Answers to Review Questions - Chapter 14
1. What types of subunits make up a single strand of DNA? How are the subunits
linked?
The subunits of DNA are nucleotides. They are linked together by
phosphodiester bonds between the 5' phosphate group of one nucleotide and the 3'
hydroxyl group of another nucleotide.
2. What is meant by the 5' "end" of a DNA strand? What is meant by the 3' "end"?
The 5' end of a DNA strand refers to the end containing an "open" 5' carbon - no
other nucleotide is attached via a phosphodiester bond at that carbon. The
opposite end of the strand will likewise have an "open" carbon that is not
participating in a bond - this will be a 3' carbon of a nucleotide.
3. What is the structure of DNA, as determined by Watson and Crick?
Watson and Crick determined that it is a double helix with a sugar-phosphate
backbone. These strands of the backbone are antiparallel, so one runs in a 3’ to 5’
direction, the other in the opposite direction.
4. What are Chargaff's rules?
Chargaff's rules state that for every A in a DNA strand, there will be a T in the
complementary strand; for every G, there is a C. The A:T ratio between
complementary strands will always be 1:1, as will the G:C ratio.
5. Does a single strand of DNA follow Chargaff's rules? Why or why not?
No, a single strand (side) of the DNA molecule does not follow Chargaff’s rule.
An equal amount of complementary bases (A and T; G and C) would only be
present if the DNA is double-stranded.
6. What would be the complementary strand for the following strand of DNA? (Be
sure to indicate 5' and 3' ends…):
5' - ACAGGCATTAGCCAGTACCAGTTAGACT - 3'
3' - TGTCCGTAATCGGTCATGGTCAATCTGA - 5'