Department of Pharmaceutics
School of Pharmacy
Center for DNA Sequencing and Gene Analysis
H260 Health Sciences Center
Box 357610
Seattle, WA 98195 -7610
(206) 616-8718
Fax: (206) 543-3204
June 29, 2006
Draft SOP for GSTA1 gene promoter genotyping
The template for PCR amplification evaluated to date include buccal cell DNA, liver DNA and WBC
DNA. The assay has given readable DNA sequence with input DNA ranging from 25-200 ng. The
primers for PCR amplification are taken from Pharmacogenetics, 11, 663-669.
PCR reaction conditions:
2.5 ul Pfu 10X buffer
0.5 ul 10 mM dNTPs (200 uM final)
0.5 ul Pfu HotStart Turbo DNA polymerase (Stratagene #600320)
0.125 ul primer AF7-100 uM stock-500 nM final concentration (5’GATCTAGGGATTTCTATATGGACCT3’)
0.125 ul primer AR1-100 uM stock-500 nM final concentration (5’TTAAACGCTGTCACCGTCCTGGCT3’)
1 ul template DNA
18.75 ul Dnase/Rnase free ddH20
Cycling Conditions:
1-95˚C-2 min
2-95˚C-30 sec
3-60˚C-30 sec
4-72˚C-2 min
repeat steps 2-4 for 40 cycles
5-72˚C-7 min
6-4˚C-hold
Following PCR, store at –20˚C or proceed with amplicon purification using Qiamp PCR purification kit
(Qiagen #28104) protocol with the final elution step being 30 ul of elution buffer AE. For the sequencing,
use 5 ul of the purified amplicon. Perform 2 separate reactions using primer AF7 and GSTA1.seq.for* (0.5
ul 10 uM stock).
*initial experiments using primer AR1 for sequencing was unsuccessful due to minor non-specific
amplification; GSTA1.seq.for (5’CCAGCTATGCTCACAGTAGAG3’) eliminated this problem.
Room H260 Health Sciences Building, Box 357610 Seattle, Washington 98195-7610 (206) 616-8718 FAX: (206) 543-3204
edkelly@u.washington.edu http://depts.washington.edu/pceut/pceut_services/index.html