 The expression of genes found in DNA
 The genes expressed in a particular cell determines its function
 DNA > RNA > Protein > Trait
 Includes the processes of transcription and translation

 Intron – DNA sequence included in the pre mRNA sequence but will be removed from the mature
RNA
 Exon – DNA sequence included in the pre mRNA that include the protein coding region and will remain as the mature RNA
 RNA splicing – removal of the intron from the pre
MRNA
 TATA box – promoter site on the RNA

 Gene or RNA splicing animations
 http://www.youtube.com/watch?feature=endscree n&NR=1&v=FVuAwBGw_pQ
 http://www.gdbdp.com/upload_2_0/winpops/k1
2_step_exons_introns.html

 In prokaryotes, regulatory proteins are often controlled by nutrient availability. This allows organisms such as bacteria to rapidly adjust their transcription patterns in response to environmental conditions.
 Recall Lac operon and Trp operon
 Lac inducible system of gene expression. Its default state is to be inactive. Only when the right catalyst is added to the system, in this case the sugar lactose, is the process activated, allowing the genes in question to be expressed.
 Trp repressible system, meaning that the operon is automatically turned on unless a repressor becomes active and turns it off.

 Transcription Regulation
 Control of binding sites
 Post Transcription Regulation
 Degrade mRNA or not protect the mRNA
 Translational Regulation
 Less used by cell but used by toxins and antibiotics
 Protein degradation
 Protein is destroyed after translation

 http://www.youtube.com/watch?v=3S3ZOmleAj0
 http://highered.mcgrawhill.com/sites/9834092339/student_view0/chapter
16/control_of_gene_expression_in_eukaryotes.html

Remove the introns to form a Chuck
Norris fact, a protein.
 Mostuuuucccaaaggapeopleuacgacuacahaveacccccca cacacacagggaccacauuuuuacagaca23uacagacgacagiua ugacachromosomesacgacagcauuacgacacaguagacach uckuacacacacacagggggcacacacacnorrisuuuuuuuuuc aacaacaacaaggacccaaacaacaahasacacacacagggagagca uuaccaggga72caacaacaacaagaagaauuuuuucaaaanda cacacgguuuauauauauagagacacactheyaccaccaccaccgc cgccuccuucggacaareaaaaaaaaaaaaaaccccalluauauaga gacagacagacgacgauapoisonousuauauagagacagacaga uuuuuugacgacgacuuua.

Rearrange the exons to form a
Chuck Norris fact, a protein.


 Choose any of the 4 gene regulation methods and investigate further
 Must include at least the following
 Title
 Active players
 Action of the players
 Description of process
 How does this process assist eukaryotic organisms in survival