown.
Chapter II
REVIEW OF LITERATURE
Objectives
The objectives of this chapter are to provide a synopsis of the background on
the deleterious effects of sarcopenia and countermeasures to reverse these effects,
including the role of molecular regulators on skeletal muscle responses to aging and
aerobic exercise.
Sarcopenia
The number of elderly individuals is expanding at a rapid rate. With this large
increase in population comes an even larger economic strain on our current
healthcare system. There are numerous cardiovascular, pulmonary and metabolic
diseases associated with aging that are raising our healthcare costs by a distressing
amount but the disease that will be of primary interest for the purpose of this review
is sarcopenia. Sarcopenia in the clinical realm has been described as the decrease
in both muscle mass and function (27). Some believe that sarcopenia or ‘ageinduced atrophy’ is not a result of aging per se, but the inactivity and extreme disuse
of skeletal muscle that is associated with aging (3). It is known that the muscles
become weaker and function is decreased, which is exemplified by individuals
6
between 60-80 y of age are typically 20-40% weaker in their knee extensor muscles
compared to their young counterparts (27). The conventional thought explaining the
decrease in muscle size is due to the loss of muscle fibers with a concomitant
reduction in size of remaining individual muscle fibers (83). Lexell and colleagues
were able to exhibit this idea by performing several studies investigating skeletal
muscle atrophy with age. Technological advancements allowed Lexell and
colleagues (82) to slice cross sections of the vastus lateralis of human cadavers.
Using these cross sections of whole muscle, he was able to quantify total muscle
size (CSA), number of muscle fibers and the distribution of fiber types. Elderly
subjects possess an average CSA that was 25% smaller and the number of muscle
fibers was 30% less than the young (82). In addition, the MHC II fibers represented
approximately 60% of the reduction in fiber number (83). These data suggest the
potential for preferential loss of these fast fibers in aging muscle.
After the age of sixty, the major contributor to the previously described
decrease in skeletal muscle structure and function is the degeneration of the
nervous system (79). There is no sign of motor neuron loss for those younger than
60 however, beyond 60 years old there is evidence of a decrease motor neuron
population (59, 79, 141). A motor neuron is an integral component of a motor unit.
Described by Sir Charles Sherrington nearly eighty years ago, a motor unit is a
single motor neuron and the muscle fibers it innervates (29). Motor units vary in size
7
from as little as ten fibers up to thousands of fibers innervated by one motor neuron
(18, 32). The loss of a motor neuron due to aging/inactivity results in a loss of a
whole motor unit. In spite of this, the muscle fibers innervated by the degenerating
motor neuron (i.e.denervation) can be salvaged by being re-innervated by a
neighboring motor neuron (80). Although within this process, when the denervation
exceeds the re-innervation some muscle fibers will become permanently lost.’
Consequently, one component of the decrease in muscle fiber structure and function
is partially explained through the diminished motor neuron pool.
As was briefly discussed early, there are suggestions of a preferential loss of
fast twitch muscle fibers with aging. The foundation of this argument stem from the
result of an age related reduction in number (59, 60) and diameter (98) of large but
not small nerve fibers. It has been noted in previous research that large motor
neurons typically innervate fast muscle fibers (83). Fast twitch muscle fibers produce
5-6 times greater power compared to slow twitch fibers (16, 142); hence a
progressive loss of fast fibers is deleterious to whole muscle function. Our laboratory
has found type IIa fibers of old women to appear 20% smaller and generate 25%
less power than the young control group (142). In addition the type IIa fibers were
28% smaller compared to the type I fibers in these women which was not observed
in either young or old men. Also these smaller and less powerful fibers also had a
defective makeup evidenced by the numerous frail fibers that failed structurally
under maximal contraction. Our data reinforce the findings by Lexell (79, 82, 83) and
8
underscore how loss of fast twitch fibers could contribute to the loss of whole muscle
function during age related atrophy.
The loss of skeletal muscle mass is not only accompanied by the loss of
muscle strength and a decrease in muscle function but also a reduction in skeletal
muscle oxidative capacity which contributes to an increased prevalence of insulin
resistance, type 2 diabetes, poor blood glucose disposal and excess fat mass (68).
All of which can proceed to initiating hyperlipidemia, hypertension, cardiovascular
diseases and even morbidity. Therefore, finding proper exercise modalities to
prevent the loss of muscle mass, function and oxidative capacity could aid in
improving the overall health of aging populations.
Thus our laboratory has
investigated the mechanisms of sarcopenia as well as potential means to reverse
the consequences of age-related atrophy and maintain ‘muscle health.’
The Role of Aerobic Training in Stimulating Muscle Adaptation
The skeletal muscle response to physical exercise has been a topic of
extreme curiosity among researchers, physicians, coaches, and athletes since the
days leading back to the first marathon competition in 776 BC Olympic Games.
Investigators have performed numerous studies exploring the countless areas of
muscle adaptation, ranging from proper exercise programs to analysis focusing on a
single muscle cell in order to determine the mechanisms behind adaptation. From
the rigorous work over the past half century, the understanding of the behavior in
which skeletal muscle responds to a stimulus is expanding at a rapid rate.
9
Currently, it is understood that there are numerous adaptations to progressive
aerobic training that occur to create the optimal environment for performance. In our
case, we want to highlight these known adaptations of progressive aerobic training
and associate them with the ability to increase the functional range in the aging
population. Both young and older populations seem to increase cardiac output (30),
capillary density (22, 49), a-vO2 difference (132, 162), mitochondria biogenesis
(114, 129), fat utilization (130) and aerobic capacity (22, 30, 67, 132). All of these
factors allow individuals to sustain desired workloads for extended amounts of time
before succumbing to fatigue. In turn, by being able maintain these workloads,
aerobic exercise could potentially lead to increased function in the elderly. Although
the previous adaptations have been outlined, the adaptation of skeletal muscle in
response to progressive aerobic training has not been clarified in elderly people.
Impact on Aging Skeletal Muscle Size
The influence of aerobic training on cross sectional area or volume of whole
muscle in older adults has been performed during several studies. From six studies,
all using slight variations in training intensity, frequency and mode, it has been
determined that older individuals do not demonstrate changes in whole muscle size
after aerobic training (24, 33, 57, 128, 154, 157). There are two main factors which
potentially could hinder the results that appeared in the majority of these studies: 1.)
subjects lost significant amounts of weight during the training program, which has
been shown to hinder the muscles ability to increase size and 2.) the intensity or
duration may not have been robust enough to elicit skeletal muscle hypertrophy. In
10
one study, Short et al. (128) reported an increase of mixed muscle protein synthesis
by 22% after 16-weeks of cycling irrespective of age. However, they did observe a
decline of mixed muscle protein synthesis by 3.5% per decade of age. Despite the
lack of change in whole muscle size, the aerobic exercise stimulus demonstrated
that basal muscle protein synthesis could be enhanced. Thus, aerobic exercise can
create a more optimal environment for skeletal muscle growth and if following proper
training procedures whole muscle size could potentially be improved in aging
skeletal muscle.
11
Table 2.1 Whole Muscle Size Adaptations to Aerobic Exercise Training in Elderly Individuals
Authors
Subjects
AET Protocol
Analysis
Results
Cuff et al. (24)
28 post menopausal women w/
Type 2 Diabetes
3 groups (control, Ae, Ae + RT)
75 min
60-75% max HR
3 days/wk
CSA
CT Scan
↔ in CSA of Thigh
Ferrara et al. (33)
9 men (63 ± 1y)
Overweight and Obese
(9 out of 19 completed study)
45-50 min
75-80% HRR
3 days/wk for 3 months
CSA
CT Scan
↔ in CSA of Thigh
Jubrias et al (57)
40 male and females (69 ± 1y)
3 groups (control, Ae, Ae + RT)
Ae group (n=15)
20 min (2 exercises)
60% HRR to 85% HRR
3 days/wk for 6 months
CSA, Volume
MRI
↔ in CSA or Volume
Short et al. (128)
3 groups (young, middle, old)
21-87y old
45 min
Up to 80% peak HR
3-4 days/wk for 16 weeks
CSA
CT Scan
↔ in CSA of Thigh
Verney et al. (154)
10 men (73 ± 4y)
3x12 min interval training
75-95% HRR
3 days/wk for 16 weeks
CSA
MRI
↔ in CSA of
60 min
70% HR Max
6 days/wk for 12 months
Volume
MRI
↔ in Volume of
Weiss et al. (157)
16 men and women
(50-60 y)
of Quadriceps
Quadriceps
Thigh
AET = Aerobic Training, ↔ No Change, CSA = Cross Sectional Area, HR = Heart Rate, HRR = Heart Rate Reserve, CT =
Computed Tomography, MRI = Magnetic Resonance Imaging
12
Impact on Aging Skeletal Muscle Function
The independence of aging individuals depends upon their ability to function
properly. Skeletal muscle is a large component in determining the amount of mobility
and function elderly individuals possess. Therefore, from the literature to date we
feel that aerobic exercise is a necessity to sustain activities of normal daily living by
improving whole muscle function and aerobic capacity. One of the first studies to
investigate this belief was a cross sectional study comparing sedentary and
endurance trained young and old men. They reported that endurance training can
attenuate the loss of strength relative to muscle volume (3). In addition, another
cross sectional study (134) observed no differences in torque produced from the
knee extensor or plantar flexor muscles between elderly subjects that were either
endurance trained or sedentary. However, the elderly subjects used in this
investigation were not very old (60’s) which may be a reason for not seeing
differences in muscle torque. In spite of this, three examinations have shown that
various types of aerobic training have improved leg muscle strength. The first study
was conducted by Ferrara et al. (33) demonstrating obese men (63 ± 1 yr) who
performed aerobic exercise on a treadmill 3 days a week for 6 months at intensities
up to 80% of heart rate reserve for 45 minutes per day were able to increase leg
strength 45% (33). Two other investigations used a cycle ergometer as a mode of
aerobic exercise to examine alterations of whole muscle strength. Verney et al. (154)
showed a 13% increase in isometric torque following 14 weeks of high intensity
interval training in older men. Slightly different, Haykowsky (48) used the more
13
typical aerobic exercise training program and demonstrated a 13% improvement in
leg press strength. Therefore, performing aerobic exercise is beneficial to the aging
population due to the ability to improve muscle strength and function. Although,
these improvements have been established, mechanistically they are not well
understood and deserve further exploration.
Impact on Single Muscle Fiber Size and Distribution
A classical paper by the late Dr. Phil Gollnick was one of the first to examine
the training effects on skeletal muscle, specifically at the single fiber level. Due to
five months of cycling training, slow-twitch fibers (ST) increased in size whereas fast
twitch fibers (FT) showed a minor decrease in size. Gollnick explained that primarily
ST fibers were recruited during the training, which was aerobic in nature allowing
selective hypertrophy to occur (40). Gollnick also demonstrated young subjects do
not alter the percent of slow and fast fiber types after 5 months of a very challenging
protocol. Since this was one of the first training studies performed, technological
limitations may have prevented the observers to witness any changes in fiber type.
In a study by Coggan et. al., 23 older men and women were examined before and
after 9-12 months of aerobic training (either walking or jogging). The subjects trained
45 min/day, 4 days/week at 80% of maximum heart rate. The training program
induced a decrease percentage of type IIb fibers while there was a concomitant
increase in type IIa fibers. Interestingly there was no change in the percentage of
type I fibers (22). Furthermore, the use of aerobic training demonstrated that aging
skeletal muscle is still capable of adapting since both type I and type IIa muscle
14
fibers increased CSA. Coggan also investigated the fiber type distribution and size in
both masters and young runners. Although the distribution was similar, master
runners had 34% larger type I fibers than the young group (23). Since single fibers
are capable of changing size in aging skeletal muscle, which is in contrast to the
results of the whole muscle level, research is warranted to investigate the
relationship between potential adaptations at the myocellular and whole muscle level
using sufficient aerobic training procedures.
Regulation of Skeletal Muscle
Molecular regulation of skeletal muscle hypertrophy
Skeletal muscle is a unique tissue with the capability to react to an extensive
range of mechanical stimuli including physical activity. Since the muscle possesses
the trait of intrinsic plasticity, this allows skeletal muscle to adapt to periods of both
increased muscle loading (69, 145) (i.e. exercise) as well as periods of decreased
loading (2, 27, 136) (i.e. aging, spaceflight). Each respective stimulus causes cellular
alterations which proceed to regulate muscle phenotype. These modifications are
controlled by levels of complex molecular machinery activated in the minutes and
hours following exercise. After performing a contractile stimulus, the mechanical
stimuli are converted into biochemical signals within the cell (4, 19). These signals
are responsible for all aspects of adaptation and involve a host of regulatory
components such as intracellular signaling pathways, transcription of muscle specific
regulatory genes, and synthesis of proteins (14, 21, 65). When a muscle cell is
15
activated by an external stimulus this starts a cascade of activation of intracellular
protein kinases and phosphatases, which control the phosphorylation status of an
endless number of intracellular proteins. The phosphorylation state, either
phosphorylated or dephosphorylated, of a protein/transcription factor can affect the
location, stability and activity of the respective transcription factor (149). As a result,
skeletal muscle is capable of altering the type and amount of protein present in the
muscle and is linked to the mode, volume, intensity and frequency of the stimulus
completed (54, 91). Thus, the process of muscular adaptation is rationalized as the
result of the aggregation of muscle specific proteins synthesized with repeated bouts
of training. By performing repeated bouts in a training regimen, the accumulation of
specific proteins leads to changes in growth related gene expression, muscle
phenotype, and muscle hypertrophy. These changes are defined by the mode of
exercise, which in our study will potentially lead to increased functionality and
mobility of older individuals.
IGF-1 PI3K AKT pathway
One of the more popular signaling cascades is the IGF-1, AKT pathway and
its downstream targets. The earliest studies interested in insulin-like growth factor
(IGF-1) were initiated by the observation that this extracellular ligand has the
capability to improve skeletal muscle regeneration in injured, diseased and aging
mice (149). IGF-1 activates one of its downstream targets, phosphatidylinositol
kinase, which recruits AKT to the cell membrane to be phosphorylated (activated)
most commonly by PDK1 (102). AKT acts as a kinase and phosphorylates several
16
downstream proteins that regulate several cellular functions such as glycolysis and
protein synthesis, in addition to attenuating the gene transcription of proteins
involved in protein degradation (118, 133) which will be discussed later in this
review. Currently, the purpose of this section will illustrate the signaling events
involved in promoting protein synthesis (38), one of the primary mechanisms of the
hypertrophy process. In the next section, AKT’s potential role in hindering protein
degradation will be clarified.
After AKT is phosphorylated, it continues down the cascade of proteins by
activating the mammalian target of rapamycin (mTOR), which has been
demonstrated to have the power to manage the initiation of protein translation.
mTOR phosphorylates (inactivates) 4E-BP1, therefore no longer inhibits translation
and regulates the release of the restrained eukaryotic initiation factor (eIF4E). mTOR
also contributes to the activation of S6 kinase (S6K1), which phosphorylates a
myriad of downstream targets important to mRNA translation (38, 102). The role of
AKT and its pathway are critical to the commencement of protein synthesis.
AKT has been shown to be activated by several factors including insulin,
growth factors, electrical stimulation, resistance training and cycling which illustrates
AKT is highly active (21, 36, 119, 161), although not all inquiries have produced
similar results. Regardless of the discrepancies within the literature, AKT appears to
be an integral factor advocating both growth inducing and metabolic processes
following exercise (38, 119, 120). Although aerobic exercise is not typically
associated with growth processes nor hypertrophy several studies have shown
17
increases in AKT activity post aerobic exercise. A few studies have demonstrated
increases in AKT phosphorylation or activity after 60-90 min of cycling (15, 139,
163). Another novel study investigating AKT used 3 weeks of cycle training, where
subjects completed 1-2 hours of cycling 4-6 days per week. In this investigation total
protein content of AKT was increased nearly 56% post training (15h after the last
training bout) (36). Through these numerous investigations it is apparent that aerobic
exercise stimulates the PI3K/AKT pathway to potentially induce increases in protein
synthesis. However, there may be arguments founded by the cellular energy status
after aerobic exercise. Aerobic exercise will increase the AMP:ATP ratio, thus
reducing the amount of energy available for growth processes in addition to
activating AMPK. The AMPK signaling pathway has a known role in blocking the
PI3K/AKT pathway at mTOR, therefore potentially inhibiting protein synthesis
through the PI3K/AKT pathway. This is a primary example of cross talk between
different signaling pathways. Conversely, there is evidence that activation of
signaling events downstream of AKT-mTOR, including initiation of protein synthesis,
occurs independently of phosphorylation of proteins (AKT, p70SK) along the
pathway (31, 93). This would suggest that there may be alternate pathways
stimulating protein synthesis.
Effect of aging on IGF-1 PI3K AKT pathway
Using a rodent model, age-related changes in the AKT-mTOR-p70 pathways
have been identified. It was established when muscles of aged rodents undergo high
frequency electrical stimulation (HFES) there is a diminished increase in
18
phosphorylation of mTOR and S6K compared to adult rodents (37, 106).
Additionally, the same laboratory followed the initial investigation reporting that aged
rats are unable to respond to HFES compared to adult rats, specifically examining
the phosphorylation status of 4E-BP1 and eIF4E complex formation with eIF4G (in
more basic terms translation initiation). The phosphorylation of 4E-BP1 was blunted,
therefore inhibiting the release of eIF4E after HFES in the tibialis anterior and
plantaris muscles of the old rodents (37). Thus, these attenuated responses in the
AKT-mTOR-p70 pathway to a hypertrophic stimulus in aging rodents create
evidence that this may be an ageing related issue. However, Reynolds et al.
compared old rats who were subjected to wheel running and those that were
sedentary. The rats that were active had increased levels of AKT and protein
synthesis after 20+ months of voluntary wheel running (113). Therefore, even though
it is difficult to compare these studies, aerobic training seemed to induce results that
could potentially attenuate age related atrophy.
Molecular regulation of skeletal muscle atrophy
On the opposite side of hypertrophy and its related signaling pathways is
atrophy. Atrophy can be classified as a decrease in muscle mass and function. As
we know from the information presented before, aging is a primary example of
atrophy as well as decreased loading and muscle fiber recruitment seen in
spaceflight, diseased individuals, clinical populations, and paralysis. Albeit the
outcomes of each circumstance are similar, the molecular regulation of the events
causing atrophy may be different. It is generally accepted that in order for atrophy to
19
occur there must be a shift in the protein balance between protein synthesis and
degradation to favor degradation. Also, it is apparent that protein degradation is a
normal function in skeletal muscle essential for basic function and muscle
remodeling. However, there is limited information on the regulation of protein
breakdown in aging skeletal muscle and even more so aging skeletal muscles’
response to exercise. There are several pathways regulating proteolysis but the
major pathway that controls nearly 90% of protein breakdown is the ubiquitinproteasomal pathway (UPP) (39). Therefore, it is believed that the UPP’s intricate
pathway plays a primary role in sarcopenia, a slow process of atrophy occurring over
the later stages of life. In addition to being active during atrophy models, the UPP is
also constitutively active during daily protein turnover and is stimulated in response
to physical activity. In every example this pathway is imperative to skeletal muscle
remodeling.
Ubiquitin-proteosomal pathway
To briefly summarize, the ubiquitin-proteasome pathway has the ability to
recognize damaged or misfolded proteins and labels the targeted protein with an
unbiquitin. Then, the ubiquinated protein is recognized and broken down into its
constituent amino acids (112).
In order to efficiently break down large quantities of proteins, the UPP is
heavily reliant on the systematic interaction between several enzyme families. First,
the ubiquitin monomers are activated by an ubiquitin-activating enzyme called E1.
Next, the activated ubiquitin is transferred to E2, which is an ubiquitin carrier protein.
20
Then, the interaction between the ubiquitin carrier protein (E2) and ubiquitin ligase
protein E3 occur. Since there are a large number of E3 proteins this allows for
specific targeting of proteins and multiple ubiquitin monomers are transferred to the
targeted protein. The numerous ubiquitin monomers create a polyubiqutin chain on
the target protein which facilitates the recognition for breakdown (50).
An increase in either E2 or E3 protein levels as well as other components
within the pathway can cause an increase in UPP activity. Interestingly, both E2 and
E3 proteins have been shown to be elevated in catabolic models (38, 74). E3 ligases
Atrogin-1 and MuRF-1 are frequently investigated in skeletal muscles response to
altered loading patterns and are normally up regulated when the activity of UPP
increases (75). Both atrogin-1 and MuRF-1 transcription is regulated by an upstream
family of transcription factors called FOXO (122, 133). Also, it is significant to
understand that the UPP activity is increased due to skeletal muscle use (i.e.
exercise) creating the typical increase in protein turnover.
Gene Expression
The previously discussed signaling pathways allocate transfer of an internal
or external signal to the nucleus where the signal can be implemented. Cells have
the extraordinary ability to respond and adapt to metabolic and physical challenges
produced by specific modes of activity. Contractile activity results in intracellular
signals, which mediate the changes in amount or types of protein within the cell,
therefore can meet the new demands imposed on the cell. The new proteins, hinted
at previously, are made through the methodical process of changes in gene
21
expression. This unique system promotes the activation of many specific growth and
remodeling genes which code for proteins that function in almost every component
of skeletal muscle. Gene expression is the flow of genetic information from DNA to
RNA and then to a protein. The first step in this process requires transcription, the
transfer of genetic information from DNA to RNA (25). When RNA molecules are
synthesized they correspond to the information within the gene that was transcribed.
After the DNA introns are eliminated (i.e. splicing) in the nucleus, the RNA molecules
are called messenger RNA (mRNA) and can pass into the cytoplasm for translation.
If a stimulus results in increased levels of mRNA it is assumed there is a cellular
need for the corresponding protein. The levels of mRNA therefore indicate the
expression of a specific gene.
Investigators have suggested the skeletal muscle adaptation that occurs with
training is a result of cumulative increases in mRNA (108) and their resulting
proteins after each individual training bout. The result being a more functional
muscular environment in which the cellular environment is less disturbed by
subsequent bouts of exercise. Thus, it has become increasingly popular to examine
these highly regulated processes in order to further understand the progression of
adaptation in skeletal muscle.
In the present study we will not only investigate the change in basal mRNA
levels before and after progressive aerobic training but also the change in related
protein content. This is warranted since the only investigations that have attempted
to connect transcription factors to translation products are in animals and spinal cord
22
injuries (152). These data will allow our laboratory to gain insight on the relationship
between mRNA expression and respective protein products in response to
progressive aerobic training in old women. In conjunction with our whole muscle size
and function increases, these transcriptional and translational alterations will allow
us to interpret the adaptive response in aging skeletal muscle in hopes to identify
mechanisms to attenuate sarcopenia. The following sections of this review will
examine the myogenic, proteolytic, and mitochondrial related gene expression in
response to exercise and aging.
Myogenic Gene Expression
Approximately three decades ago there was an intensified search to discover
a master regulatory gene involved in the control of myogenesis, which is
characterized as the expression of muscle-specific proteins. Lassar et al. (73) lead
the way by indentifying a unique transcription factor termed MyoD. The identification
of MyoD as a master regulator of skeletal muscle allowed the subsequent discovery
of three other regulatory factors, Myf5, myogenin, and MRF4 (10). Together, these
four regulatory factors are known as the muscle regulatory factors (MRF). Over
expression of the MRF genes result in the conversion of non-muscle cells to the
myogenic lineage, illustrating the importance of MRF mediated proliferation and
differentiation.
Since MRF’s have an integral role in determining and differentiating the
myogenic lineage it is of no surprise that MRF’s are vital during development.
23
Studies that have focused on eliminating MRF’s MyoD and Myf5 genes have shown
a complete absence of myoblasts and myofibers (12). These results clearly reveal
the importance of MyoD and Myf5 in the determination of the myogenic lineage.
When scientists removed myogenin and MRF4 it was determined that since there
was a deficiency of muscle fibers, these two genes were primarily responsible for
differentiation (17).
More interesting and relevant to our investigation is the role of MRF’s in adult
skeletal muscle. All four MRF’s genes are expressed in human skeletal muscle,
typically with MRF4 being expressed to the greatest degree (156). The following
sections will underscore the unique role of MRF’s in skeletal muscle experiencing
sarcopenia and the response to exercise.
Effects of Aging on Basal Level Myogenic Gene
Investigations examining the difference in myogenic gene expression
between young and old individuals are scarce however this has initiated several
research groups to examine a focal point in understanding aging-related atrophy.
Kim et al (64) have shown that MyoD and Myf5 gene expression was greater in
resting muscle of 60-75 year-olds compared to young subjects. Similarly, Hameed et
al (43) reported a greater MyoD expression in elderly subjects even when using
slightly older subjects (70-82 y). Furthermore, our laboratory has previously shown
elderly women greater than 80 years of age also exhibited higher levels of MyoD,
MRF4, Myf5 and myogenin (109). In all of these investigations subjects displayed
symptoms of sarcopenia and the authors concluded that this consistent increase in
24
myogenic gene expression is a compensatory mechanism by the muscles to retain
muscle mass during aging-related atrophy. Supporting this theory, one research
team investigated the MRF’s translated protein content in young and old subjects
(60-75y). They found myogenin to be significantly higher in old, while MRF-4 trended
to be higher in older females (6) thus reiterating the need for growth related proteins,
not just mRNA, in attempt to prevent muscle loss during aging.
Effects of Aerobic Exercise on Myogenic Gene Expression
For the past several years there have been a handful of studies exploring the
myogenic response to aerobic exercise. Although aerobic exercise is not typically
associated with hypertrophy, cross sectional studies have demonstrated those who
perform endurance training have larger cross-sectional areas of muscle fibers than
those who are recreationally active (44). Therefore to determine growth and
remodeling processes seen with aerobic training, investigating the myogenic gene
expression is a popular approach. The first study to explore a component of the
MRF’s was performed by Kadi et al. (58) where they were able to determine that
myogenin had accumulated in the myonuclei after one bout of aerobic exercise.
Since this group used immunochemistry to measure myogenin, some subtle
differences may not have been identified; however, they were able to observe an
increase in myogenin after one-legged cycling with no difference between 40 and
75% of VO2 max. Our laboratory then conducted an investigation to ascertain the
proper time points for peak expression after aerobic exercise. In this study, subjects
performed 30 min of running at 70% of VO2 max and biopsies were obtained from
25
the gastrocnemius muscle. We revealed that the greatest expression of MyoD was
at 8 and 12 hours post exercise (165). Nevertheless, two studies have identified
increases in MRF’s at 3 and 4 hours post exercise. After 3 hours of recovery Coffey
et al. observed increases in MyoD and Myogenin due to 60 min of cycling (20). Our
laboratory, four hours after 45 min of running, was able to detect higher levels of
MRF4 in the VL in addition to elevated levels of MyoD in both the Sol and VL (45).
Although these studies used different exercise modalities, durations, muscles, and
biopsy time points aerobic exercise consistently induces an increase in a component
of myogenic gene expression. Studies that have investigated the impact of aerobic
exercise on myogenic gene expression in aging individuals are nonexistent.
Although aerobic exercise has not been implemented, there have been two studies
that observed a similar increase in myogenic gene expression after a bout of
resistance exercise in elderly subjects (64, 109). Collectively, it appears that skeletal
muscle from young and old women respond similarly at the transcriptional level.
Therefore, it is necessary to research how aging skeletal muscle responds to various
stimuli (e.g. aerobic exercise) in order to better understand the attenuation of
sarcopenia.
26
Table 2.2 Myogenic Gene Expression Response to Acute Aerobic Exercise in Young Subjects
Authors
Genes of Interest
Protocol
Biopsies
Results
Coffey et al (20)
MyoD, Myogenin
60 min cycling
70% VO2 max
Pre, 3 hr post
↑ MyoD, Myogenin
Harber et al.
(45)
MyoD, Myogenin, MRF4
45 min running
75% VO2 max
Pre, 4hr, 24hr post
↑ MRF4 in Sol & VL
Kadi et al.(58)
MyoD
30 min 1-leg cycling
45 & 75% VO2 max
Pre & 0 hr post
Accumulation of
Myogenin
Klossner et al.
(66)
MyoD, Myogenin, Myf6
15 min eccentric
cycling
50% of max concentric
power
Pre, 0, 1, 3, 8, &
24 hr post
↑ Myf6 (MRF4) after
3h
Schmultz et al
(124)
MyoD, MYH4
MHC I & IIa
Training: 30 min,
5d/wk 65% Max WL
Acute Bout: ↑ WL until
exhaustion
Pre, 0, 1, 3, 8, &
24 hr post
Acute: ↑ MYH4, MyoD
at 8 h post
Training: ↑ MHC I &
IIa (mRNA)
Yang et al. (90)
MyoD, Myogenin, MRF4
30 min running
75% VO2 max
Pre, 1, 2, 4, 8, 12,
& 24 hr post
↑ MyoD 8 & 5 fold at 8
& 12 h post
MRF4 = Myogenic Regulatory Factor-4, WL = Workload
27
Myostatin
In 1997, myostatin was first examined by McPherron et al (95). It was
determined that myostatin is indeed expressed in skeletal muscle and is a negative
regulator of muscle mass (i.e. inverse relationship between myostatin and muscle
growth). Animal models have been a popular model to investigate the effects of
myostatin knockout species. With these models it has been determined that
myostatin-null animals have shown a great increase in myofiber size and number
(95). Although the complete understanding of the function of myostatin in the control
of muscle mass is well documented, only recently have the downstream targets of
myostatin been exposed. One study conducted by Thomas et al (137) suggested
that myostatin applies its operations to inhibit myoblast proliferation whereas an
investigation by Langley et. al. (71) demonstrated that myostatin may also be
involved in restraining myoblast differentiation. Collectively, these data suggest that
myostatin plays a role in both myoblast proliferation and differentiation and thus
retarding muscle growth.
In addition to the inhibition of myoblast proliferation and or differentiation,
myostatin has been shown to affect the IGF-1/PI3K/AKT pathway through the
inhibition of AKT phosphorylation (94). As mentioned earlier in this chapter, AKT
phosphorylation is believed to be a fundamental element in the initiation of protein
synthesis. Furthermore, AKT has an important part in proteolytic gene expression in
skeletal muscle. It is believed that AKT phosphorylation is critical for the subsequent
phosphorylation of FOXO3A, resulting in nuclear exclusion of this transcription factor
28
and the attenuation of both atrogin-1 and MuRF-1 (downstream transcription factors
of FOXO3A). For these reasons, it has been suggested that myostatin can promote
proteolytic activity through the dephosphorylation of AKT. When AKT is
dephosphorylated this causes the continued localization of FOXO3A, which allows
increased levels of its downstream transcription factors atrogin-1 and MuRF-1
(which will be discussed further in the following section). By either the inhibition of
myogenesis or the initiation of proteolytic events, myostatin is a large component of
skeletal muscle mass regulation.
Myostatin Expression in Aging Skeletal Muscle
Due to aging skeletal muscle experiencing sarcopenia, it may be anticipated
that myostatin should be elevated since this gene has such a potent role in
negatively regulating muscle mass. There are only a few studies who have
investigated sarcopenia and myostatin’s potential role. Contrary to what was
expected, there was no age-related difference in myostatin mRNA from young (2035y) and old subjects (60-77 y) (63, 115, 158). However, evidence from our
laboratory using skeletal muscle from the vastus lateralis of subjects slightly older
(80+ y) resulted in a greater expression of myostatin than their young counterparts
(110). In addition, these subjects also did not experience hypertrophy after a
progressive resistance training program that has demonstrated itself as eliciting
hypertrophy in old individuals (111, 145).
Rodent data has provided similar results to that of human data, essentially no
differences in myostatin mRNA between young and old (8, 42, 131). Interestingly,
29
Baumann found lower levels of mRNA but also found an elevated amount of protein
in old muscle compared to young muscle (8). This is a novel revelation because this
may suggest that during long term atrophy myostatin mRNA may not be elevated
because there is already a high amount of protein that has been translated and
regulating the muscle loss seen in sarcopenia. However, models using accelerated
muscle atrophy (e.g. spaceflight or denervation) have shown increased levels of
myostatin gene expression (70). Due to these data, it is possible that myostatin
partially regulates the rate of atrophy. Together, models that have used subjects with
long term (sarcopenia in 80+ y old subjects) or rapid muscle loss have shown
increased levels of myostatin.
Myostatin Gene expression after Aerobic Exercise
After resistance Exercise it has been proven in numerous studies that
myostatin is decreased compared to basal levels (52, 90, 109, 116), thus one factor
that is conducive to muscle hypertrophy. In spite of this, myostatin is relatively
understudied using aerobic exercise. The first study in humans investigating
myostatin after aerobic exercise was completed by our laboratory. We reported that
myostatin mRNA from the gastrocnemius muscle was down-regulated by
approximately 3 fold at 8 & 12 hours after 30 minutes of treadmill running (90). In
addition another study from our laboratory by Harber et al. (45) displayed a decrease
in myostatin in both the soleus and vastus lateralis after four hours of recovery from
45 minutes of running. However, using a different exercise modality demonstrated
divergent results. Unpublished observations by Urso et. al. (151) reported that
30
myostatin did not change at 2 & 5 hrs after recovery of 60 min of cycling, whereas
Coffey et al (20) used a similar protocol and witnessed an increase in myostatin after
3 hrs of recovery. Using different modes of exercise or biopsy time points makes
comparisons of studies and the classification of myostatin’s response to aerobic
exercise difficult. Lastly, there have been no studies investigating the response to
myostatin to aerobic exercise in the elderly population. We feel this is highly
warranted considering the substantial amounts of hypertrophy we have witnessed
using a progressive aerobic training program in a small subject population of elderly
women.
Proteolytic Gene Expression
There are three primary genes that are associated with proteolytic activity and
arguably the best markers for muscle atrophy. First, FOXO3A is a member of the
forkhead transcription factor family which is responsible for a diverse array of
biological processes. In particular, FOXO3A has been referred to as being the
master switch behind the balance of proteolytic and myogenic events (123). Several
factors that will be discussed have implications on the phosphorylation status of
FOXO3A. When FOXO3A is phosphorylated it is excluded from the nucleus
therefore inhibiting its effects on downstream targets, whereas if it is not
phosphorylated FOXO3A remains in the nucleus activating both atrogin-1 and
MuRF-1. The importance of atrogin-1 and MuRF-1 is underscored by using knockout
mice for either gene and demonstrating partial resistance to denervation atrophy
(13). Conversely, recent data have suggested that myosin heavy chains are
31
ubiquitinated and degraded by MuRF1 (166), highlighting its significant role in
muscle atrophy. Furthermore, atrogin-1 has been found to target and bind the
myogenic transcription factor MyoD (140), inhibiting muscle differentiation. In
addition to these data, studies using diaphragm muscles controlled by mechanical
ventilation (78, 166) and skeletal muscle from spinal cord injuries (151) have shown
increases in atrogin-1 or MuRF-1 mRNA compared to controls. Altogether, data from
a vast array of atrophy models have shown the potent role of these three proteolytic
genes and how critical it is to both fully understand and off-set these mechanisms in
order to attenuate/prevent muscle loss.
Effects of Age on Basal Levels of Proteolytic Gene Expression
There are a limited number of studies investigating the change in basal levels
of proteolytic gene expression. The primary reason is due to the fact atrogin-1 and
MuRf-1 has been shown to be up-regulated in both rodent (13, 41, 74) and human
atrophy models (56, 78, 152), therefore it is expected that proteolytic genes will be
elevated in sarcopenic skeletal muscle. The first study to examine these
assumptions was conducted by Whitman et al. (160) reporting similar levels of
atrogin-1 and MuRF-1 mRNA expression between young and old adult. Raue et al.
(110) demonstrated that elderly women (80+y) have greater expression of MuRF-1
and FOXO3A mRNA compared to the young control group. Our laboratory then
followed up our previous study with an investigation examining the effects of 12
weeks of resistance training on gene expression in very old women (80+y). Our
32
laboratory demonstrated that the very old women did not experience hypertrophy.
These unpublished results suggest that the inability to decrease basal levels of
proteolytic genes partially mediates no change in whole muscle size. This is
rationalized by the fact young women who were able to decrease levels of
proteolytic mRNA achieved a 5% increase in muscle size.
Proteolytic Gene Expression After Aerobic Exercise
Proteolytic transcription factors FOXO3A, MuRF-1, atrogin-1 may play a role
in the muscle proteolysis known to ensue after exercise mediating protein turnover.
Evidence from several studies and laboratories has demonstrated components of
proteolytic gene expression are elevated during the recovery of aerobic exercise (20,
45, 90, 151). This is believed to regulate protein turnover leading to the remodeling
of skeletal muscle seen in endurance athletes whom are performing chronic exercise
bouts.
33
Figure 2.1 AKT-FOXO Signaling. Adapted from Glass (38) and Sandri (122)
34
Manipulation of Proteolytic Gene Expression
AKT & Myostatin
As was discussed earlier in this chapter, AKT phosphorylation and myostatin
expression have effects on the expression of proteolytic gene expression. Due to
increased contractile activity AKT phosphorylation increases in skeletal muscle.
Elevated AKT phosphorylation allows biochemical signals to phosphorylate
FOXO3A, triggering the exclusion of FOXO3A from the nucleus. By excluding
FOXO3A from the nucleus this inhibits any activation of the downstream
transcriptions MuRF-1 and Atrogin-1 and their proteolytic effect (38, 122, 133). In
addition, myostatin has been shown to affect the IGF-1/PI3K/AKT pathway through
the inhibition of AKT phosphorylation therefore having the reverse effects as above
(94). However, by potentially decreasing myostatin gene expression, this would
suggest a decrease in the inhibitory effects that myostatin would have on the IGF1/PI3K/AKT allowing the initiation of protein synthesis.
Heat Shock Proteins
Heat Shock proteins (HSP’s) have been shown to act as molecular
chaperones facilitating the folding, transportation, and conformational maturation of
newly synthesized proteins (61). The heat shock family of proteins are labeled due
to their molecular mass. In our case we will focus on the 70 kilo-Dalton HSP (i.e.
Heat Shock Protein 70, [HSP70]). It has been proposed that HSP70 is a protective
mechanism against a second damaging bout of exercise. More specifically, smaller
35
HSP’s attempt to transiently stabilize or repair damaged structures, whereas HSP70
assists in the general remodeling processes (107, 138).
Several studies using acute and or chronic aerobic exercise have shown
increases (26, 125) in both mRNA and protein content of HSP70. Using a training
protocol, Liu et al observed progressive increases in HSP70 in the vastus lateralis of
rowers over a four week training period (88). Interestingly HSP70 expression was
found to be dependent on the intensity of the training rather than the volume (87).
Another study demonstrated that all fiber types have elevated levels of HSP70 after
exercise, although type I fibers have the greatest expression (150). Similar to PGC-1
(which will be discussed later), HSP70 has been shown to have affects on skeletal
muscle breakdown. Two studies performed by the same laboratory have shown that
injecting HSP70 plasmids into immobilized rats inhibits FOXO3A activity and
overcomes skeletal muscle loss that was documented in the control group (26, 125).
Therefore due to these inhibitory affects in skeletal muscle of animals and the
increased expression of HSP70 in human skeletal muscle, investigations examining
HSP70’s role in blocking proteolytic gene expression is needed in humans.
In addition it has been elucidated that in old mice the expression of HSP70 is
attenuated compared to that of young. In 2001, old and young rats completed 10
weeks of treadmill running at the same relative intensity. Both groups demonstrated
increases in basal levels of HSP70 compared to non-exercising age-matched
controls. However, the increase in HSP70 was significantly less in the older ‘fast’
skeletal muscles than that of the younger trained rats (103). The inability to express
36
HSP70 may lead to the inability to repair skeletal muscle after exercise. Since there
have been no human investigations on HSP’s in aging human skeletal muscle we
are interested to examine if HSP’s may play a role in maintaining muscle health in
the elderly.
37
Table 2.3 Proteolytic Gene Expression Response to Acute Aerobic Exercise in Young Subjects
Authors
Genes of Interest
Protocol
Biopsies
Results
Coffey et al (20)
Atrogin-1
60 min cycling
70% VO2 max
Pre & 3hr post
↑ Atrogin-1
Harber et al (45) FOXO3A, MuRF-1, Atrogin-1
45 min running
77% VO2 max
Pre, 4, & 24hr post
↑ FOXO3A in Sol @ 24h
↑ MuRF-1 in VL @ 4h
Louis et al (90)
FOXO3A, MuRF-1, Atrogin-1
30 min running
75% VO2 max
Pre, 1, 2, 4, 8,
12, & 24 hr post
↑ FOXO3A @ 1h
↑ MuRF-1 @ 1, 2, & 4h
↑ Atrogin-1 @ 1, 2, & 4h
Urso et al (151)
FOXO1 & 4, MuRF-1, Atrogin-1
60 min cycling
60% VO2 max
Pre, 2, & 5 hr post
↑ MuRF-1 @ 2 & 5h
↑ Atrogin-1 @ 2 & 5h
FOXO3A = Forkhead Box O3, MuRF-1 = Muscle Ring Finger-1
38
Mitochondrial Gene Expression
As we have discussed before chronically performed aerobic exercise (i.e.
aerobic/endurance training) produces a well established adaptation within skeletal
muscle termed mitochondrial biogenesis. Even though this was discovered nearly
three decades ago the molecular mechanisms are only at their infant stages.
Mitochondrial biogenesis requires the co-expression of both nuclear and
mitochondrial mRNA to insure the proper construction of mitochondria (1). One
transcription factor labeled peroxisome proliferator-activated receptor-γ coactivator1α (PGC-1α) has transpired into the master regulator of mitochondrial biogenesis.
Animal research has established that overexpression of PGC-1α can lead to the
induction of both nuclear and mitochondrial proteins (164). In particular PGC-1α can
elevate the levels of mitochondrial transcription factor A (Tfam/mtTFA) which will
trigger an increase in mitochondrial DNA (mtDNA) transcription and replication,
resulting in mitochondrial biogenesis (164). Furthermore, there have been rodent
models demonstrating that overexpression of PGC-1α elevates mRNA of MHC I and
decreases levels of MHC IIx isoform (99). In support, PGC-1α transgenic mice have
also shown a shift from a fast isoform (MHC IIx) to more oxidative myosin heavy
chain isoforms (MHC IIa & MHC I) (86).
Effects of Age on Mitochondrial Gene Expression
Only two studies have investigated potential differences in mitochondrial
mRNA with aging. First, mRNA expression and protein content of Tfam have been
39
reported to be elevated 11- and 2.6-fold in the aged skeletal muscle (71-88 y) (84).
In a study conducted by Short et. al. there was no age related differences in mRNA
levels of PGC-1α or Tfam before or after 16 weeks of aerobic training. Moreover,
independent of age, PGC-1α and Tfam gene expression increased by 55% and 85%
respectively after training (129). The authors concluded that despite the typical agerelated functional decline, skeletal muscle capacity for mitochondrial biogenesis
remains high in older muscle when regimented with regular exercise. As mentioned
earlier, over expression of PGC-1α also acts as an inhibitor of FOXO3A (121). Since
oxidative fibers possess the greatest amount of mitochondria, the PGC-1α
expression may be greater in these fibers compared to more glycolytic fibers.
Therefore, since PGC-1α can inhibit FOXO3A and its downstream atrogenes, these
results may explain why oxidative fibers are more resistant to atrophy compared to
glycolytic fibers in aged skeletal muscle (85). These data suggest that during muscle
wasting (denervation, fasting, sarcopenia, etc.) metabolic changes may be
necessary to attenuate skeletal muscle loss. Evidence from our laboratory purports
there is preferential hypertrophy of type I fibers compared to type II fibers in aging
skeletal muscle before and after training (143, 146). Research is warranted to
determine if PGC-1α and its relationship to inhibit proteolytic transcription factors
mediate the known attenuation of atrophy in type I (oxidative) fibers within human
skeletal muscle.
40
Figure 2.2 Potential pathways regulating muscle hypertrophy after aerobic training.
Adopted from Sandri et al. (121)
Mitochondrial Gene Expression after Aerobic Exercise
Several studies have shown that after acute and chronic bouts of aerobic
exercise PGC-1α gene expression is elevated compared to basal levels (20, 45, 72,
105, 129). Recently a study was the first to reveal the protein content of PGC-1α
was greater immediately after a two hour exhaustive bout of cycling (92). This in line
with the fact that endurance training is known to cause mitochondrial biogenesis and
PGC-1α is a master regulator of this process. This study gives foundation to support
the need for translational research to determine how mRNA affects protein content
in human skeletal muscle.
41
Chapter Summary
Skeletal muscle tissue is a highly organized tissue with a large degree of
malleability in response to contractile activity through the eighth decade of life. Agerelated atrophy (i.e. sarcopenia) is expressed by a decrease in skeletal muscle fiber
number and size, which causes hindered whole muscle function. Regulation of
muscle relies on an elaborate balance between protein synthesis and breakdown
mediated by signals of growth or atrophy which are not simply the mirror image of
each other, but instead each process is regulated through intricate cellular
mechanisms. We know that older individuals are capable of whole muscle
adaptations and cellular alterations in response to resistance exercise training, but
very few have attempted to examine these adaptations after aerobic exercise
training, which is a very common exercise prescription in the elderly.
From the literature we have gathered a handful of questions that have not
been addressed.
1. Skeletal muscle gene expression data related to myogenic and proteolytic
pathways after aerobic exercise training in elderly
2. A comprehensive examination (muscle to gene) of older individuals in
response to a sufficient aerobic training intervention.
3. Identification of protein products related to gene expression that may play
a role in regulating whole muscle and myocellular adaptations.
Chapter III
METHODS
Subjects
Nine older women subjects (70 ± 2 yrs) were recruited from the Greater
Muncie area (Table 4.1). Prior to enrollment, all subjects received a physical
examination that included a medical history, blood chemistry profile, and a resting
and exercise electrocardiogram (ECG). All subjects were sedentary, defined as one
who has not completed aerobic or resistance exercise more than one time per week
for 20 minutes or longer during the previous year. Subjects were included if they
have a body mass index ≤ 35 kg/m 2. We excluded any subject with any acute or
chronic illness, cardiac, pulmonary, liver, or kidney abnormalities, uncontrolled
hypertension, insulin- or non-insulin dependent diabetes or other metabolic
disorders, arthritis, a history of neuromuscular problems, or if they used tobacco.
Experimental Design and Methodology
Each subject completed the experimental protocol over a period of
approximately 15 weeks consisting of several visits to the laboratory. These visits
involved informed consent, a medical history, blood chemistry screening, graded
exercise test, assessment of muscle size (MRI), muscle function testing, muscle
biopsy procedure, and 42 exercise training sessions (3-5 sessions/week for 12
43
weeks) all approved by Ball State University and Ball Memorial Hospital Institutional
Review Boards.
Aerobic Capacity
Subjects performed a physician supervised graded exercise test before and
after the 12-week training period. This also served as a measure for both baseline
and post training aerobic capacity. The test was performed on a cycle ergometer
and began at a very low workload (~50 watts). After a one-minute warm-up at the
initial workload, the workload was progressively increased in one-minute stages until
exhaustion. Additionally, during the test, subjects breathed through a mouthpiece
that allowed room air to be breathed in and expired air to go into a gas analyzer
(TrueOne 2400 Metabolic System, ParvoMedics, Inc.).
Magnetic Resonance Imaging
Proton magnetic resonance (MR) images of the leg were measured before
and after the 12-week training intervention using a General Electric Signa 1.5 Tesla
imaging system at standard settings (TR/TE = 2000/9 ms) as we have previously
described (148). After electronic data transfer, cross-sectional area (CSA)
measurement and calculation were performed using NIH Image J 1.63b. Images
were coded so investigators were blind to the time point associated with each set of
respective images in order to eliminate any biases. Bilateral scans obtained after 1 h
of supine rest to avoid the influence of potential fluid shifts (9). Subjects were
positioned with an adjustable foot restraint for fixation of joint angles and thus,
44
muscle lengths. A standard of 1% CuSO4 was placed along the length of the leg
such that it appears in the field of view of all images to eliminate bias in viewing
images, resulting from day to day variations in the magnetic field and thus, pixel
density. Contiguous, 1 cm interleaved serial scans were obtained from the greater
trochanter of the femur to the articular surface of the tibia, as estimated from frontal
or sagittal scout images. Depending on body stature about 14 to 18 slices were
analyzed per subject. The muscle size measurements were used to assess changes
in whole muscle size in response to the training intervention. Additionally, obtaining
an accurate measure of muscle size allowed us to assess muscle quality by directly
measuring specific force and power (i.e., peak force and power normalized to
muscle size).
Skeletal Muscle Function:
Maximum Voluntary Contraction (MVC) and Concentric Power
Muscle function testing of the knee extensor muscle group was assessed
before and after the 12-week training intervention. Following multiple orientation
sessions to become familiar with the knee extensor devices, subjects performed two
identical sessions of muscle function testing separated by at least two days. All tests
were conducted bilaterally. Muscle function tests allowed us to assess alterations in
whole muscle function in response to the progressive aerobic training intervention.
Peak isometric force and peak power of the knee extensor muscle group was
determined using a novel inertial ergometer (Inertial Technology, Sweden)
connected to a strain gauge load cell and potentiometer interfaced with a personal
45
computer (Gateway E-4200). Isometric force was assessed at a fixed knee joint
angle of 120°. For both assessments, subjects completed three maximal attempts
with three minutes rest between attempts. During the power measurements,
subjects were instructed to give maximum effort (force & velocity) throughout the full
range of motion. The concentric power output was recorded during a 1 repetition
maximal effort throughout the full range of motion.
Skeletal Muscle Biopsy
Before and after the 12-week aerobic training intervention, a muscle biopsy
was obtained from the vastus lateralis of each subject. The post training biopsy
sample occurred 48-72 hours after the last exercise session. Tissue was obtained
following local anesthetic (Lidocaine HCl 1%) using a 5 mm Bergstrom needle with
suction (11). A portion of the muscle was processed for the assessment of single
muscle fiber diameter. The remaining muscle was cleansed of excess blood and fat
and separated. One ~15mg piece was placed in RNAlater and stored at -20° C until
RNA extraction and real time RT-PCR while the other pieces were immediately
frozen and stored in liquid nitrogen.
Aerobic Exercise Training Protocol
Subjects performed 12-weeks of progressive aerobic training on a cycle
ergometer in the Adult Physical Fitness Program’s fitness center. Exercise intensity
was based on the resting heart rate and maximum heart rate achieved during the
graded exercise test (i.e., heart rate reserve [HRR]). A member of our laboratory
46
group supervised each exercise session to insure maintenance of proper exercise
intensity and safety of our subjects. Duration, intensity, and frequency of exercise
were progressively increased throughout the twelve weeks to optimize the training
response. Subjects whom completed the training maintained a 100% attendance
record. Only two subjects did not complete the 12-week training program due to
personal reasons. Table 1 below provides the details of the training intervention.
Table 3.1 Aerobic exercise training program.
Week
Duration
Intensity
(min)
(%HRR)
1
20
60
2
30
60
3
40
60
4
40
70
5
40
75
6
40
75
7
40
75
8
45
80
9
45
80
10
45
80
11
45
80
12
45
80
Frequency
(sessions/week)
3
3
3
3
3
3
4
4
4
4
4
4
HRR = Heart Rate Reserve
Single Muscle Fiber Size
Fiber size was determined from chemically skinned muscle fibers isolated
from muscle biopsy samples before and after training. Both ends of a fiber were
fixed to a force transducer (model 400A; Cambridge Technology, Watertown, MA
and a DC torque motor (model 308B, Cambridge Technology) as previously
described (101). The sarcomere spacing for each muscle fiber was adjusted to 2.5
µm using an eyepiece micrometer. A video camera (Sony) connected to the
microscope and interfaced to a computer allowed viewing on a computer monitor
47
and storage of the digitized image of the muscle fibers. Fiber diameter was
measured at three points along the length of the captured computer image using
public domain software (NIH Image version 1.61). Fiber cross-sectional area (CSA)
was calculated from the mean width with the assumption that the fiber forms a
cylindrical cross-section when suspended in air (97).
Fiber Type Composition
Muscle fiber types were determined by assessing the myosin heavy chain
composition of single muscle fibers using SDS-PAGE combined with silver-staining.
Fibers were solubilized in 80µl of 1% SDS sample buffer (1% SDS, 6 mg/ml EDTA,
0.06 M Tris [pH 6.8], 2 mg/ml bromphenol blue, 15% glycerol, and 5% bmercaptoethanol) and stored at -80° C until assayed. 1µl of the samples were run on
a 3.5% loading gel and a 5% separating gel at 4°C (Hoeffer SE 600 series, San
Francisco, CA) as described previously.
MHC isoforms were identified according to migration rates from the SDSPAGE/silver staining. The MHC was categorized as MHC I, IIa, IIx, I/IIa, I/IIa/IIx, I/IIx,
and IIa/IIx. A subject’s MHC fiber-type was determined from ~100 fibers per biopsy
and the percentages of the total for each MHC are reported.
Separating gel: The 5% separating gel (acrylamide/bis) was poured into a 140
X 160 X 0.75 mm gel cast 4cm from the top of the glass plate. The gel reagents
consisted of 3.75 ml of 1.5 M Tris Buffer (18.17 g Tris base and 4 ml of 10% SDS in
100 ml, pH 8.8, 8.75 ml of 50% glycerol, 0.045 ml of 10% ammonium persulfate
(APS), and 0.015 ml of N, N, N’, N’-tetramethylethylenediamine (TEMED).
48
Stacking Gel: Once the separating gel polymerized, the stacking gel was
poured on top then, the 28-well combs were placed between the glass plates. The
3.5% stacking gel consisted of 3.25 ml of distilled water, .5ml of acrylamide/bis, 1.25
ml of 0.05 M Tris buffer (6.06 g Tris base and 4.0 ml of 10% SDS in 100 ml, pH 6.8),
0.02 ml of 10 APS, and 0.01 ml of TEMED.
Silver stain: After approximately 12 h of electrophoresis, or when the
bromphenol blue was near the bottom of the plates, the electric current was
terminated. The loading gel was discarded and the right corner of the separating gel
was cut off in order to maintain proper orientation. Then the plate, with the gel, was
placed into 250 ml of solution A (alcohol-acid fixing solution) (500 ml ethanol, 100 ml
glacial acetic acid, 400 ml distilled water) for 30 min. The gel was then transferred
into 250 ml of Solution B (gluteraldehyde cross-linking solution) (200 ml of 50%
gluteraldehyde, 800 ml distilled water) for a minimum 30 min. Next the gels
underwent a series of three rinses in distilled water, one rinse per a minimum of 10
minutes. The gel was continuously agitated (modified Thermolyne Roto Mix,
Barnstead, Newington, NH) in a Pyrex glass dish for optimal rinsing and prevention
of gel bonding to the glassware.
The staining began by transferring the gel into solution C (ammonia silver
stain solution) (6ml of 1.14 M AgNO3, 31.5 ml of 90 mM NaOH, 2.1 ml of 14.8 M
NH4OH in 110 ml of distilled water at 4° C) for 6 min while it was agitated. Once
finished, the gel was transferred into distilled water for a series of 2 min rinses with
distilled water for 6 min. The gel was then placed into solution D (citric acidformaldehyde developer) 2.5 ml of 47.6 mM citric Acid, 250 µl of 37% formaldehyde
49
in 10% methanol solution in 500 ml of distilled water) for developing. When the stain
had reached a desired strength, the gel was transferred into a series of 1-min
distilled water rinses for several minutes and then agitated in distilled water for
approximately 3 h. After agitating in distilled water, digital images were captured
using a chemiluminescent imaging system (FluorChem SP, Alpha Innotech). MHC
protein expression distribution was identified according to migration rates of each
single fiber. A subjects MHC fiber-type distribution was determined from the ~100
fibers pre- and post-training. From these fibers, the percentage of the total for each
MHC isoform was represented. This distribution of ~100 fibers acts as one data set
for an individual. This was done for each subject’s fibers, pre- and post-training. Our
mean data were derived from the individual subject data; the individual subject
distributions were added to determine a mean for the group pre and post training.
Gene Expression
Total RNA extraction and RNA quality check. Each muscle sample was
removed from the RNAlater and placed in a mixture of 0.8ml of RNA isolation
reagent, TRI reagent, and 4µl of PolyAcryl Carrier (Molecular Research Center,
Cincinnati, OH). The tissue was homogenized, and total RNA was extracted
according to the manufacturer’s protocol. The RNA pellet was dissolved in 30 µl of
nuclease-free water and stored at -80°C.
One microliter of each total RNA extract (1:3 vol/vol with water) was analyzed
using the RNA 6000 Nano LabChip kit on an Agilent 2100 Bioanalyzer (agilent
Technologies, Palo Alto, CA). This system reported detailed information about
50
quantity and quality (integrity and purity) of the RNA samples. Each RNA sample
was electrophoretically separated into two peaks of 18S and 28S ribosomal RNA.
Data were displayed as gel-like image and/or an electropherogram. Sample
analyses were performed as described by the manufacturer. The high quality of RNA
was confirmed by presence of ribosomal peaks with no additional signals (DNA
contamination or RNA degradation) below the ribosomal bands and no shifts to
lower fragments.
RT and real-time PCR. Oligo(dT) primed first-strand complementary DNA
(cDNA) was synthesized using SuperScript II RT (Invitrogen, Carlsbad, CA)
optimized for sensitive RT-PCR on low amounts of RNA. Quantification of
messenger RNA (mRNA) transcription (in duplicate) was performed in a 72-well
Rotor-Gene 3,000 Centrifugal Real-Time Cycler (Corbett Research, Mortlake, NSW,
Australia). GAPDH was used as a housekeeping gene (HKG) for internal control
after validation (109). All primers used in this study were mRNA specific (on different
exons and/or crossing over an intron) and designed for gene expression real-time
PCR analysis using Vector NTI Advance 9 software (Invitrogen). Primers for MyoD,
myogenin, muscle regulatory factor 4 (MRF4), atrogin-1, muscle-RING-finger
protein-1 (MuRF-1), and forkhead box [FOXO]3A, peroxisome-proliferator-activated
receptor-gamma coactivator 1-α (PGC-1α) have been reported previously by our
laboratory (45, 90, 165).
A melting curve analysis was generated at the end of each real-time PCR
assay. A single-melt peak was observed for each sample, validating that only one
product was present. The presence of PCR inhibitors within our biological samples
51
was assessed using SPUD assay, an artificial amplicon-based Solanun tuberosum
phyB gene of potato root (104). The assay generated CT values (22.5–22.9)
characteristic of an uninhibited SPUD assay showing that no inhibitors were present
in the cDNA generated from the muscle tissue samples in the current study.
Table 3.2 Primer Set sequences and Amplicon Information
Target
mRNA
PCR Primer sequence 5’→3’
F
R
F
R
GGTCCCTCGCGCCCAAAAGATT
CAGTTCTCCCGCCTCTCCTACCTCAA
CAGTGCACTGGAGTTCAGCGCCAA
TTCATCTGGGAAGGCCACAGACACAT
MRF4
F
R
Myostatin
MyoD
Myogenin
Amp.
Size, bp
94
Amp.
Location,
bp
1,1781,271
NCBI
NM_002478
139
599-737
NM_002479
CCCCTTCAGCTACAGACCCAAACAAGAA
CCCCCTGGAATGATCGGAAACAC
100
542-641
NM_002469
F
R
GACCAGGAGAAGATGGGCTGAATCCGTT
GCTCATCACAGTCAAGACCAAAATCCCTT
96
861-956
NM_005259
FOXO3A
F
R
GAACGTGGGGAACTTCACTGGTGCTA
GGTCTGCTTTGCCCACTTCCCCTT
98
2278-2375
NM_201559
Atrogin-1
F
R
TATTGCACCCTGGGGGAAGCTTTCAA
TCCAACAGCCGGACCACGTAGTTAAA
92
481-572
NM_058229
F CTCAGTGTCCATGTCTGGAGGCCGTT
147
328-474
NM_O32588
R GGCCGACTGGAGCACTCCTGTTTGTA
F GGCCCAGGTATGACAGCTACGAGGAA
PGC-1α
R TCAATTGCCTTCTGCCTCTGCCTCTC
F = forward, R = reverse, Amp. = amplicon, mRNA = messenger RNA, PCR = polymerase chain
reaction, NCBI = National Center for Biotechnology Information
MuRF-1
Relative quantification of real-time PCR assay. The gene expression in relation to
muscle and exercise was evaluated by a relative quantification method. To avoid
interassay variability, each real-time PCR run contained samples from experimental
conditions (before and after training).
The data were analyzed using the 2–∆CT methods (89). As described by us
previously (45), to compare the relative gene expression between baseline and
posttraining values. This method generates a value in arbitrary units (AU) of the
52
gene of interest (GOI) expression normalized to the HKG expression ( CT = CTGOI –
CTHKG).
Western Blotting
For each biopsy sample, a piece of muscle ~20mg was weighed on a
precision microbalance at -50° C. Each sample was homogenized using an
electrically powered glass pestel (Polyscience Corp., Niles, IL, USA) in 30 volumes
of cold RIPA buffer (25mM Tris•HCL pH 7.6, 150mM NaCl, 1% sodium
deoxycholate, 0.1% SDS) (Pierce, Rockford, ILUSA) with Halt™ Protease Inhibitor
Cocktail, Halt™ Phosphatase Inhibitor Cocktail and 0.5 M EDTA (Pierce). After
homogenization, samples were spun in a microcentrifuge for 5 min at 1000g. Then
10µl supernatant was aliquotted for determination of protein concentration (BCA
Assay, Pierce) and the remaining aliquots of the homogenate were diluted in SDS
sample buffer and heated to 95° C for 5 min. Proteins (20 µg) were separated with a
12% or 4-20% gradient gel (Pierce) using SDS-PAGE for 90 min at 100 V (Mini
Protean 3 system, Bio-Rad Laboratories, Hercules, CA) and then transferred to
PVDF membrane (Immobilon-P, Millipore, Bedford, MA) for 2 h at 200 mA at 4° C.
The membrane was blocked with 5% milk for 60 min and then incubated with a
human primary antibody (PGC-1α, HSP70, & FOXO3A) at 4° C overnight. Blots
were identified by incubation with horseradish peroxidase-conjugated-secondary
antibody then exposed to an enhanced chemiluminescent substrate (Pierce ECL
Western Blotting Substrate, Rockford, IL & GE Amersham ECL Plus Western
Blotting Detection System). Digital images were captured using a chemiluminescent
53
imaging system (FluorChem SP, Alpha Innotech). Equal protein loading was verified
by Poncea S staining, and sizes of the immunodetected proteins are confirmed by
molecular weight markers (See Blue & Magic Marker, Invitrogen) and an internal
control protein. Both pre and post time points for each subject were analyzed on the
same blot to control for intra-assay variability.
Statistics
Pre- and Post-training values for all variables were analyzed using a paired
two-tailed student’s t-test. Significance was accepted as p < 0.05. All values are
presented as mean ± SE.
Chapter IV
RESULTS
Aerobic Capacity
Graded exercise test results are shown in Table 4.2. Relative VO2 peak
increased (p < 0.05) 31 ± 10% from 16 ± 1 to 20 ± 1 ml/kg/min while absolute VO2
peak increased (p < 0.05) of 29 ± 9% from 1.5 ± 0.8 to 1.9 ± 0.9 L/min. Additionally,
maximum workload during the graded cycle test increased (p < 0.05) 43% (87 ± 9 to
122 ± 10 Watts) with aerobic training.
Whole Muscle Size and Function
Cross-sectional area of the quadriceps femoris increased (p < 0.05) 11 ± 2%
in response to 12-weeks of progressive aerobic training as presented in Table 4.3.
Functional capacity of their knee extensor muscles, measured as MVC and peak
power, improved (p < 0.05) 27% and 29% respectively. In addition, when normalized
to muscle size, both whole muscle specific tension and normalized power were
improved (p < 0.05) after progressive aerobic training by 20 ± 6 and 12 ± 4%,
respectively. Whole muscle function is presented in Figure 4.1 and Table 4.2
55
Single Muscle Fiber MHC Composition
There was an increase (p < 0.05) in MHC I fibers (36 ± 4 to 50 ± 4%) and a
decrease (p < 0.05) in MHC IIa fibers (51 ± 4 to 39 ± 5%) with progressive aerobic
training. There was no change between the total MHC hybrid fibers profile (13 ± 2 to
12 ± 3%). (Figure 4.2.)
Single Muscle Fiber Size
Single muscle fiber CSA is shown in Table 4.3. MHC I fibers increased (p <
0.05) by 16% after aerobic training. Although not significant, MHC IIa CSA was 21%
greater (p = 0.19) after training.
Basal Gene Expression
A comprehensive illustration of skeletal muscle transcription factors is
depicted in Figure 4.3. Resting levels of myogenic gene MRF4 was decreased (p <
0.05) 25% and myogenin trended to decrease (p = 0.09) 10% after training. For the
proteolytic genes, FOXO3A was lower (27%, p < 0.05) while atrogin-1 and MuRF-1
were unaltered by training. Myostatin gene expression was decreased (p < 0.05)
57% after completion of the aerobic training program (Figure 4.4). Mitochondrial
gene transcripts, PGC-1α and TFAM were not statistically altered due to the training
intervention.
56
Protein Expression
There were no changes in the protein content of HSP70 or FOXO3A after
twelve weeks of progressive aerobic training in elderly women. Basal levels of PGC1α protein decreased (p< 0.05, n=8) after the training intervention. Results are
shown in Figures 4.5 – 4.7.
57
Table 4.1 Subject Characteristics
PRE
POST
Number
9
9
Age (yr)
71 ± 2
71 ± 2
Weight (kg)
67 ± 4
67 ± 4
BMI (kg∙m-2)
25 ± 2
25 ± 2
FFM (kg)
39 ± 1
40 ± 1*
41 ± 3%
40 ± 3%*
% Fat
All values are presented in mean ± SE, * p < 0.05
58
Table 4.2 Whole Body Functional Parameters
PRE
POST*
%∆
Max Heart Rate
154 ± 5
156 ± 5
1%
VO2 Peak (ml∙kg-1∙min-1)
16 ± 1
20 ± 1*
29%
Maximum Workload (Watts)
87 ± 9
122 ± 10*
43%
Isometric Force (Nm)
247 ± 34
301 ± 35*
28%
Specific Force (Nm∙cm-2)
5.9 ± 0.8
6.9 ± 0.8*
20%
Peak Power (Watts)
273 ± 49
328 ± 50*
25%
Normalized Power (Watts∙L-1)
466 ± 70
508 ± 68*
12%
Graded Exercise Test
Whole Muscle Knee Extension Function
All values are presented in mean ± SE * p < 0.05 vs. pre
59
40
*
Percent Change
35
*
30
*
25
20
*
15
10
5
0
MVC (Nm)
Specific Tension
(Nm/cm2)
Peak Power
(Watts)
Normalized
Power (Watts/L)
Figure 4.1 Percent change in whole muscle knee extensor function before and after 12 weeks of
progressive aerobic exercise training. Values are means ± SE. * p < 0.05
60
60
*
*
PRE
Fiber Type (%)
50
POST
40
30
20
10
0
I
I/IIa
IIa
IIa/IIx
IIx
Hybrids
Figure 4.2 MHC distributions before and after 12 weeks of progressive aerobic training.
Values are means ± SE. * p < 0.05 vs. pre
61
Table 4.3 CSA of the Quadriceps Femoris and Single Fibers in the Vastus Lateralis
Whole Muscle (cm2)
MHC I (µm2)
MHC IIa (µm2)
Pre
40 ± 3
5638 ± 361
4154 ± 469
Post
44 ± 3*
6498 ± 475*
4874 ± 626†
All values are presented in mean ± SE * p < 0.05 vs. pre, † p = 0.19
62
Myogenic
Proteolytic
Atrogin-1 MuRF-1 FOXO3A
0
MyoD
Myogenin
Mitochondrial
MRF4
PGC-1α
TFAM
Myostatin
Percent Change
-10
†
-20
-30
*
*
-40
-50
-60
*
Figure 4.3 Percent change of basal gene expression after 12 weeks of progressive aerobic training.
All values are means ± SE. *p < 0.05 vs. pre, † p < 0.10
63
Arbitrary Units
4
3
*
2
1
0
Pre
Post
Myostatin
Figure 4.4 Myostatin mRNA expression before and after 12 weeks of progressive aerobic
training. Values are presented mean ± SE. * p < 0.05 vs. pre
64
mRNA
B
75
1.5
*
60
Arbitrary Units
Arbitrary Units
A
Protein
45
30
15
0
1.0
0.5
0.0
Pre
Post
FOXO3A
Pre
Post
FOXO3A
Figure 4.5 FOXO3A mRNA (A) and protein levels (B) before and after 12 weeks of progressive aerobic training.
Values are presented mean ± SE. * p < 0.05 vs. pre.
65
mRNA
A
Protein
B
6
Arbitrary Units
Arbitrary Units
8
4
2
0
1.25
*
1.00
0.75
0.50
0.25
0.00
Pre
Post
PGC-1α
Pre
Post
PGC-1α
Figure 4.6 PGC1-α mRNA (A) and protein levels (B) before and after 12 weeks of progressive aerobic training.
Values are presented mean ± SE. * p < 0.05 vs. pre.
66
Arbitrary Units
1.5
1.0
0.5
0.0
Pre
Post
HSP70
Figure 4.7 HSP70 protein levels before and after 12 weeks of progressive aerobic training.
Values are presented mean ± SE. * p < 0.05 vs. pre
Chapter V
DISCUSSION
Introduction
The focal point of this investigation was to examine the cellular factors within
skeletal muscle that are associated with improvements of skeletal muscle size,
function, and aerobic capacity after an aerobic training intervention in elderly
women. To accomplish this endeavor, we examined women before and after 12
weeks of progressive aerobic training on a stationary cycle ergometer. In addition to
the improvements of whole muscle size, function, and aerobic capacity, the main
findings from this investigation are that aerobic training 1) shifts muscle fiber type
distribution towards a more oxidative phenotype, 2) increases type I fiber size, 3)
reduces basal FOXO3A and myostatin gene expression and 4) reduces PGC-1α
protein expression. These alterations in the mechanistic parameters facilitate the
explanation of the remarkable improvements in whole muscle size and function in
elderly women. Collectively, these data suggest progressive aerobic cycle training
may be used as a novel and effective intervention to combat the age-related loss of
functionality.
68
Aerobic Capacity
As hypothesized, we observed a substantial improvement in maximal aerobic
capacity by 30%. A comprehensive review of adaptations in response to aerobic
exercise (77) demonstrates that improvements in aerobic capacity of greater than
20% are typical when training programs demand intensities greater than 80% VO 2
max for durations greater than 40 minutes, as was prescribed in the current study.
Moreover, an investigation using similar subjects and high intensity cycle training
program found a 38% increase in aerobic capacity, supporting the results of our
study. Other investigations exploring muscle size and function with aerobic training
in older individuals have not reported improvements in aerobic capacity greater than
16% (24, 33, 128, 154, 157). This can be rationalized due to the subject population
(obese, overweight (33, 157), type 2 diabetes (24) or regularly exercising individuals
(154)) which may potentially limit adaptations. Another critical attribute of our
investigation is the intensity was based on heart rate reserve rather than the
traditional peak heart rate. Heart rate reserve is a stronger correlate to VO2 max
(159) and creates a more challenging intensity to maintain over the whole duration of
the exercise bout. Therefore, our study demonstrated that elderly subjects can
exercise at very high intensities and could be one reason for the robust
improvements.
Whole Muscle Size & Function
To examine the influence of aerobic training on muscle size in the elderly, we
examined the quadriceps muscles, pre- and post-training using MRI analysis. We
69
established that a progressive aerobic training intervention with sufficient intensity
and duration can stimulate an increase in cross-sectional area of the quadriceps
muscle group. This is the first study to demonstrate hypertrophy at the whole muscle
level from an aerobic training program in elderly subjects. Our robust increases in
muscle size may also partially explain why we witnessed the sizeable improvements
in absolute aerobic capacity (VO2 max) within the present study. However, when
aerobic capacity is expressed relative to body weight, we also observed
considerable improvements suggesting central adaptations and or increased
oxidative capacity of skeletal muscle also occurred in response to the training
program.
In addition to muscle size, our subjects also experienced extensive
improvements in muscle function. When testing for maximal voluntary contraction
(MVC) the elderly women improved 28 ± 8%. Only one other study demonstrated
increases in isometric torque. Verney et. al. (154) reported 13% improvements in
isometric torque following 14 weeks of intermittent high intensity cycle ergometry in
elderly subjects. Peak power, unlike MVC, incorporates dynamic muscle strength
combined with contraction velocity. These two parameters are often used as a
predictor of functional status in older individuals because the combination is a
stronger determinant of mobility than muscle strength alone (7, 35). Our
investigation demonstrated an increase in the knee extensor concentric peak power
production of 25 ± 4%. This is the first investigation to directly report knee extensor
power production before and after aerobic training in the elderly. The same study as
70
highlighted above conducted by Verney et. al. (154) presents an increase in peak
isokinetic torque at varying speeds, indicating the potential for increased peak
power. Improvements in MVC and peak power are critical measures to determine
the functional capacity of aging individuals. The independence of an aging individual
depends on their ability to function properly and more specifically, the muscles ability
support an active lifestyle. Thus, our study purports that aerobic exercise can
increase functional capacity in elderly women, therefore increasing their ability to
maintain an independent and healthy lifestyle.
The large improvements in muscle size and function contend with the
hypertrophy and increase in function that has been documented by resistance
training programs using similar subject populations (81, 111, 145). When comparing
aerobic training studies, our investigation provided the greatest workload and
duration per exercise bout, therefore creating greater time under tension. From this
large amount of time under tension of the quadriceps muscle we were able to report
astonishing adaptations at the whole muscle level. When using sedentary elderly
women, a proper aerobic training program can yield substantial improvements in
whole muscle size and function, while concomitantly improving aerobic capacity, in
addition to the known cardiovascular and metabolic health benefits. Therefore an
aerobic training intervention as an exercise prescription may provide the most
dynamic benefits to maintain healthy living and combat the debilitating effects of
sarcopenia in sedentary elderly individuals.
71
Fiber Type Distribution and Myofiber Size
One of the many adaptations to aerobic exercise training that occurred in our
investigation was a shift of fiber type distribution to an oxidative phenotype. We
reported an increase of MHC I fibers from 36 ± 4 to 50 ± 4% and a decrease in type
IIa fibers from 51 ± 4 to 39 ± 5%. In addition there were no changes in the
percentage of hybrid fibers before and after training. Therefore, the transformation in
fiber type distribution can be accounted for by a reallocation of fibers from MHC IIa
=> MHC I/IIa => MHC I fibers. One investigation examined the mRNA and protein
expression of MHC isoforms in muscle homogenates after aerobic training in men
and women ages 21-87 years old. They reported that independent of age MHC I and
IIa mRNA increased whereas MHC IIx mRNA decreased. In aging subjects, the
MHC I, IIa, and IIx protein expression did not change despite the large alterations
seen in mRNA expression (127). These data suggest there may be age related
inhibition of protein translation compared to their younger counterparts. Additionally,
Coggan et. al (22) reported no change in the percentage of type I fibers after 9-12
months of regular exercise in men and women between 60-70 years old. However,
modifications in this investigation came from an increase in percentage of type IIa
and a decrease in type IIb fibers. These differences in Coggan’s study compared to
our investigation could potentially be explained by different fiber type analysis,
muscle of interest, and training program.
Additionally, in the current study the cross sectional area (CSA) of type I
fibers increased by 16% and although type IIa fibers failed to reach significance
72
these fibers were 21% larger after training. Again, the investigation by Coggan et al.
(22) observed increases in CSA by 12 and 10% in both Type I and Type IIa fibers
respectively, thus supporting the results from the present study. Regardless of the
differences across investigations, all evidence suggests skeletal muscle of older
individuals can adapt to aerobic training at the myocellular level, which contribute to
the increases in CSA at the whole muscle level. Collectively, the fiber type
distribution and myofiber size data indicate that progressive aerobic training primarily
targeted type I fibers. Trappe and colleagues (142, 143) reported that in response to
resistance training in old women, most of the adaptations occurred in the type I
fibers as well. Since similar adaptations have occurred in response to both aerobic
and resistance training interventions, conceivably there is an age-related response
where old women may have these specific adaptations to optimize function.
Basal Gene Expression
Molecular adaptations to aerobic exercise for either young or old subjects are
nearly absent from the literature. To our knowledge, this is the first study illustrating
basal adaptations of transcription factors that regulate skeletal muscle growth after a
progressive aerobic training study in elderly individuals.
The first portion of the mRNA alterations is focused on the proteolytic
transcripts and the negative regulator of growth myostatin. Basal levels of FOXO3A
and myostatin decreased 27% and 57% respectively. Traditionally, acute aerobic
exercise up-regulates factors in the proteolytic spectrum (FOXO3A, atrogin-1,
MuRF-1) potentially promoting the known protein turnover associated with aerobic
73
exercise. In response to acute aerobic exercise, myostatin gene expression is
divergent depending on investigation (20, 45, 151). However, our laboratory has
demonstrated during recovery from running, myostatin is reduced in three different
muscles (gastrocnemius, soleus, & vastus lateralis) (45, 90). Albeit these protocols
examining myostatin were using acute exercise and young subjects, these data
support the results of the current training study. Since no other aerobic training
investigation exists, we are limited in comparing our alterations in basal gene
expression with that of a resistance training program. Accordingly, Raue et al. (109,
110) has conducted a series of investigations from our laboratory studying very old
individuals (80+ yrs) and reported greater basal levels of FOXO3A, MuRF-1 and
myostatin than their young counterparts. These women were unable to decrease
basal levels of both FOXO3A and myostatin mRNA after resistance training and also
did not experience hypertrophy.
Moreover, the young group was capable of
reducing the expression of FOXO3A and myostatin and consequently experienced
hypertrophy. Therefore the inability to reduce these transcripts has been proposed to
be a mechanism obstructing hypertrophy in very old women. Again a similar pattern
is witnessed within our current study. Subjects were able to reduce both FOXO3A
and myostatin gene expression supporting the rationale that these transcripts
potentially regulate the hypertrophy observed in the current study.
With regards to the myogenic genes, MRF4 decreased and myogenin trended
to decrease after progressive aerobic training. Both MRF4 and myogenin have been
proposed to play an integral role in the differentiation of myoblasts to muscle fibers
74
(17). Animals whose MRF4 and myogenin have been eliminated have shown paucity
of muscle fibers (17). Interestingly, basal levels of MyoD, MRF4 and myogenin have
been shown to be elevated in old subjects in attempts to offset the muscle loss seen
in sarcopenic muscle (64, 109, 158). After a resistance training program, no changes
were observed in old men and women (64±1y) for MRF4, but there were elevated
levels of MyoD and Myogenin with training (69). The decrease in myogenic mRNA
(MRF4 and myogenin) in our study could potentially be linked to diminished
proteolytic machinery. Thus, there may be less need for MRF4 and myogenin to
offset the muscle atrophy that is regulated by FOXO3A and myostatin gene
expression.
In addition to its role in the myogenic lineage, myogenin overexpression also
has been proposed to increase oxidative enzymes in skeletal muscle (51).
Interestingly, after aerobic exercise training in elderly women we have seen a trend
for a diminished myogenin gene expression suggesting marginal adaptations in
skeletal muscle oxidative capacity. Supporting these results, we observed no
changes in basal gene expression of mitochondrial transcription factors Tfam or
PGC-1α. These results are contrary to the changes in mitochondrial genes we
hypothesized, as we believed a vigorous aerobic training regimen would enhance
transcripts involved in mitochondrial biogenesis. Also, other investigations using a
similar age group have shown increases in both Tfam and PGC-1α (129). However,
our subjects may have different cellular adaptations due to the sizeable amount of
75
muscle hypertrophy as well as the training program being four weeks less than the
present study.
Protein Expression
The final data point within this thesis relates to the content of specific proteins
that have been suggested to play functional roles in regulating skeletal muscle
adaptations. We measured total protein expression of FOXO3A, HSP70, and PGC1α, as these factors are implicated in the regulation of muscle mass and or muscle
oxidative capacity and therefore are likely targets of aerobic training.
Despite reductions in FOXO3A mRNA we reported no change in FOXO3A
total protein expression. Generally, investigators have assumed alterations in mRNA
expression represent a new demand placed on the cell for the corresponding
protein. However, to our knowledge few laboratories have truly solidified these
assumptions in human skeletal muscle after acute or chronic exercise (6, 69).
Therefore this is the first study to investigate the basal levels of FOXO3A protein and
mRNA after aerobic training. We found that although there were no statistical
differences, FOXO3A protein decreased by 8%. The marginal decrease in FOXO3A
protein expression was associated with the coinciding decrease in FOXO3A mRNA.
The evident decrease in the FOXO3A mRNA and its functional protein indicates
reductions in this catabolic pathway and suggest likely mechanisms underlying
muscle hypertrophy observed after aerobic training in elderly women.
We measured HSP70 as it has recently been implicated in attenuating
FOXO3A signaling and preventing skeletal muscle atrophy in mouse models (26,
76
125). Additionally, it is responsive to acute aerobic exercise in young subjects (62).
Also, when comparing the HSP70 basal levels in aerobically trained and untrained
young subjects using a cross sectional design there is no difference in expression
(100). Similarly, we observed no change in the basal expression of HSP70 before
and after 12 weeks of aerobic training in elderly women. Our study is supported by
data reporting that elderly mice have attenuated (103, 153) levels of HSP70 in
response to exercise training. Lastly, it appears that reductions in FOXO3A gene
expression are not related to HSP70 protein expression within skeletal muscle of old
women.
The last protein that we examined was PGC-1α, which is a master regulator
of mitochondrial biogenesis and has been implicated in reducing muscle protein
breakdown by attenuating FOXO3A signaling (121). Interestingly, we observed a
20% reduction in PGC-1α protein after training in our elderly women.
A recent
investigation reported that PGC-1α protein is increased directly after an acute
aerobic exercise bout in recreationally active young men (92). Additionally, acute
and chronic aerobic exercise has been shown to increase PGC-1α protein in mouse
(5, 135) and human (117) models, therefore, many researchers believe the increase
in PGC-1α is integral for controlling exercise induced mitochondrial biogenesis (53).
However, there are limited data related to PGC-1α protein in older subjects. A crosssectional investigation examining sedentary and trained young and old (59-76y)
individuals demonstrated that trained individuals have elevated levels of PGC-1α
compared to sedentary (72). Consequently, we hypothesized elderly women would
77
also increase PGC-1α with training. Our findings may differ from the previous study
for several reasons. Lanza et al. (72) conducted a cross sectional study, thus the
trained subjects had been exercising six days per week for four years where as our
subjects trained 12-weeks with nearly half the frequency. Most likely due to their
exercise history, the trained group had vastly different subject characteristics (fat
free mass, % body fat and age) compared to our study creating divergent
environments for adaptations to occur. Moreover, our stimulus was unique because
we induced muscle hypertrophy and aerobic capacity.
Also, since no statistical
changes were observed in PGC-1α mRNA this suggests that in humans, elevated
PGC-1α levels are not responsible for the observed decrease in FOXO3A mRNA, as
was demonstrated in animal models (121). Furthermore, recent research has
revealed that PGC-1α is not required to elicit adaptations of mitochondrial proteins in
response to endurance exercise (76). These data suggest there may be alternate
pathways to increase proteins in the mitochondria responsible for enhancing skeletal
muscle oxidative capacity. The decrease in PGC-1α protein is uncharacteristic of
aerobic training protocols and is potentially related to the effects of the observed
muscle hypertrophy or a mitochondrial dysfunction with aging. Further research is
warranted to determine various effects of exercise training on PGC-1α and oxidative
capacity in aging skeletal muscle.
78
Conclusion
We are the first to show that a progressive aerobic training intervention
performed on a cycle ergometer is an exercise modality that induces improvements
of muscle mass, strength and aerobic capacity in older women. Also, we were able
to provide descriptive evidence of the molecular alterations that may mediate the
muscle hypertrophy observed after training in elderly women. Further research is
warranted to compare the observed results in elderly women to either a young group
or a group of elderly men. This would allow us to determine if there are any gender
specific responses or how the aging process influences adaptations at the whole
muscle and cellular level. Additionally, there is need to examine the process of
mitochondrial biogenesis in order to gain insight on the age-related effects on
oxidative capacity and or mitochondrial function. Our study substantiated that
aerobic exercise training is an exceptional method to improve skeletal muscle size
and function, thereby combating the deleterious effects of sarcopenia while providing
cardiovascular and metabolic health benefits. Therefore an aerobic training
intervention may provide the most comprehensive exercise prescription to attain
healthy living and combat the debilitating effects of sarcopenia in sedentary elderly
individuals
79
References
1.
Adhihetty PJ, Irrcher I, Joseph AM, Ljubicic V, and Hood DA. Plasticity of
skeletal muscle mitochondria in response to contractile activity. Exp Physiol 88: 99107, 2003.
2.
Alkner BA, and Tesch PA. Knee extensor and plantar flexor muscle size and
function following 90 days of bed rest with or without resistance exercise. Eur J Appl
Physiol 93: 294-305, 2004.
3.
Alway SE, Coggan AR, Sproul MS, Abduljalil AM, and Robitaille PM.
Muscle torque in young and older untrained and endurance-trained men. J Gerontol
A Biol Sci Med Sci 51: B195-201, 1996.
4.
Atherton PJ, Babraj J, Smith K, Singh J, Rennie MJ, and Wackerhage H.
Selective activation of AMPK-PGC-1alpha or PKB-TSC2-mTOR signaling can
explain specific adaptive responses to endurance or resistance training-like electrical
muscle stimulation. FASEB J 19: 786-788, 2005.
5.
Baar K, Wende AR, Jones TE, Marison M, Nolte LA, Chen M, Kelly DP,
and Holloszy JO. Adaptations of skeletal muscle to exercise: rapid increase in the
transcriptional coactivator PGC-1. FASEB J 16: 1879-1886, 2002.
6.
Bamman MM, Ragan RC, Kim JS, Cross JM, Hill VJ, Tuggle SC, and
Allman RM. Myogenic protein expression before and after resistance loading in 26and 64-yr-old men and women. J Appl Physiol 97: 1329-1337, 2004.
7.
Bassey EJ, Fiatarone MA, O'Neill EF, Kelly M, Evans WJ, and Lipsitz LA.
Leg extensor power and functional performance in very old men and women. Clin
Sci (Lond) 82: 321-327, 1992.
8.
Baumann AP, Ibebunjo C, Grasser WA, and Paralkar VM. Myostatin
expression in age and denervation-induced skeletal muscle atrophy. J
Musculoskelet Neuronal Interact 3: 8-16, 2003.
9.
Berg HE, Tedner B, and Tesch PA. Changes in lower limb muscle crosssectional area and tissue fluid volume after transition from standing to supine. Acta
Physiol Scand 148: 379-385, 1993.
10.
Bergstrom DA, Penn BH, Strand A, Perry RL, Rudnicki MA, and Tapscott
SJ. Promoter-specific regulation of MyoD binding and signal transduction cooperate
to pattern gene expression. Mol Cell 9: 587-600, 2002.
11.
Bergstrom J. Muscle electrolytes in man. . Scand J Clin Lab Invest Suppl 68:
1-110, 1962.
12.
Berkes CA, and Tapscott SJ. MyoD and the transcriptional control of
myogenesis. Semin Cell Dev Biol 16: 585-595, 2005.
13.
Bodine SC, Latres E, Baumhueter S, Lai VK, Nunez L, Clarke BA,
Poueymirou WT, Panaro FJ, Na E, Dharmarajan K, Pan ZQ, Valenzuela DM,
DeChiara TM, Stitt TN, Yancopoulos GD, and Glass DJ. Identification of ubiquitin
ligases required for skeletal muscle atrophy. Science 294: 1704-1708, 2001.
14.
Bolster DR, Kimball SR, and Jefferson LS. Translational control
mechanisms modulate skeletal muscle gene expression during hypertrophy. Exerc
Sport Sci Rev 31: 111-116, 2003.
80
15.
Boonsong T, Norton L, Chokkalingam K, Jewell K, Macdonald I, Bennett
A, and Tsintzas K. Effect of exercise and insulin on SREBP-1c expression in
human skeletal muscle: potential roles for the ERK1/2 and Akt signalling pathways.
Biochem Soc Trans 35: 1310-1311, 2007.
16.
Bottinelli R, Pellegrino MA, Canepari M, Rossi R, and Reggiani C.
Specific contributions of various muscle fibre types to human muscle performance:
an in vitro study. J Electromyogr Kinesiol 9: 87-95, 1999.
17.
Charge SB, and Rudnicki MA. Cellular and molecular regulation of muscle
regeneration. Physiol Rev 84: 209-238, 2004.
18.
Close R. Properties of motor units in fast and slow skeletal muscles of the rat.
J Physiol 193: 45-55, 1967.
19.
Coffey VG, and Hawley JA. The molecular bases of training adaptation.
Sports Med 37: 737-763, 2007.
20.
Coffey VG, Shield A, Canny BJ, Carey KA, Cameron-Smith D, and
Hawley JA. Interaction of contractile activity and training history on mRNA
abundance in skeletal muscle from trained athletes. Am J Physiol Endocrinol Metab
290: E849-855, 2006.
21.
Coffey VG, Zhong Z, Shield A, Canny BJ, Chibalin AV, Zierath JR, and
Hawley JA. Early signaling responses to divergent exercise stimuli in skeletal
muscle from well-trained humans. FASEB J 20: 190-192, 2006.
22.
Coggan AR, Spina RJ, King DS, Rogers MA, Brown M, Nemeth PM, and
Holloszy JO. Skeletal muscle adaptations to endurance training in 60- to 70-yr-old
men and women. J Appl Physiol 72: 1780-1786, 1992.
23.
Coggan AR, Spina RJ, Rogers MA, King DS, Brown M, Nemeth PM, and
Holloszy JO. Histochemical and enzymatic characteristics of skeletal muscle in
master athletes. J Appl Physiol 68: 1896-1901, 1990.
24.
Cuff DJ, Meneilly GS, Martin A, Ignaszewski A, Tildesley HD, and
Frohlich JJ. Effective exercise modality to reduce insulin resistance in women with
type 2 diabetes. Diabetes Care 26: 2977-2982, 2003.
25.
Davis RL, Weintraub H, and Lassar AB. Expression of a single transfected
cDNA converts fibroblasts to myoblasts. Cell 51: 987-1000, 1987.
26.
Dodd S, Hain B, and Judge A. Hsp70 prevents disuse muscle atrophy in
senescent rats. Biogerontology 2008.
27.
Doherty TJ. Invited review: Aging and sarcopenia. J Appl Physiol 95: 17171727, 2003.
28.
Douglass M. Age and Muscle Function: Impact of Aerobic Exercise. In:
Human Performance Laboratory. Muncie: Ball State University, 2008.
29.
Eccles JC, and Sherrigton CS. Numbers and contraction values of
individual motor units examined in some muscles of the limb. Proc R Soc 106: 326357, 1930.
30.
Ehsani AA, Spina RJ, Peterson LR, Rinder MR, Glover KL, Villareal DT,
Binder EF, and Holloszy JO. Attenuation of cardiovascular adaptations to exercise
in frail octogenarians. J Appl Physiol 95: 1781-1788, 2003.
81
31.
Eliasson J, Elfegoun T, Nilsson J, Kohnke R, Ekblom B, and Blomstrand
E. Maximal lengthening contractions increase p70 S6 kinase phosphorylation in
human skeletal muscle in the absence of nutritional supply. Am J Physiol Endocrinol
Metab 291: E1197-1205, 2006.
32.
Enoka RM, and Fuglevand AJ. Motor unit physiology: some unresolved
issues. Muscle Nerve 24: 4-17, 2001.
33.
Ferrara CM, Goldberg AP, Ortmeyer HK, and Ryan AS. Effects of aerobic
and resistive exercise training on glucose disposal and skeletal muscle metabolism
in older men. J Gerontol A Biol Sci Med Sci 61: 480-487, 2006.
34.
Fiatarone MA, O'Neill EF, Ryan ND, Clements KM, Solares GR, Nelson
ME, Roberts SB, Kehayias JJ, Lipsitz LA, and Evans WJ. Exercise training and
nutritional supplementation for physical frailty in very elderly people. N Engl J Med
330: 1769-1775, 1994.
35.
Foldvari M, Clark M, Laviolette LC, Bernstein MA, Kaliton D, Castaneda
C, Pu CT, Hausdorff JM, Fielding RA, and Singh MA. Association of muscle
power with functional status in community-dwelling elderly women. J Gerontol A Biol
Sci Med Sci 55: M192-199, 2000.
36.
Frosig C, Rose AJ, Treebak JT, Kiens B, Richter EA, and Wojtaszewski
JF. Effects of endurance exercise training on insulin signaling in human skeletal
muscle: interactions at the level of phosphatidylinositol 3-kinase, Akt, and AS160.
Diabetes 56: 2093-2102, 2007.
37.
Funai K, Parkington JD, Carambula S, and Fielding RA. Age-associated
decrease in contraction-induced activation of downstream targets of Akt/mTor
signaling in skeletal muscle. Am J Physiol Regul Integr Comp Physiol 290: R10801086, 2006.
38.
Glass DJ. Skeletal muscle hypertrophy and atrophy signaling pathways. Int J
Biochem Cell Biol 37: 1974-1984, 2005.
39.
Glickman MH, and Ciechanover A. The ubiquitin-proteasome proteolytic
pathway: destruction for the sake of construction. Physiol Rev 82: 373-428, 2002.
40.
Gollnick PD, Armstrong RB, Saltin B, Saubert CWt, Sembrowich WL,
and Shepherd RE. Effect of training on enzyme activity and fiber composition of
human skeletal muscle. J Appl Physiol 34: 107-111, 1973.
41.
Gomes MD, Lecker SH, Jagoe RT, Navon A, and Goldberg AL. Atrogin-1,
a muscle-specific F-box protein highly expressed during muscle atrophy. Proc Natl
Acad Sci U S A 98: 14440-14445, 2001.
42.
Haddad F, and Adams GR. Aging-sensitive cellular and molecular
mechanisms associated with skeletal muscle hypertrophy. J Appl Physiol 100: 11881203, 2006.
43.
Hameed M, Orrell RW, Cobbold M, Goldspink G, and Harridge SD.
Expression of IGF-I splice variants in young and old human skeletal muscle after
high resistance exercise. J Physiol 547: 247-254, 2003.
44.
Harber M, and Trappe S. Single muscle fiber contractile properties of young
competitive distance runners. J Appl Physiol 105: 629-636, 2008.
82
45.
Harber MP, Crane JD, Dickinson JM, Jemiolo B, Raue U, Trappe TA, and
Trappe SW. Protein Synthesis and the Expression of Growth Related Genes are
Altered by Running in Human Vastus Lateralis and Soleus Muscles. Am J Physiol
Regul Integr Comp Physiol 2008.
46.
Harber MP, Gallagher PM, Creer AR, Minchev KM, and Trappe SW. Single
muscle fiber contractile properties during a competitive season in male runners. Am
J Physiol Regul Integr Comp Physiol 287: R1124-1131, 2004.
47.
Harber MP, Gallagher PM, Trautmann J, and Trappe SW. Myosin heavy
chain composition of single muscle fibers in male distance runners. Int J Sports Med
23: 484-488, 2002.
48.
Haykowsky M, Vonder Muhll I, Ezekowitz J, and Armstrong P. Supervised
exercise training improves aerobic capacity and muscle strength in older women
with heart failure. Can J Cardiol 21: 1277-1280, 2005.
49.
Hepple RT, Mackinnon SL, Goodman JM, Thomas SG, and Plyley MJ.
Resistance and aerobic training in older men: effects on VO2peak and the capillary
supply to skeletal muscle. J Appl Physiol 82: 1305-1310, 1997.
50.
Hershko A, and Ciechanover A. The ubiquitin system. Annu Rev Biochem
67: 425-479, 1998.
51.
Hughes SM, Chi MM, Lowry OH, and Gundersen K. Myogenin induces a
shift of enzyme activity from glycolytic to oxidative metabolism in muscles of
transgenic mice. J Cell Biol 145: 633-642, 1999.
52.
Hulmi JJ, Ahtiainen JP, Kaasalainen T, Pollanen E, Hakkinen K, Alen M,
Selanne H, Kovanen V, and Mero AA. Postexercise myostatin and activin IIb
mRNA levels: effects of strength training. Med Sci Sports Exerc 39: 289-297, 2007.
53.
Irrcher I, Adhihetty PJ, Joseph AM, Ljubicic V, and Hood DA. Regulation
of mitochondrial biogenesis in muscle by endurance exercise. Sports Med 33: 783793, 2003.
54.
Izquierdo M, Ibanez J, Hakkinen K, Kraemer WJ, Ruesta M, and
Gorostiaga EM. Maximal strength and power, muscle mass, endurance and serum
hormones in weightlifters and road cyclists. J Sports Sci 22: 465-478, 2004.
55.
Janssen I, Shepard DS, Katzmarzyk PT, and Roubenoff R. The healthcare
costs of sarcopenia in the United States. J Am Geriatr Soc 52: 80-85, 2004.
56.
Jones SW, Hill RJ, Krasney PA, O'Conner B, Peirce N, and Greenhaff PL.
Disuse atrophy and exercise rehabilitation in humans profoundly affects the
expression of genes associated with the regulation of skeletal muscle mass. FASEB
J 18: 1025-1027, 2004.
57.
Jubrias SA, Esselman PC, Price LB, Cress ME, and Conley KE. Large
energetic adaptations of elderly muscle to resistance and endurance training. J Appl
Physiol 90: 1663-1670, 2001.
58.
Kadi F, Johansson F, Johansson R, Sjostrom M, and Henriksson J.
Effects of one bout of endurance exercise on the expression of myogenin in human
quadriceps muscle. Histochem Cell Biol 121: 329-334, 2004.
59.
Kawamura Y, O'Brien P, Okazaki H, and Dyck PJ. Lumbar motoneurons of
man II: the number and diameter distribution of large- and intermediate-diameter
83
cytons in "motoneuron columns" of spinal cord of man. J Neuropathol Exp Neurol
36: 861-870, 1977.
60.
Kawamura Y, Okazaki H, O'Brien PC, and Dych PJ. Lumbar motoneurons
of man: I) number and diameter histogram of alpha and gamma axons of ventral
root. J Neuropathol Exp Neurol 36: 853-860, 1977.
61.
Kayani AC, Morton JP, and McArdle A. The exercise-induced stress
response in skeletal muscle: failure during aging. Appl Physiol Nutr Metab 33: 10331041, 2008.
62.
Khassaf M, Child RB, McArdle A, Brodie DA, Esanu C, and Jackson MJ.
Time course of responses of human skeletal muscle to oxidative stress induced by
nondamaging exercise. J Appl Physiol 90: 1031-1035, 2001.
63.
Kim JS, Cross JM, and Bamman MM. Impact of resistance loading on
myostatin expression and cell cycle regulation in young and older men and women.
Am J Physiol Endocrinol Metab 288: E1110-1119, 2005.
64.
Kim JS, Kosek DJ, Petrella JK, Cross JM, and Bamman MM. Resting and
load-induced levels of myogenic gene transcripts differ between older adults with
demonstrable sarcopenia and young men and women. J Appl Physiol 99: 21492158, 2005.
65.
Kimball SR, and Jefferson LS. Signaling pathways and molecular
mechanisms through which branched-chain amino acids mediate translational
control of protein synthesis. J Nutr 136: 227S-231S, 2006.
66.
Klossner S, Dapp C, Schmutz S, Vogt M, Hoppeler H, and Fluck M.
Muscle transcriptome adaptations with mild eccentric ergometer exercise. Pflugers
Arch 455: 555-562, 2007.
67.
Kohrt WM, Malley MT, Coggan AR, Spina RJ, Ogawa T, Ehsani AA,
Bourey RE, Martin WH, 3rd, and Holloszy JO. Effects of gender, age, and fitness
level on response of VO2max to training in 60-71 yr olds. J Appl Physiol 71: 20042011, 1991.
68.
Koopman R, and van Loon LJ. Aging, exercise and muscle protein
metabolism. J Appl Physiol 2009.
69.
Kosek DJ, Kim JS, Petrella JK, Cross JM, and Bamman MM. Efficacy of 3
days/wk resistance training on myofiber hypertrophy and myogenic mechanisms in
young vs. older adults. J Appl Physiol 101: 531-544, 2006.
70.
Lalani R, Bhasin S, Byhower F, Tarnuzzer R, Grant M, Shen R, Asa S,
Ezzat S, and Gonzalez-Cadavid NF. Myostatin and insulin-like growth factor-I and II expression in the muscle of rats exposed to the microgravity environment of the
NeuroLab space shuttle flight. J Endocrinol 167: 417-428, 2000.
71.
Langley B, Thomas M, Bishop A, Sharma M, Gilmour S, and Kambadur
R. Myostatin inhibits myoblast differentiation by down-regulating MyoD expression. J
Biol Chem 277: 49831-49840, 2002.
72.
Lanza IR, Short DK, Short KR, Raghavakaimal S, Basu R, Joyner MJ,
McConnell JP, and Nair KS. Endurance exercise as a countermeasure for aging.
Diabetes 57: 2933-2942, 2008.
84
73.
Lassar AB, Paterson BM, and Weintraub H. Transfection of a DNA locus
that mediates the conversion of 10T1/2 fibroblasts to myoblasts. Cell 47: 649-656,
1986.
74.
Lecker SH. Ubiquitin-protein ligases in muscle wasting: multiple parallel
pathways? Curr Opin Clin Nutr Metab Care 6: 271-275, 2003.
75.
Lecker SH, Jagoe RT, Gilbert A, Gomes M, Baracos V, Bailey J, Price
SR, Mitch WE, and Goldberg AL. Multiple types of skeletal muscle atrophy involve
a common program of changes in gene expression. FASEB J 18: 39-51, 2004.
76.
Leick L, Wojtaszewski JF, Johansen ST, Kiilerich K, Comes G, Hellsten
Y, Hidalgo J, and Pilegaard H. PGC-1alpha is not mandatory for exercise- and
training-induced adaptive gene responses in mouse skeletal muscle. Am J Physiol
Endocrinol Metab 294: E463-474, 2008.
77.
Lemura LM, von Duvillard SP, and Mookerjee S. The effects of physical
training of functional capacity in adults. Ages 46 to 90: a meta-analysis. J Sports
Med Phys Fitness 40: 1-10, 2000.
78.
Levine S, Nguyen T, Taylor N, Friscia ME, Budak MT, Rothenberg P, Zhu
J, Sachdeva R, Sonnad S, Kaiser LR, Rubinstein NA, Powers SK, and Shrager
JB. Rapid disuse atrophy of diaphragm fibers in mechanically ventilated humans. N
Engl J Med 358: 1327-1335, 2008.
79.
Lexell J. Evidence for nervous system degeneration with advancing age. J
Nutr 127: 1011S-1013S, 1997.
80.
Lexell J, Downham D, and Sjostrom M. Distribution of different fibre types
in human skeletal muscles. Fibre type arrangement in m. vastus lateralis from three
groups of healthy men between 15 and 83 years. J Neurol Sci 72: 211-222, 1986.
81.
Lexell J, Downham DY, Larsson Y, Bruhn E, and Morsing B. Heavyresistance training in older Scandinavian men and women: short- and long-term
effects on arm and leg muscles. Scand J Med Sci Sports 5: 329-341, 1995.
82.
Lexell J, Henriksson-Larsen K, Winblad B, and Sjostrom M. Distribution of
different fiber types in human skeletal muscles: effects of aging studied in whole
muscle cross sections. Muscle Nerve 6: 588-595, 1983.
83.
Lexell J, Taylor CC, and Sjostrom M. What is the cause of the ageing
atrophy? Total number, size and proportion of different fiber types studied in whole
vastus lateralis muscle from 15- to 83-year-old men. J Neurol Sci 84: 275-294, 1988.
84.
Lezza AM, Pesce V, Cormio A, Fracasso F, Vecchiet J, Felzani G,
Cantatore P, and Gadaleta MN. Increased expression of mitochondrial transcription
factor A and nuclear respiratory factor-1 in skeletal muscle from aged human
subjects. FEBS Lett 501: 74-78, 2001.
85.
Li P, Waters RE, Redfern SI, Zhang M, Mao L, Annex BH, and Yan Z.
Oxidative phenotype protects myofibers from pathological insults induced by chronic
heart failure in mice. Am J Pathol 170: 599-608, 2007.
86.
Lin J, Wu H, Tarr PT, Zhang CY, Wu Z, Boss O, Michael LF, Puigserver P,
Isotani E, Olson EN, Lowell BB, Bassel-Duby R, and Spiegelman BM.
Transcriptional co-activator PGC-1 alpha drives the formation of slow-twitch muscle
fibres. Nature 418: 797-801, 2002.
85
87.
Liu Y, Lormes W, Baur C, Opitz-Gress A, Altenburg D, Lehmann M, and
Steinacker JM. Human skeletal muscle HSP70 response to physical training
depends on exercise intensity. Int J Sports Med 21: 351-355, 2000.
88.
Liu Y, Mayr S, Opitz-Gress A, Zeller C, Lormes W, Baur S, Lehmann M,
and Steinacker JM. Human skeletal muscle HSP70 response to training in highly
trained rowers. J Appl Physiol 86: 101-104, 1999.
89.
Livak KJ, and Schmittgen TD. Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:
402-408, 2001.
90.
Louis E, Raue U, Yang Y, Jemiolo B, and Trappe S. Time course of
proteolytic, cytokine, and myostatin gene expression after acute exercise in human
skeletal muscle. J Appl Physiol 103: 1744-1751, 2007.
91.
Mahoney DJ, Parise G, Melov S, Safdar A, and Tarnopolsky MA. Analysis
of global mRNA expression in human skeletal muscle during recovery from
endurance exercise. FASEB J 19: 1498-1500, 2005.
92.
Mathai AS, Bonen A, Benton CR, Robinson DL, and Graham TE. Rapid
exercise-induced changes in PGC-1alpha mRNA and protein in human skeletal
muscle. J Appl Physiol 105: 1098-1105, 2008.
93.
Matsakas A, and Patel K. Intracellular signalling pathways regulating the
adaptation of skeletal muscle to exercise and nutritional changes. Histol Histopathol
24: 209-222, 2009.
94.
McFarlane C, Plummer E, Thomas M, Hennebry A, Ashby M, Ling N,
Smith H, Sharma M, and Kambadur R. Myostatin induces cachexia by activating
the ubiquitin proteolytic system through an NF-kappaB-independent, FoxO1dependent mechanism. J Cell Physiol 209: 501-514, 2006.
95.
McPherron AC, Lawler AM, and Lee SJ. Regulation of skeletal muscle
mass in mice by a new TGF-beta superfamily member. Nature 387: 83-90, 1997.
96.
Meredith CN, Zackin MJ, Frontera WR, and Evans WJ. Dietary protein
requirements and body protein metabolism in endurance-trained men. J Appl Physiol
66: 2850-2856, 1989.
97.
Metzger JM, and Moss RL. Shortening velocity in skinned single muscle
fibers. Influence of filament lattice spacing. Biophys J 52: 127-131, 1987.
98.
Mittal KR, and Logmani FH. Age-related reduction in 8th cervical ventral
nerve root myelinated fiber diameters and numbers in man. J Gerontol 42: 8-10,
1987.
99.
Mortensen OH, Frandsen L, Schjerling P, Nishimura E, and Grunnet N.
PGC-1alpha and PGC-1beta have both similar and distinct effects on myofiber
switching toward an oxidative phenotype. Am J Physiol Endocrinol Metab 291:
E807-816, 2006.
100. Morton JP, Maclaren DP, Cable NT, Campbell IT, Evans L, Kayani AC,
McArdle A, and Drust B. Trained men display increased Basal heat shock protein
content of skeletal muscle. Med Sci Sports Exerc 40: 1255-1262, 2008.
101. Moss RL. Sarcomere length-tension relations of frog skinned muscle fibres
during calcium activation at short lengths. J Physiol 292: 177-192, 1979.
86
102. Nader GA. Molecular determinants of skeletal muscle mass: getting the
"AKT" together. Int J Biochem Cell Biol 37: 1985-1996, 2005.
103. Naito H, Powers SK, Demirel HA, and Aoki J. Exercise training increases
heat shock protein in skeletal muscles of old rats. Med Sci Sports Exerc 33: 729734, 2001.
104. Nolan T, Hands RE, Ogunkolade W, and Bustin SA. SPUD: a quantitative
PCR assay for the detection of inhibitors in nucleic acid preparations. Anal Biochem
351: 308-310, 2006.
105. Norrbom J, Sundberg CJ, Ameln H, Kraus WE, Jansson E, and
Gustafsson T. PGC-1alpha mRNA expression is influenced by metabolic
perturbation in exercising human skeletal muscle. J Appl Physiol 96: 189-194, 2004.
106. Parkington JD, LeBrasseur NK, Siebert AP, and Fielding RA. Contractionmediated mTOR, p70S6k, and ERK1/2 phosphorylation in aged skeletal muscle. J
Appl Physiol 97: 243-248, 2004.
107. Paulsen G, Vissing K, Kalhovde JM, Ugelstad I, Bayer ML, Kadi F,
Schjerling P, Hallen J, and Raastad T. Maximal eccentric exercise induces a rapid
accumulation of small heat shock proteins on myofibrils and a delayed HSP70
response in humans. Am J Physiol Regul Integr Comp Physiol 293: R844-853, 2007.
108. Pilegaard H, Ordway GA, Saltin B, and Neufer PD. Transcriptional
regulation of gene expression in human skeletal muscle during recovery from
exercise. Am J Physiol Endocrinol Metab 279: E806-814, 2000.
109. Raue U, Slivka D, Jemiolo B, Hollon C, and Trappe S. Myogenic gene
expression at rest and after a bout of resistance exercise in young (18-30 yr) and old
(80-89 yr) women. J Appl Physiol 101: 53-59, 2006.
110. Raue U, Slivka D, Jemiolo B, Hollon C, and Trappe S. Proteolytic gene
expression differs at rest and after resistance exercise between young and old
women. J Gerontol A Biol Sci Med Sci 62: 1407-1412, 2007.
111. Raue U, Slivka D, Minchev K, and Trappe S. Improvements in Whole
Muscle and Myocellular Function are Limited with High-Intensity Resistance Training
in Octogenarian Women. J Appl Physiol 2009.
112. Reid MB. Response of the ubiquitin-proteasome pathway to changes in
muscle activity. Am J Physiol Regul Integr Comp Physiol 288: R1423-1431, 2005.
113. Reynolds THt, Reid P, Larkin LM, and Dengel DR. Effects of aerobic
exercise training on the protein kinase B (PKB)/mammalian target of rapamycin
(mTOR) signaling pathway in aged skeletal muscle. Exp Gerontol 39: 379-385,
2004.
114. Rooyackers OE, Adey DB, Ades PA, and Nair KS. Effect of age on in vivo
rates of mitochondrial protein synthesis in human skeletal muscle. Proc Natl Acad
Sci U S A 93: 15364-15369, 1996.
115. Roth SM, Ferrell RE, Peters DG, Metter EJ, Hurley BF, and Rogers MA.
Influence of age, sex, and strength training on human muscle gene expression
determined by microarray. Physiol Genomics 10: 181-190, 2002.
87
116. Roth SM, Martel GF, Ferrell RE, Metter EJ, Hurley BF, and Rogers MA.
Myostatin gene expression is reduced in humans with heavy-resistance strength
training: a brief communication. Exp Biol Med (Maywood) 228: 706-709, 2003.
117. Russell AP, Hesselink MK, Lo SK, and Schrauwen P. Regulation of
metabolic transcriptional co-activators and transcription factors with acute exercise.
FASEB J 19: 986-988, 2005.
118. Sacheck JM, Ohtsuka A, McLary SC, and Goldberg AL. IGF-I stimulates
muscle growth by suppressing protein breakdown and expression of atrophy-related
ubiquitin ligases, atrogin-1 and MuRF1. Am J Physiol Endocrinol Metab 287: E591601, 2004.
119. Sakamoto K, Aschenbach WG, Hirshman MF, and Goodyear LJ. Akt
signaling in skeletal muscle: regulation by exercise and passive stretch. Am J
Physiol Endocrinol Metab 285: E1081-1088, 2003.
120. Sakamoto K, and Goodyear LJ. Invited review: intracellular signaling in
contracting skeletal muscle. J Appl Physiol 93: 369-383, 2002.
121. Sandri M, Lin J, Handschin C, Yang W, Arany ZP, Lecker SH, Goldberg
AL, and Spiegelman BM. PGC-1alpha protects skeletal muscle from atrophy by
suppressing FoxO3 action and atrophy-specific gene transcription. Proc Natl Acad
Sci U S A 103: 16260-16265, 2006.
122. Sandri M, Sandri C, Gilbert A, Skurk C, Calabria E, Picard A, Walsh K,
Schiaffino S, Lecker SH, and Goldberg AL. Foxo transcription factors induce the
atrophy-related ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy. Cell
117: 399-412, 2004.
123. Schisler JC, Willis MS, and Patterson C. You spin me round:
MaFBx/Atrogin-1 feeds forward on FOXO transcription factors (like a record). Cell
Cycle 7: 440-443, 2008.
124. Schmutz S, Dapp C, Wittwer M, Vogt M, Hoppeler H, and Fluck M.
Endurance training modulates the muscular transcriptome response to acute
exercise. Pflugers Arch 451: 678-687, 2006.
125. Senf SM, Dodd SL, McClung JM, and Judge AR. Hsp70 overexpression
inhibits NF-kappaB and Foxo3a transcriptional activities and prevents skeletal
muscle atrophy. FASEB J 22: 3836-3845, 2008.
126. Sheffield-Moore M, Yeckel CW, Volpi E, Wolf SE, Morio B, Chinkes DL,
Paddon-Jones D, and Wolfe RR. Postexercise protein metabolism in older and
younger men following moderate-intensity aerobic exercise. Am J Physiol Endocrinol
Metab 287: E513-522, 2004.
127. Short KR, Vittone JL, Bigelow ML, Proctor DN, Coenen-Schimke JM, Rys
P, and Nair KS. Changes in myosin heavy chain mRNA and protein expression in
human skeletal muscle with age and endurance exercise training. J Appl Physiol 99:
95-102, 2005.
128. Short KR, Vittone JL, Bigelow ML, Proctor DN, and Nair KS. Age and
aerobic exercise training effects on whole body and muscle protein metabolism. Am
J Physiol Endocrinol Metab 286: E92-101, 2004.
88
129. Short KR, Vittone JL, Bigelow ML, Proctor DN, Rizza RA, CoenenSchimke JM, and Nair KS. Impact of Aerobic Exercise Training on Age-Related
Changes in Insulin Sensitivity and Muscle Oxidative Capacity. Diabetes 52: 18881896, 2003.
130. Sial S, Coggan AR, Hickner RC, and Klein S. Training-induced alterations
in fat and carbohydrate metabolism during exercise in elderly subjects. Am J Physiol
274: E785-790, 1998.
131. Siriett V, Platt L, Salerno MS, Ling N, Kambadur R, and Sharma M.
Prolonged absence of myostatin reduces sarcopenia. J Cell Physiol 209: 866-873,
2006.
132. Spina RJ, Ogawa T, Kohrt WM, Martin WH, 3rd, Holloszy JO, and Ehsani
AA. Differences in cardiovascular adaptations to endurance exercise training
between older men and women. J Appl Physiol 75: 849-855, 1993.
133. Stitt TN, Drujan D, Clarke BA, Panaro F, Timofeyva Y, Kline WO,
Gonzalez M, Yancopoulos GD, and Glass DJ. The IGF-1/PI3K/Akt pathway
prevents expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO
transcription factors. Mol Cell 14: 395-403, 2004.
134. Tarpenning KM, Hawkins SA, Marcell TJ, and Wiswell RA. Endurance
exercise and leg strength in older women. J Aging Phys Act 14: 3-11, 2006.
135. Terada S, and Tabata I. Effects of acute bouts of running and swimming
exercise on PGC-1alpha protein expression in rat epitrochlearis and soleus muscle.
Am J Physiol Endocrinol Metab 286: E208-216, 2004.
136. Tesch PA, Berg HE, Bring D, Evans HJ, and LeBlanc AD. Effects of 17day spaceflight on knee extensor muscle function and size. Eur J Appl Physiol 93:
463-468, 2005.
137. Thomas M, Langley B, Berry C, Sharma M, Kirk S, Bass J, and
Kambadur R. Myostatin, a negative regulator of muscle growth, functions by
inhibiting myoblast proliferation. J Biol Chem 275: 40235-40243, 2000.
138. Thompson HS, Clarkson PM, and Scordilis SP. The repeated bout effect
and heat shock proteins: intramuscular HSP27 and HSP70 expression following two
bouts of eccentric exercise in humans. Acta Physiol Scand 174: 47-56, 2002.
139. Thorell A, Hirshman MF, Nygren J, Jorfeldt L, Wojtaszewski JF,
Dufresne SD, Horton ES, Ljungqvist O, and Goodyear LJ. Exercise and insulin
cause GLUT-4 translocation in human skeletal muscle. Am J Physiol 277: E733-741,
1999.
140. Tintignac LA, Lagirand J, Batonnet S, Sirri V, Leibovitch MP, and
Leibovitch SA. Degradation of MyoD mediated by the SCF (MAFbx) ubiquitin
ligase. J Biol Chem 280: 2847-2856, 2005.
141. Tomlinson BE, and Irving D. The numbers of limb motor neurons in the
human lumbosacral cord throughout life. J Neurol Sci 34: 213-219, 1977.
142. Trappe S, Gallagher P, Harber M, Carrithers J, Fluckey J, and Trappe T.
Single muscle fibre contractile properties in young and old men and women. J
Physiol 552: 47-58, 2003.
89
143. Trappe S, Godard M, Gallagher P, Carroll C, Rowden G, and Porter D.
Resistance training improves single muscle fiber contractile function in older women.
Am J Physiol Cell Physiol 281: C398-406, 2001.
144. Trappe S, Harber M, Creer A, Gallagher P, Slivka D, Minchev K, and
Whitsett D. Single muscle fiber adaptations with marathon training. J Appl Physiol
101: 721-727, 2006.
145. Trappe S, Williamson D, and Godard M. Maintenance of whole muscle
strength and size following resistance training in older men. J Gerontol A Biol Sci
Med Sci 57: B138-143, 2002.
146. Trappe S, Williamson D, Godard M, Porter D, Rowden G, and Costill D.
Effect of resistance training on single muscle fiber contractile function in older men. J
Appl Physiol 89: 143-152, 2000.
147. Trappe T, Williams R, Carrithers J, Raue U, Esmarck B, Kjaer M, and
Hickner R. Influence of age and resistance exercise on human skeletal muscle
proteolysis: a microdialysis approach. J Physiol 554: 803-813, 2004.
148. Trappe TA, Lindquist DM, and Carrithers JA. Muscle-specific atrophy of
the quadriceps femoris with aging. J Appl Physiol 90: 2070-2074, 2001.
149. Tsika R editor. The Muscular System: The Control of Muscle Mass. .
Bethseda, MD: 2006.
150. Tupling AR, Bombardier E, Stewart RD, Vigna C, and Aqui AE. Muscle
fiber type-specific response of Hsp70 expression in human quadriceps following
acute isometric exercise. J Appl Physiol 103: 2105-2111, 2007.
151. Urso ML. Endurance Exercise Affects Transcription of Ubiquitin Proteosome
Pathway Components. In: 2008 APS Intersociety Meeting: The Integrative Biology of
Exercise-V. Hilton Head, South Carolina: 2008.
152. Urso ML, Chen YW, Scrimgeour AG, Lee PC, Lee KF, and Clarkson PM.
Alterations in mRNA expression and protein products following spinal cord injury in
humans. J Physiol 579: 877-892, 2007.
153. Vasilaki A, Jackson MJ, and McArdle A. Attenuated HSP70 response in
skeletal muscle of aged rats following contractile activity. Muscle Nerve 25: 902-905,
2002.
154. Verney J, Kadi F, Saafi MA, Piehl-Aulin K, and Denis C. Combined lower
body endurance and upper body resistance training improves performance and
health parameters in healthy active elderly. Eur J Appl Physiol 97: 288-297, 2006.
155. Volpi E, Sheffield-Moore M, Rasmussen BB, and Wolfe RR. Basal muscle
amino acid kinetics and protein synthesis in healthy young and older men. JAMA
286: 1206-1212, 2001.
156. Voytik SL, Przyborski M, Badylak SF, and Konieczny SF. Differential
expression of muscle regulatory factor genes in normal and denervated adult rat
hindlimb muscles. Dev Dyn 198: 214-224, 1993.
157. Weiss EP, Racette SB, Villareal DT, Fontana L, Steger-May K,
Schechtman KB, Klein S, Ehsani AA, and Holloszy JO. Lower extremity muscle
size and strength and aerobic capacity decrease with caloric restriction but not with
exercise-induced weight loss. J Appl Physiol 102: 634-640, 2007.
90
158. Welle S, Brooks AI, Delehanty JM, Needler N, and Thornton CA. Gene
expression profile of aging in human muscle. Physiol Genomics 14: 149-159, 2003.
159. Whaley MH editor. ACSM's Guidelines for Exercise Testing and Prescription;
Seventh Edition. 2006.
160. Whitman SA, Wacker MJ, Richmond SR, and Godard MP. Contributions of
the ubiquitin-proteasome pathway and apoptosis to human skeletal muscle wasting
with age. Pflugers Arch 450: 437-446, 2005.
161. Widegren U, Jiang XJ, Krook A, Chibalin AV, Bjornholm M, Tally M, Roth
RA, Henriksson J, Wallberg-henriksson H, and Zierath JR. Divergent effects of
exercise on metabolic and mitogenic signaling pathways in human skeletal muscle.
FASEB J 12: 1379-1389, 1998.
162. Wilmore JH, Stanforth PR, Gagnon J, Rice T, Mandel S, Leon AS, Rao
DC, Skinner JS, and Bouchard C. Cardiac output and stroke volume changes with
endurance training: the HERITAGE Family Study. Med Sci Sports Exerc 33: 99-106,
2001.
163. Wilson C, Hargreaves M, and Howlett KF. Exercise does not alter
subcellular localization, but increases phosphorylation of insulin-signaling proteins in
human skeletal muscle. Am J Physiol Endocrinol Metab 290: E341-346, 2006.
164. Wu Z, Puigserver P, Andersson U, Zhang C, Adelmant G, Mootha V, Troy
A, Cinti S, Lowell B, Scarpulla RC, and Spiegelman BM. Mechanisms controlling
mitochondrial biogenesis and respiration through the thermogenic coactivator PGC1. Cell 98: 115-124, 1999.
165. Yang Y, Creer A, Jemiolo B, and Trappe S. Time course of myogenic and
metabolic gene expression in response to acute exercise in human skeletal muscle.
J Appl Physiol 98: 1745-1752, 2005.
166. Zhu E, Sassoon CS, Nelson R, Pham HT, Zhu L, Baker MJ, and Caiozzo
VJ. Early effects of mechanical ventilation on isotonic contractile properties and
MAF-box gene expression in the diaphragm. J Appl Physiol 99: 747-756, 2005.
APPENDIX A
INFORMED CONSENT
92
Human Performance Laboratory Consent Form
Ball State University and Ball Memorial Hospital
Title of Project:
Age and Muscle Function: Impact of Aerobic Exercise
Principal Investigator:
Matthew Harber, Ph.D.
Co – Investigators:
Scott Trappe, Ph.D., Todd Trappe, Ph.D.,
Leonard Kaminsky, Ph.D.
1. Purpose of the Study
The reductions in muscle size and function with aging are well known. A major
focus of our laboratory is to understand how these age related reductions at the
whole muscle level are related to changes in the individual muscle cells.
Additionally, our research has revealed that regularly performed resistance exercise
improves muscle size and strength at both the whole muscle and muscle cell level.
Aerobic exercise is a popular mode of exercise among older individuals because of
its overall health benefits and because it is typically more convenient than
performing resistance exercise. Despite the popularity of aerobic exercise, relatively
little is known regarding its influence on muscle function. Recent research has
revealed that aerobic exercise may improve whole muscle function in older subjects.
Therefore, the purpose of this study is to examine the influence of 12-weeks of
aerobic exercise training on muscle size and function at both the whole muscle and
muscle cell level.
2. Procedures to be Followed
Sixteen older (60-80 yr), men and women will be recruited from the Greater Muncie
area. All subjects will perform the same procedures. Eligible volunteers will be
enrolled, at no cost to you, in the Adult Physical Fitness program at Ball State
University. If you choose to participate in this study, you will provide to the best of
your knowledge a complete history of your personal and family health history,
smoking, exercise, and dietary habits, and a list of any medications and
supplements that you are taking.
You will report to the Human Performance Laboratory (HPL) and Ball Memorial
Hospital (BMH) on the dates and times designated by the investigators. The entire
study will last approximately four months. All of the testing and procedures asked of
you at the HPL and BMH will be completed at no cost to you.
The details of each procedure and study trial are detailed below.
93
Screening Procedures
All of the screening procedures will take place in the Human Performance
Laboratory (HPL).
a. Initial Interview: You have been invited to the HPL for an initial interview,
introduction to the HPL, and an explanation of the study procedures.
b. Medical History Questionnaire: You will complete a medical history form, which
will ask questions about your general health, personal and family health history, and
smoking, exercise and dietary habits. After completing the questionnaire, you will be
interviewed and asked questions about the information you provided, as well as
other general questions related to your participation in this research study.
c. Anthropometric Measurements: You will undergo measurements of your weight
and height.
d. Blood Draw: You will have a small amount of blood drawn from your arm vein
(venipuncture) for various routine blood measurements (e.g. blood lipids).
e. Exercise Stress Test: You will complete an exercise stress test, which will
involve you exercising until you reach exhaustion. The total test should take about
10 minutes. During the test, your heart function will be monitored with an
electrocardiogram (ECG). The ECG involves connecting a few wires to your chest
with adhesive pads. Also during this test, your respiratory gases will be monitored,
which will allow us to measure your aerobic capacity. This test will be supervised by
a physician who will monitor your heart function during the test. This test will be
performed again following the 12-week training program.
Study Procedures
a. Body Composition Assessment: Body composition (% body fat, fat free mass) will
be measured using a machine referred to as DXA before and after the 12-week
training program. You will be asked to lie motionless in the supine position for
approximately 5 minutes during the scan. There is no discomfort associated with
this procedure and the potential hazard of X-ray exposure is no more than for normal
diagnostic X-rays, similar to the amount of exposure during a transatlantic flight.
The time required for this procedure is less than 30 min. This procedure will take
place at the HPL.
b. Muscle Size: Before and after the 12-week aerobic training program you will
have the size of your leg measured with magnetic resonance imaging (MRI). You
will be required to rest quietly on a bed for one hour prior to the MRI scan to evenly
94
distribute the fluid in your body. The actual MRI scan will last about 30 minutes.
This procedure will take place at Ball Memorial Hospital.
c. Tendon Size: Before and after the 12-week aerobic training program you will
have the size of your patellar (knee) tendon measured with MRI. This procedure will
occur in conjunction with the measurement of muscle size and will help us determine
if the improvements in whole muscle function were influenced by changes in your
tendon. The muscle and tendon size measures will occur in conjunction with the
measurement of muscle size. This procedure will take place at Ball Memorial
Hospital.
d. Muscle Biopsy: Two muscle biopsies will be taken from your thigh. One biopsy
will be taken before and one after the 12-week aerobic training program. These
biopsy samples will be stored for analyses at the end of the study and used to
determine the characteristics of your muscles. For each biopsy, you will have the
area of your thigh numbed by injection with local anesthetic, then a small 1/4 inch
incision will be made in the skin and a needle inserted briefly into the muscle to
remove a piece of muscle about the size of a pencil eraser. The incision is pulled
closed with a Band-Aid and the area over the incision will be covered with an elastic
pressure bandage. The whole procedure will take a total of approximately 10-15
minutes, with the actual biopsy lasting only a few seconds. This procedure will take
place at the HPL.
e. Indirect Calorimetry: We will measure your resting metabolic rate by analyzing
the air you breathe out. During this test, you will lay quietly in bed, awake but
undisturbed for ~ 30 min. You will breath into a canopy that will allow us to measure
your expired air. We will perform this measure before and after the 12-week aerobic
training program. The indirect calorimetry and muscle biopsy procedures will be
performed on the same day. The total time for both procedures will be less than one
hour. This procedure will take place at the HPL.
f. Dietary Control: The evening prior to your muscle biopsy and indirect calorimetry
session, you will be provided an evening meal. You will be asked to consume this
meal at a specific time and it will take approximately 30 minutes.
g. Muscle Function Testing: Before and after the 12-week aerobic training program
you will undergo a test to determine the maximum weight that you can lift (referred to
as your one repetition maximum, or 1RM) and how much power your thigh muscles
can generate. You will warm-up on a stationary bike and stretch before any of the
strength measurements are completed. This testing will last about 30 minutes. The
actual measurements will be performed twice, separated by at least three days.
Additionally, these tests will be completed after an orientation session. This
procedure will take place at the HPL.
h. Aerobic Exercise Training: Following the preliminary testing, you will complete
twelve weeks of aerobic exercise training, three - five days per week. Your heart rate
95
will be monitored during each exercise session. Each training session will last 30 60 minutes. The training sessions will occur in the Adult Physical Fitness exercise
facility that is located within the same building and within close proximity to the HPL.
You will be provided a parking pass, as no cost to you, that will allow convenient
parking access to the exercise facility.
Use of specimens for future research: Some specimens obtained during this study
will be stored indefinitely in the laboratory, and may be used in future research
approved by the Institutional Review Board. These samples may be used to study
other markers of muscle metabolism and responses to exercise. Please indicate
whether you will permit these specimens to be used in future research by initializing
one of the following statements:
I agree to allow my specimens to be stored for future research.
I do not agree to allow my specimens to be stored for future research.
If, in the future, you decide that you do not want the specimens used for
research, please notify Dr. Matthew Harber, and your specimens will be destroyed.
3. Discomforts and Risks
Screening Procedures
a. Initial Interview: No known risks.
b. Medical History Questionnaire: No known risks.
c. Anthropometric Measurements: No known risks.
d. Blood draw: There are some risks associated with the blood draw procedure.
During the procedure you may feel discomfort from insertion of the needle into your
vein. This procedure could leave bruises and theoretically, could lead to infection;
however, strict sterile technique (super-clean) will be used during this procedure to
reduce the risk of infection. You also may feel lightheaded and there is a slight risk
of fainting.
e. Exercise Stress Test: There are some risks associated with the exercise stress
test. You may experience muscle tightness, muscle soreness and fatigue, shortness
96
of breath, lightheadedness, and rarely a pulled muscle. The cardiovascular risks in
the defined study/screening population for performing an exercise stress test include
abnormal blood pressure, fainting, cardiac arrhythmia requiring immediate treatment,
and death. Trained personnel will be available during the test to respond to any
foreseeable event.
Study Procedures
a. Body Composition Assessment: There is no discomfort associated with this
procedure and the potential hazard of X-ray exposure is no more than for normal
diagnostic X-rays.
b. Muscle Size: There are some risks associated with being enclosed during the
MRI measurement of muscle size. You may experience claustrophobia-like
symptoms (anxiety reactions and dizziness), as the MRI device is a small chamber.
There is danger associated with approaching the magnet with metallic objects. You
will be carefully screened by the radiological staff for any contraindications to
exposure to MRI equipment.
c. Tendon Size: The risks are the same outlined above in section b. Muscle Size.
d. Muscle Biopsy: There are some risks when muscle biopsies are taken. There is
a possibility of discomfort and pain during the injection of the local anesthetic and
during the brief biopsy procedure, as well as during the day or so following the
procedure. There is a small risk of bleeding, infection and scarring of the skin.
Temporary numbness of the skin near the biopsy site occurs rarely. By using
appropriate techniques during these procedures the risks outlined above are
minimized. In addition, strict sterile technique (super-clean) will be used during
these procedures to reduce the risk of infection. You also may feel lightheaded and
there is a slight risk of fainting.
e. Indirect Calorimetry: No known risks.
f. Dietary Control: No known risks.
g. Muscle Function Testing: There are some risks associated with the muscle
function testing. You may experience muscle tightness, muscle soreness and
fatigue, shortness of breath, lightheadedness, and rarely a pulled muscle. There is a
very small risk (1 in 15,000 persons) of death from a sudden cardiac event during
vigorous activity, even in apparently healthy individuals.
97
h. Aerobic Exercise Training: There are some risks associated with the aerobic
exercise training. You may experience muscle tightness, muscle soreness and
fatigue, shortness of breath, lightheadedness, and rarely a pulled muscle. The
cardiovascular risks in the defined study/screening population for performing an
exercise stress test include abnormal blood pressure, fainting, cardiac arrhythmia
requiring immediate treatment, and death. Trained personnel will be available
during your exercise sessions to respond to any foreseeable event.
4. Benefits
a. Potential Benefits to the Subjects: You may benefit from the information about
your blood chemistry profile, your aerobic capacity, and muscle function. You may
also benefit from the physical activity training performed in this study by improved
muscle function and cardiovascular conditioning. No benefit is guaranteed.
b. Potential Benefits to Society: The knowledge gained for this study will have a
benefit to society by providing important new and novel data describing the benefits
of aerobic exercise on muscle function in older adults. Such information may lead to
the development of alternative therapeutic modalities to counteract the muscle
wasting that is associated with aging.
5. Alternative Procedures
None. You may decline to participate.
6. Time
You understand that this study will last approximately four months. The approximate
time for each procedure or test has been described previously to you in the above
written sections and verbally.
7. Confidentiality and Right to ask questions
All records associated with your participation in this study are subject to the usual
confidentiality standards applicable to medical records, with the exception of
Institutional Review Board review, and in the event of any publication resulting from
the research no personally identifiable information will be disclosed.
98
If you have any questions about your rights as a research subject or concerning a
research-related injury, you can call the following individuals: Coordinator of
Research Compliance, Academic Research and Sponsored Programs, Ball State
University, Muncie, IN 47306, (765) 285-5070 or Ball Memorial Hospital Review
Board, Muncie, IN, (765) 747-8458.
Emergency medical treatment is available if you become injured or ill during your
participation in this research project. You will be responsible for the costs of any
medical care that is provided. It is understood that in the unlikely event of an injury
or illness of any kind as a result of you participation in this research project that Ball
State University, its agents and employees will assume whatever responsibility is
required by law. If any injury or illness occurs in the course of your participation in
this research project, please notify the principal investigator at: Matthew Harber,
Ph.D., (765) 285-9840 work or (765) 729-3833 cell.
8. Compensation
There is no direct financial compensation for participating in this study. As part of
this investigation, you will be enrolled in the Adult Physical Fitness program and Ball
State University at no cost to you. Following completion of the study procedures,
you will have the option of remaining in the program, at no cost to you, for the
remainder of the year (~8 months) with access to the services provided by the
program (i.e., access to the exercise facility, individualized exercise prescription,
etc.).
99
9. Voluntary Participation
You understand that your participation in this study is voluntary, and that you may
withdraw from this study at any time by notifying the investigator. You understand
that your refusal to participate will involve no penalty or loss of benefits to which you
are otherwise entitled and that you may discontinue participation at any time without
penalty or loss of benefits to which you are otherwise entitled. You understand that
your participation in this research may be terminated by the investigator without
regard to your consent if you are unable or unwilling to comply with the guidelines
and procedures explained to you or if the study is terminated prior to your
completion.
You understand that you will be notified if significant new findings develop during the
course of your participation in the research project which may relate to your
willingness to continue your participation.
You understand that you have not waived any legal right to which you are legally
entitled by signing this form.
I,
, have read the above statement and have
been able to ask questions and express concerns, which have been satisfactorily
responded to by the investigator. I understand the purpose of the study as well as
the potential benefits and risks that are involved. I hereby give my informed and free
consent to be a participant in this study. I will be given a copy of this consent form.
Volunteer's Signature
Date
Principle Investigator's Signature
Date
Witness’s Signature
Date
Person Obtaining Consent
Date
APPENDIX B
WESTERN BLOTTING
PROCEDURES AND SUPPLIES
101
Muscle Homogenization for Western Blotting
Summary
 Pre-Weigh muscle and label cryovials
 Prepare 30 volumes of RIPA buffer
o Add Halt protease Inhibitor Cocktail
 10µL per 1Ml RIPA
o Add EDTA
 10µL per 1Ml RIPA
o Add Halt Phosphatase Inhibitor Cocktail
 10 µL per 1Ml RIPA
 Pipette 30 volumes of prepared RIPA Buffer into Glass Homogenizing tube
 Add muscle and commence homogenization. 3 x 30 sec. Avoid foam/bubbles.
 Pipette 10µL sample to 90 µL RIPA for protein assay
o Remaining sample stays on Ice
 Follow directions for protein assay
 After protein assay, dilute samples 1:1 with 2x blue buffer
**Supplies and Details are provided below**
102
Table B-1. Western Blotting Supplies
Description
0.5 ml Microcentrifuge Tubes
1.5 ml Microcentrifuge Tubes
2 ml Flat Bottom Tubes
Immobilon-P transfer
NaCl
Tween* 20
Methanol
SDS
Tris Base
Glycerol
2-β-mercaptoethanol
12% Protein Gels
4-20% Protein Gels
BupH Tris-Glycine Transfer Buffer
BupH Tris-Hepes-SDS Running Buffer
Pierce ECL Western Blotting
Substrate
Amersham ECL Plus
RIPA Lysis and Extraction Buffer
Halt™ Phosphotase Inhibitor Cocktail
Protease Inhibitor Cocktail Kit
BCA Protein Assay Kit
See Blue Plus2 Prestained Standard
Magic Marker™ XP Western
STandard
2-β-mercaptoethanol
FOXO3A Antibody
PGC-1α Antibody
HSP70 Antibody
Carnation 5% nonfat dry milk
Company Item #
Fisher
Fisher
Fisher
Fisher
Fisher
Fisher
Fisher
05-408-120
05-408-129
02-681-258
IPVH 000 10
S642-500
BP337-100
A452-4
Fisher
Fisher
Fisher
Fisher
Pierce
Pierce
Pierce
Pierce
BP166-500
BP152-1
G33-1
BP176-100
25242
25244
28380
28398
Pierce 32106
GE RPN2132V1
Pierce 89901
Pierce 78420
Pierce 78410
Pierce 23227
Invitrogen 422183
Invitrogen LC5602
Sigma M-6250
Cell Signaling 9467
Cell Signaling 2178S
Cell Signaling 4872
103
Muscle Protein Quantification Protocol
WEIGHING MUSCLE
1) Confirm that weighing freezer is at -20C or cooler.
2) Turn on freeze dryer.
3) Place needed instruments into freezer (tweezers, scalpel #11, should be new
and sharp), weigh paper, Kimwipes, small petri dish, and test tube rack).
4) Remove muscle from storage and place in liquid nitrogen container.
5) Label cryovial tubes with 4 venting holes in the lid (prepared with 18G needle
or forceps) and place in -20°C freezer.
6) Place weigh paper on scale, tare, remove weigh paper.
7) Cut muscle to ~20 mg (15-25 mg will work) hold Kimwipe over top during
cutting to prevent muscle from flying all over the place. The tissue piece in
each tube should be approximately 10 mg, and therefore should not need to
be cut.
8) Place muscle onto weigh paper and then onto scale. Record weight.
9) Put weighed muscle into 1.2-ml cryovial tube and place in a tube rack placed
in liquid nitrogen.
10) If there is extra muscle, place it back in original vial to be stored in the dewer.
Record approximately how much tissue is left.
11) Return extra muscle to storage (usually liquid nitrogen dewer).
12) Be sure to monitor temperature in -20C freezer during cutting. It should not
drop more than 10C if the freezer is running correctly. Record temperature at
time of weighing.
13) Place cryovial containing the weighed muscle in the freeze dryer and record
time.
14) After a designated time of freeze drying (72 hours), remove cryovials from
the dryer and place in the -20°C weighing freezer. Record time.
15) Place weigh paper on scale, tare, remove weigh paper.
104
16) Place freeze dried muscle on the weigh paper and then place on the scale
and record weight. Return weighed muscle to the original vented cryovial tube
and place in liquid nitrogen for homogenization steps.
HOMOGENIZING MUSCLE
1) Place 90 μl of RIPA buffer into 500 μl tubes pre-labeled for the BCA protein
assay. Store at 4° C
2) Turn on Centrifuge (4° C, 1000g, 5 min)
3) Place 30 volumes of ice cold homogenizing buffer (i.e. if muscle weighs 20
mg add 600 l of buffer) into the 2 ml glass homogenizing tube. Then take
muscle from the cryovial and place into ground glass homogenizer (electric
homogenizing).
4) Homogenize for 3 x 30 seconds. (no noticeable tissue should be remaining;
usually pink/beige in color).
5) Transfer solution with glass disposable pipette from the glass homogenizer to
a new, a 1.5 ml microcentrifuge tube. Try to retrieve all protein and fluid, even
if on sides of the 2ml glass ground homogenizer.
SPIN STEPS
1) Spin 1.5 ml tube of homogenized muscle at 1,000 g for 5 min at 4C
2) Aliquot 10 l of the homogenate in the designated 500 l microcentrifuge tube
containing 90 μl of RIPA buffer for protein assay, votex, and place on ice until
after assay.
3) Retrieve a known amount of solution (about 100-130µl less than your 30
volumes) and then pipette into a 2.0 ml flat bottomed tube, which will be used
for western blot analyses. You will not retain all 40 volumes. Record this
volume.
4) Dispense an equal amount of 2x Blue Buffer into 2.0 ml flat bottomed tube
diluting your sample to a concentration of 1:1.
5) Place all tubes for the Western Blot Analysis in a labeled box in the -80°C
freezer.
105
PIERCE BCA ASSAY PROTOCOL
1) Pull out an aliquot of each BSA standard dilution for the standard curve from
the -20°C freezer (50, 100, 200, 400, 600, 800, and 1000 μg/ml) and allow to
warm to room temperature. *Standards (BSA, from manufacture) were stored
at -20°C.
2) Into a Fisher 400 μl plate, pipette 25 μl of each standard and samples into
their predetermined wells.
3) Prepare the BCA Working Reagent (WR) as an over-estimation of what we
will need.
TABLE B-2
Pierce BCA Working Reagent (WR)
Reagent A:B = 50:1; 200µl needed per well, completed in triplicate
# Samples
x3
Vol needed (ml)
Vol to make up (ml)
Reagent A (50
parts)
Reagent B (1 part)
8
24
4.80
6.12
6.00
0.12
16
48
9.60
11.22
11.00
0.22
24
72
14.40
16.32
16.00
0.32
32
96
19.20
20.40
20.00
0.40
40
120
24.00
25.50
25.00
0.50
48
144
28.80
30.60
30.00
0.60
56
168
33.60
35.70
35.00
0.70
64
192
38.40
40.80
40.00
0.80
4) . Add 200 μl of WR to each well using a multi-channel pipette.
5) . Mix the plate using the microtiterplate shaker for 30 seconds (speed ~8).
6) . Cover the plate and incubate at 37°C for 30 minutes.
7) . Let cool briefly (5 min) and measure absorbance at 562 nm on the plate
reader (540-590 wavelengths can be used, but incubation times may vary).
106
General Procedures for Western Blotting
1) Mix adequate amounts of running and transfer buffer, then store in 4°C.
2) Create apparatus, insert pre-fabricated 15 well gels
3) Fill apparatus with running buffer and then clean the lanes with 5 ml syringe.
4) Load gels, skipping first and last lanes.
a. Load markers on the second and fourteenth lanes
i. (5µl for BlueSee, 0.5 µl for Magic Marker).
b. Load proteins at a predetermined volume to load 20µg
5) Begin electrophoresis for 75min at 100 constant volts. Record mAMPs before
and after the run.
6) Soak filter paper and sponge in transfer buffer
7) Cut membrane to meet specifications of the apparatus. Then charge
membrane by soaking in methanol for 1 min and then 1 min in transfer
8) Pry open gel, making sure gel stays on one plate. Identify proper orientation
9) Cut top left corner and place in transfer buffer.
10) Create and label sandwiches (sponge, filter paper, gel, membrane, filter
paper sponge)
11) Use filter paper to ‘scoop’ gel and set it properly on filter paper. Then place
filter paper and sponge in sandwich.
12) When transferring black goes in back and proteins always flow to red
13) Transfer for 2h at 200 mAMPs (100 mAMPs per gel) at 4°C. Place Ice Pack
into apparatus to assist in keeping the transfer cool.
14) Create 5% milk with TBST (e.g. 1g of dry milk into 20 ml of TBST)
15) Remove membranes from transfer sandwich and immediately put in 5% milk
for 1 hr while rocking slowly (1-1.5 setting)
16) After blocking do three quick rinses in tBST to remove milke, then rinse in
TBST for 3 x 5 minutes
17) Discard TBST and add 10 ml of primary AB-TBST solution. Primary
antibodies used in this investigation were 1:1000. Rock blots overnight at 4°C.
107
18) Create secondary AB in a 3-4% milk-TBST solution. Secondary AB in this
investigation were 1:4000
19) Collect primary AB in original tube and then begin 3 x 5 min. rinses in TBST
20) After rinses place secondary AB-milk-TBST solution into tubs. Let rock for 1h
at room temp
21) Rinse 3 times quickly followed by 3 x 15min washes in TBST
22) Mix the ECL that will be used to manufacturer’s specifications
23) Put membrane on thick plastic plate, then pour ECL onto Gel for specified
duration
24) Then put membrane on glass plate and transport to imaging station
Imaging Procedures
1) Turn on Camera and set camera to maximum zoom that fits the gel. Make
sure the camera is in focus. Also, the camera aperture should be on 2.8
2) Settings using FluroChem imaging program should be as follows
a. 1.4 x zoom
b. High/medium (sensitivity/resolution)
c. No light
3) After properly aligned acquire image. Then reverse and auto-contrast image.
Adjust contrast, gamma and white until you see clearest unsaturated bands
4) Repeat at different exposure durations
APPENDIX C
WESTERN BLOTTING
RAW DATA
109
TABLE C-1
FOXO3A
Subject
KW
MB
MJ
CS
BC
JSJ
SM
PA
MS
PRE
6703200
9684395
8453480
8852480
1393860
1365780
2106390
2362230
995280
POST
7647500
7777840
8242675
3950100
913380
1657110
2238210
1248000
1491750
Delta
944300
-1906555
-210805
-4902380
-480480
291330
131820
-1114230
496470
% Change
14
-20
-2
-55
-34
21
6
-47
50
pre/pre
1
1
1
1
1
1
1
1
1
pre/post
1.14
0.80
0.98
0.45
0.66
1.21
1.06
0.53
1.50
AVG
STD
SE
4657455
3676563
1225521
3907396
3112214
1037405
-750059
1780528
593509.2
-8
35
12
1.00
0.00
0.00
0.92
0.35
0.12
110
TABLE C-2
Subject
KW
MB
MJ
CS
BC
JSJ
SM
PA
MS
PRE
2109037
2440520
2357492
2314720
1898925
2755200
2573550
2898000
2904300
POST
1895177
2048653
2188920
2443036
2306850
2451750
2478525
2374575
2852850
HSP70
Delta
-213860
-391867
-168572
128316
407925
-303450
-95025
-523425
-51450
% Change
-10
-16
-7
6
21
-11
-4
-18
-2
pre/pre
1
1
1
1
1
1
1
1
1
pre/post
0.90
0.84
0.93
1.06
1.21
0.89
0.96
0.82
0.98
AVG
STD
SE
2472416
346025.6
115341.9
2337815
276842.9
92280.97
-134601
279565.7
93188.58
-5
12
4
1.00
0.00
0.00
0.95
0.12
0.04
111
TABLE C-3
Subject
KW
MB
MJ
CS
BC
JSJ
SM
PA
MS
PRE
883680
897680
960960
934080
687276
1058148
760716
POST
654080
587440
891520
767760
667080
565488
721548
PGC-1α
Delta
% Change
-229600
-26
-310240
-35
-69440
-7
-166320
-18
-20196
-3
-492660
-47
-39168
-5
1033668
848232
-185436
-18
AVG
STD
SE
902026
126855
44850
712894
117312
41476
-189133
157808
55793
-20
15
5
pre/pre
1
1
1
1
1
1
1
pre/post
0.74
0.65
0.93
0.82
0.97
0.53
0.95
1
0.82
0.00
0.80
0.15
0.05