Last updated 10/26/11 http://www.helicosbio.com/Technology/TrueSingleMoleculeSequencing/tabid/64/Default.aspx Like Illumina, but immobilized templates are SS DNA molecules (~200 nt) Each cycle adds one base,records, and then cleaves the fluorescent group and washes it away. Several billion single molecule “spots” per slide. 1 2 3 Helicos paired end sequencing 1 2 3 4 5 6 7 4 Helicos virtual terminator Inhibits DNA Pol once incorporated (so 1 base at a time) Cleavable via the S-S bond (reduce it) Fluorescent tag Free 3’ OH never blocked dUTP dU-3’P,5’P 5 Quantification of the yeast transcriptome by single-molecule sequencing Lipson et al. NATURE BIOTECHNOLOGY 27: 652, 2009 Make cDNA via oligo dT Hybridize to surface-linked oligo dTs Note: no amplifications or ligations Cleave dye from incorporated nt. Wash. Tail 3’ end with A via terminal transferase, adding dT to terminate Add Cy5-labeled special nucleotide tri-Ps + DNA Pol. Wash. Record image. Add next Cy5labeled special nucleotide triPs (A) + DNA Pol. Wash. Record image. 6 smsDGE = digital gene expression via Helicos sequencing and counting MA = microarray data 7 QPCR = quantitative PCR, real time PCR Exponential phase Nonexponential plateau phase CT value Threshold line Bio-rad 8 QPCR (Quantitative PCR) Q-RT-PCR (Quantitative reverse transcription-PCR) Run 96 samples simultaneously 9 Some data produced: Distribution of yeast transcripts mRNA Est. copies/cell: 0.5 5 50 500 TSS = transcription start site t.p.m. = transcripts per million TSS position relative to ATG 10 Complete Genomics (DNA nanoballs) AcuI: a type IIS restriction enzyme RCR = rolling circle replication Rolling circle DNA synthesis (Φ29 polymerase) 11 12 Complete Genomics 13 Complete Genomics\”CPAL Probes degenerate at all but one position, colored for the base at that position. 5 probe sets for positions +1 to +5 relative to anchor end Hybridize, wash, ligate, wash, image. Second anchor set extends 5 nt (degenerate reach). Repeat10 nt sequenced. Repeat with anchors on the other side of the adaptor. Repeat for the other 3 adaptors. Total 70 nts sequenced (theor. = 80) 14 Complete Genomics Est. 1 billion spots (reads) per slide Lower cost 200 human genomes sequenced Business plan: sell sequencing service, not machines 15 http://www.pacificbiosciences.com 16 ZMW = zero mode waveguide 10 zl volume seen (1 zeptoliter = 10-21 L.) One DNA Pol molecule per ZMW Add template and special phospho nucleotides. 17 Cleaved when incorporated Other technologies Phospho-linked fluorescentlylabeled nucleoside triphosphates 18 Excitation Emission 19 20 Use a circular template to get redundant reads and so more accuracy. 21 Pacific Biosciences • 50,000 ZMWs (Aug., 2011), and density may climb • Long reads (e.g., full molecule analysis for splicing isoform) • Direct RNA sequecning possible. • DNA methylation detectable 22 DNA methylation detection by bisulfite conversion 23 Agilent SureSelect RNA Target Enrichment Capture a subgenomic region of interest for economy and speed of sequencing: E.g., the entire exome (all exons w/o introns or intergeneic regions) hundreds of cancer genes a particular genomic locus Alternative: hybridize to a custom microarray. Agilent 24 Applications of “deep” sequencing Also: definition and discovery of cis-acting regulatory motifs in DNA and RNA cytosine Detection of methylated C (~all in CpG dinucleotides) ----CmpG--- > ----CpG-- > ----CmpG--- > < ---G p Cm--DS DNA Na bisulfite Heat Na bisulfite Heat ----CmpG--- > ----UpG-- > PCR ----TpG-- > <--ApC--uracil All NON-methylated Cs changed to T ----CpG-- > <--GpC--- 25 26 DEEP SEQUENCING (Next generation sequencing, High throughput sequencing, Massively parallel sequencing) applications: Human genome re-sequencing (mutations, SNPs, haplotypes, disease associations, personalized medicine) Tumor genome sequencing Microbial flora sequencing (microbiome) Metagenomic sequencing (without cell culturing) RNA sequencing (RNAseq; gene expression levels, miRNAs, lncRNAs, splicing isoforms) Chromatin structure (ChIP-seq; histone modifications, nucleosome positioning) Epigenetic modifications (DNA CpG methylation and hydroxymethylation) Transcription kinetics (GROseq; nascent RNA, pulse labeled RNA) High throughput genetics (QUEPASA; cis-acting regulatory motif discovery) Drug discovery (bar-coded organic molecule libraries) 27 Ke et al, and Chasin, Quantitative evaluation of all hexamers as exonic splicing elements. Genome Res. 2011. 21: 1360-1374 ). Order an equal mixture of all 4 bases at these 6 positions 28 29 Rank 1 2 3 4 5 6 7 8 6-mer AGAAGA GAAGAT GACGTC GAAGAC TCGTCG TGAAGA CAAGAA CGTCGA : 4086 4087 4088 4089 4090 4091 4092 4093 4094 4093 4094 4095 4096 TAGATA AGGTAG CGTCGC CTTAAA CCTTTA GCAAGA TAGTTA TCGCCG CCAGCA CTAGTA TAGTAG TAGGTA CTTTTA -1.0610 ESRseq score (~ -1 to +1) 1.0339 0.9918 0.9836 0.9642 0.9517 Best exonic splicing enhancers 0.9434 0.9219 0.8853 : -0.8609 -0.8713 0.8850 -0.8786 -0.8812 0.8911 Worst exonic splicing enhancers, -0.8933 = best exonic splicing silencers 0.9113 -0.8942 -0.9251 -0.9383 -0.9965 30 Constitutive exons Alternativexons Pseudo exons Composite exon (from ~100,000) 31 31 Sequence of 36 Quality code CGCACTGTGCTGGAGCTCCCGGGGTTAACTCTAGAA abU^Vaa`a\aaa]aWaTNZ`aa`Q][TE[UaP_U] TACACTGTGCTGGAGCTCCCAACGGCAACTCTAGAA a`P^Wa`[`Wa^`X_X_XWVa^NSP]_]S^X_T\X^ CGCACTGTGCTGGAGCTCCCATGGAGAACTCTAGAA aTa`^b``baaaa^aab^YaTQLOHIa`^a``TX]] TACACTGTGCTGGAGCTCCCCTCCCAAACTCTAGAA I_`aaaa`aaaaaaa_a_^[KZIGIGZ`U`\^P^^` CGCACTGTGCTGGAGCTCCCAATAGTAACTTTAGAA aY_\abb[T\abaaa`a`bZ[HXXIZa_`_LGMS[` TATACTGTGCTGGAGCTCCCGACGTAAACTCTAGAA aba]^aa_a]`aa]_]`XWSMFGGIPX[P]X`V_Y^ TACACTGTGCTGGAGCTCCCTGGTAAAACTCTAGAA a_^a^aa`aYaaa_aY`Y_^[I]VY\`]V]R\W]VV TACACTGTGCTGGAGCTCCCAATAAAAACTCTAGAA XZababa`aZaaaaaYaYXX`baa``\\TaUa\aW` Variable region Constant regions (peculiar to our expt.) 2 nt barcode (TA or CG) Experiment: 1 1 1 2 2 1+2 2 2 1 2 32 Next generarion method: Use custom oligo libraries to construct minigene libraries (40,000, up to 60 nt long): E.g., for saturation mutagenesis to identify all exonic bases contributing to splicing (or transcription or polyadenylation, …..) Use bar codes to detect sequences missing from the selected molecules E.g., Nat Biotechnol. 2009 27:1173-5. High-resolution analysis of DNA regulatory elements by synthetic saturation mutagenesis. Patwardhan RP, Lee C, Litvin O, Young DL, Pe'er D, Shendure J. Long (200-mer) synthetic oligo library OUTLINE OF NEXT LECTURE TOPICS Expression and manipulation of transgenes in the laboratory • In vitro mutagenesis to isolate variants of your protein/gene with desirable properties – – – – • To study the protein: Express your transgene – – – – – • • • • • • Single base mutations Deletions Overlap extension PCR Cassette mutagenesis Usually in E. coli, for speed, economy Expression in eukaryotic hosts Drive it with a promoter/enhancer Purify it via a protein tag Cleave it to get the pure protein Explore protein-protein interaction Co-immunoprecipitation (co-IP) from extracts 2-hybrid formation surface plasmon resonance FRET (Fluorescence resonance energy transfer) Complementation readout 33 33 RS1 34 34 RS2 Site-directed mutagenesis by overlap extension PCR PCR fragment subsequent cloning in a plasmid RS1 RS2 Ligate into similarly cut vector Cut with RE 1 and 2 1 2 35 35 Cassette mutagenesis = random mutagenesis but in a limited region: 1) by error-prone PCR --------------------------------------------------------------------------------------------------------------------- Original sequence coding for, e.g., a transcripiton enhancer region PCR fragment with high Taq polymerase and Mn+2 instead of Mg+2 errors ------*--------*--*-**---------------*-----------*--*------*------------------------*-*-*------------*------------*-- Cut in primer sites and clone upstream of a reporter protein sequence. Pick colonies Analyze phenotypes Sequence 36 36 Cassette mutagenesis = random mutagenesis but in a limited region: 2) by “doped” synthesis Target = e.g., an enhancer element ----------------------------------------------------------Original enhancer sequence -----------------------------------------------------------*------------------------*-*-*------------*------------*-------*--------*--*-**---------------*-----------*--*------ Clone upstream of a reporter. Pick colonies Analyze phenotypes Sequence Buy 2 doped oligos; anneal OK for up to ~80 nt. Doping = e.g., 90% G, 3.3% A, 3.3% C, 3.3% T at each position 37 Got this far 38 38 E. coli as a host • PROs:Easy, flexible, high tech, fast, cheap; but problems • • • • • CONs Folding (can misfold) Sorting -> can form inclusion bodies Purification -- endotoxins Modification -- not done (glycosylation, phosphorylation, etc. ) • • • • • • • • • • Modifications: Glycoproteins Acylation: acetylation, myristoylation Methylation (arg, lys) Phosphorylation (ser, thr, tyr) Sulfation (tyr) Prenylation (farnesyl, geranylgeranyl on cys) Vitamin C-Dependent Modifications (hydroxylation of proline and lysine) Vitamin K-Dependent Modifications (gamma carboxylation of glu) Selenoproteins (seleno-cys tRNA at UGA stop) 39 39 Some alternative hosts • • • • Yeasts (Saccharomyces , Pichia) Insect cells with baculovirus vectors Mammalian cells in culture (later) Whole organisms (mice, goats, corn) (not discussed) • In vitro (cell-free), for analysis only (good for radiolabeled proteins) 40 40 Yeast Expression Vector (example) Saccharomyces cerevisiae (baker’s yeast) 2 mu seq: yeast ori oriE = bacterial ori Ampr = bacterial selection LEU2, e.g. = Leu biosynthesis for yeast selection Complementation of an auxotrophy can be used instead of drug-resistance 2 micron plasmid GAPDterm Your favorite gene (Yfg) LEU2 Auxotrophy = state of a mutant in a biosynthetic pathway resulting in a requirement for a nutrient Ampr GAPDprom oriE GAPD = the enzyme glyceraldehyde-3 phosphate dehydrogenase 41 Yeast - genomic integration via homologous recombination t p Vector DNA gfY HIS4 Genomic DNA Genomic DNA HIS4 mutation- t p Yfg Functional HIS4 gene Defective HIS4 gene 42 Double recombination Yeast (integration in Pichia pastoris) P. pastoris -tight control -methanol induced (AOX1) -large scale production AOX1t (gram quantities) HIS4 Vector DNA Yfg 3’AOX1 AOX1p Genomic DNA Alcohol oxidase gene AOX1 gene (~ 30% of total protein) Genomic DNA Yfg AOX1p AOX1t HIS4 3’AOX1 43 PROTEIN-PROTEIN INTERACTIONS Yeast 2-hybrid system to discover proteins that interact with each other Or to test for interaction based on a hypothesis for a specific protein. (bait) Y = e.g., a candidate protein being tested for possible interaction with X ? ? BD = (DNA) binding domain (prey) Or: Y = e.g., a cDNA library used to discover a protein that interacts with X AD = activation domain http://www.mblab.gla.ac.uk/~maria/Y2H/Y2H.html 44 No interaction between X and Y: no reporter expression Yes, interaction between X and Y: reporter protein is expressed: Y = e.g., a cDNA library used to discover a protein that interacts with X Recover the Y sequence from reporter+ colonies by PCR to idenify protein Y 45 Fusion library Bait protein is the known target protein for whom partners are sought =“prey” and/or Two different assays help, as there are often many false positives. BD= DNA binding domain; TA = transactiavting domain http://www.mblab.gla.ac.uk/~maria/Y2H/Y2H.html 46 3-HYBRID: select for proteins domains that bind a particular RNA sequence Prey Bait Prey could be proteins from a cDNA library 47 Yeast one-hybrid: Insert a DNA sequence upstream of the selectable or reporter Transform with candidate DNA-binding proteins (e.g., cDNA library) fused to an activator domain. Each T = one copy of a DNA target sequence 48 Indirect selection using a yeast 3-hybrid system: a more efficient glycosynthase enzyme Directed Evolution of a Glycosynthase via Chemical Complementation Hening Lin,† Haiyan Tao, and Virginia W. Cornish J. AM. CHEM. SOC. 2004, 126, 15051-15059 Turning a glycosidase into a glyco-synthase Glycosidase: Glucose-Glucose (e.g., maltose) + H2O 2 Glucose 49 Indirect selection using the yeast 3-hybrid system (one of the hybrid moelcules here is a small molecule) e.g., from a mutated library of enzyme glycosynthase genes glucose Leu2 gene Leu2 gene Transform a yeast leucine auxotroph. Provide synthetic chimeric substrate molecules. Select in leucine-free medium. DHFR = dihydrofolate reductase GR = glucocorticoid receptor (trancription factor ) MTX = methotrexate (enzyme inhibitor of DHFR) DEX = dexamethasone, a glucocorticoid agonist, binds to GR AD = activation domain, DBD = DNA binding domain 50 Selection of improved cellulases via the yeast 2-hybrid system Survivors are enriched for cellulase genes that will cleave cellulose with greater efficiency (kcat / Km) Cellobiose (disaccharide) URA-3 (toxic) cellulase x x x x Library of cellulase mutant genes (one per cell) Directed Evolution of Cellulases via Chemical Complementation. P. PeraltaYahya, B. T. Carter, H. Lin, H. Tao. V.W. Cornish. JACS 2008, 130, 17446–17452 51 Substrate 52 How does the URA-3 system work? Pathway to pyrimidine nucleotides: 5-fluoroorotic acid 5-Fluoro-OMP URA-3 URA-3 = gene for orotidine phosphate (OMP) decarboxylase decarboxylation (pyr-4) 5-Fluoro-UMP RNA Death Thymidylate Synthetase inhibition Exogenous uridine Ura3+ is FOA sensitive; ura3- is FOA resistant 53 Measuring protein-protein interactions in vitro X=one protein Y= another protein Pull-downs: Binding between defined purified proteins, at least one being purified. Tag each protein differently. Examples: His6-X + HA-Y; Bind to nickel ion column, elute (his), Western with HA Ab GST-X + HA-Y; Bind to glutathione ion column, elute (glutathione), Western with HA Ab His6-X + 35S-Y (made in vitro); Bind Ni column, elute (his), gel + autoradiography. No antibody needed. (HA = influenza virus flu hemagglutinin) glutathione = Gamma-glutamyl-cysteinyl-glycine. 54 Example of a result of a pull-down experiment Also identfy by MW (or mass spec) Antibody used in Western Total protein: no antibody or Western (stained with Coomassie blue or silver stain) Compare pulled down fraction (eluted) with loaded 55 Western blotting To detect the antibody use a secondary antibody against the primary antibody. The secondary antibody is fusion protein with an enzyme activity (e.g., alkaline phosphatase). The enzyme activity is detected by its catalysis of a reaction producing a luminescent compound. http://www.bio.davidson.edu/courses/genomics/method/Westernblot.html 56 Detection of antibody binding in western blots Antibody to protein on membrane Alkaline phosphatase fusion Non-luminescent substrate-PO4 = Luminescent product + PO4= Secondary antibody-enzyme fusion Detect by exposing to film (e.g., goat anti-rabbit IgG) Protein band on membrane 57 Far western blotting to detect specific protein-protein interactions. Use a specific purified protein as a probe instead of the primary antibody To detect the protein probe use an antibody against it. protein protein Then a secondary antibody, a fusion protein with an enzyme activity. The enzyme activity is detected by its catalysis of a reaction producing a luminescent compound. http://www.bio.davidson.edu/courses/genomics/method/Westernblot.html 58 Expression via in vitro transcription followed by in vitro translation T7 RNA polymerase binding site (17-21 nt) VECTOR cDNA ….ACCATGG….. Radioactively labeled protein 1. Transcription to mRNA via the T7 promoter + T7 polymerase 2. Add to translation system: rabbit reticulocyte lysate or wheat germ lysate Or: E. coli lysate (combined transcription + translation) All commerically available as kits Add ATP, GTP, tRNAs, amino acids, label (35S-met), May need to add RNase (Ca++-dependent) to remove endogenous mRNA In lysate NOTE: Protein is NOT at all pure (100s of lysate proteins present), just “radio-pure” 59 Co-immunoprecipitation • Most times not true precipitation, which requires about equivalent concentrations of antigen and antibody • Use protein A immobilized on beads (e.g., agarose beads) • Protein A is from Staphylococcus aureus: binds tightly to Immunoglobulin G (IgG) from many species. Does X interact with Y in the cell or in vitro? B Y X Y Y incubate C X D X A A X Y A A A Wash by centrifugation (or magnet) Elute with SDS Detect X, Y in eluate by Western blotting Y + Protein A X A A A D A A X A C Y A A + X Or cell extract Y B A A A A A B + C X Y D Surface plasmon resonance (SPR) The binding events are monitored in real-time and it is not necessary to label the interacting biomolecules. glass plate http://home.hccnet.nl/ja.marquart/BasicSPR/BasicSpr01.htm 60 Expression in mammalian cells Lab examples: HEK293 Human embyonic kidney (high transfection efficiency) HeLa Human cervical carcinoma (historical, low RNase) CHO Chinese hamster ovary (hardy, diploid DNA content, mutants) Cos Monkey cells with SV40 replication proteins (-> high transgene copies) 3T3 Mouse or human exhibiting ~regulated (normal-like) growth + various others, many differentiated to different degrees, e.g.: BHK Baby hamster kidey HepG2 Human hepatoma GH3 Rat pituitary cells PC12 Mouse neuronal-like tumor cells MCF7 Human breast cancer HT1080 Human with near diploid karyotype IPS induced pluripotent stem cells and: Primary cells cultured with a limited lifetime. E.g., MEF = mouse embryonic fibroblasts, HDF = Human diploid fibroblasts Common in industry: NS1 Mabs Vero vaccines CHO Mabs, other therapeutic proteins PER6 Mabs, other therapeutic proteins Mouse plasma cell tumor cells African greem monkey cells Chinese hamster ovary cells Human retinal cells 61 62