Bio 1 General Biology – Exam 2 Outline
Powering Life: Energy (Chapter 6)
How is a cell able to perform all of its functions to survive?
I. Energy
A. Two forms of energy
1. Potential energy
Examples?
2. Kinetic energy
Examples?
Energy can be changed from one form to another!
Ex. Food = potential energy which changes into kinetic energy when organism moves around or grows
B. Thermodynamics – the study of energy and its transformations
1. First Law of Thermodynamics (Conservation of Energy)
a. Organisms cannot create energy that it needs to live. It must capture it from the environment and
change it into a usable form.
Ex. Photosynthesis –uses sunlight energy and converts it to chemical energy contained in the bonds in
sugars that plant produces.
Ex. Animals eat food, which is transformed to chemical energy, which is transformed into mechanical
energy, muscle movement etc.
2. Second Law of Thermodynamics
a. Whenever energy is converted, some useable energy is degraded into a less useable and ordered form
(heat). We are not losing energy just changing it to a less useable form.
Ex. Food is used for movement which releases heat energy (less usable form)
b. No process involving energy conversion is 100% efficient.
Why?
As a result, what happens to the amount of useable
energy over time?
3. The Laws of Thermodynamics and Us
a. What do Arctic peoples tend to produce more of?
b. What is the upside of this extra production?
c. What is the downside of this extra production?
View course website animations on energy
D. Measuring Energy
1. Calorie
Ex. Can measure caloric content of a peanut (or any food) by
burning it under a container of water to convert all of the stored
chemical energy to heat and then measure the temperature increase
of the water
2. Kilocalories (kcal) – units of 1,000 calories; calories on food
packages are actually kilocalories
Ex. One peanut has 5 food calories (5 kcal) which is enough energy
to increase temp. of 1 kg (a little more than a quart) of water by 5º
C. A handful would boil 1 kg of water.
II. How Energy Is Used By Living Things (The Energy Molecule: ATP)
Carbs, fats and other fuel molecules we get from food do not drive work in our cells. They must be broken down
so that their energy is released.
Chemical energy (ATP) is released by the breakdown of organic molecules during cellular respiration. In what
organelle does ATP production occur?
ATP then powers cellular work.
A. ATP (Adenosine triphosphate) – the energy molecule (Fig. 6.6)
1. 3 phosphate groups each with a negative charge.
2. When energy is needed, ATP is broken down, a
phosphate is removed, & energy is released.
3. When cell needs a place to store energy, a phosphate
is added back on.
B. Renewable ATP (Fig. 6.6)
1. A working cell recycles all of its ATP about once each minute. That is
about 10 million ATP molecules spent and regenerated per second per
cell.
2. ATP can be restored by adding a phosphate group back to ADP.
3. This takes energy; like recompressing a spring
4. This is where food enters the story. Chemical energy that cellular
respiration harvests from food is put to work regenerating the cell’s
supply of ATP.
III. Using Energy Efficiently with Enzymes
Read pp. 115-116: “Efficient Energy Use in Living Things: Enzymes”
and answer the following:
A. What is an enzyme?
B. What is our metabolism and how are enzymes involved in our metabolism?
C. How Enzymes Work (Fig. 6.9)
1. Enzymes enable reactions to occur faster by reducing the amount of energy required to get reactions going.
2. Enzymes bind to their substrate which makes the substrate more vulnerable to chemical alteration.
3. Each enzyme is specific to the reaction it speeds up (> 5000 enzymes exist)
Ex. Lactase = enzyme that breaks down lactose (milk sugar)
4. Vitamins help enzymes bind to their substrates.
View course website animations on enzymes.
D. What will stop enzymes from working?
Energy for Cells: Cellular Respiration (Chapter 7)
How Cells Gain Energy (ATP) From Food: This is done by a
process called cellular respiration
I.
Aerobic Cellular Respiration – how cells harvest energy
(ATP) from organic molecules (food) using oxygen
A. General Characteristics:
1. Cellular respiration requires cells to take in oxygen
and glucose and release wastes in the form of carbon
dioxide and water. Cellular respiration is the reason
why we breathe and eat.
B. Why is oxygen important to aerobic cellular respiration?
1. Equation for cellular respiration:
Where did the hydrogens (electrons) in glucose go?
2. These electrons (hydrogens) hold energy (high energy electrons)
What type of energy are they holding, potential or kinetic?
3. When high energy electrons (hydrogens) change partners, from sugar to oxygen, the energy is released
a. Electrons (hydrogens) are strongly attracted to oxygen.
4. How do high energy electrons (hydrogens) make their way from glucose to oxygen? (Fig. 7.3)
a. Electrons (hydrogens) are carried to oxygen by electron carriers called NAD+ and FAD
b. NAD+ (nicotinamide adenine dinucleotide) accepts electron (hydrogen) from glucose and becomes
NADH. FAD accepts electrons (hydrogens) and becomes FADH2
c. Electrons carried by electron carriers are taken to the electron transport chain (the last step in aerobic
cellular respiration)
d. Oxygen pulls the energy filled electrons through the electron transport chain and the energy is released.
C. The Mitochondria – where cellular respiration (energy production) occurs
1. Mitochondria Anatomy:
a. Cristae
b. Matrix
D. 4 Steps of Cellular Respiration: 1) Glycolysis, 2) Intermediate Step, 3) Krebs
(Citric Acid) Cycle and 4) the Electron Transport Chain (ETC) (Fig. 7.4)
All four steps together produce 36 - 38 ATP!
- Glycolysis = more ancient; least efficient step (found in all organisms)
- Other 3 steps = evolved later; are more efficient (not found in all organisms)
1. Glycolysis ‘sugar splitting’ (Fig. 7.5)
a. Glucose enters cell from bloodstream and is broken down into 2 pyruvates
b. Electrons (hydrogens) are removed by electron carriers NAD+ forming NADH (high energy electron)
c. 4 ATP are produced and 2 ATP are used producing a net gain of 2 ATP
d. Location of this step?
INPUTS:
OUTPUTS:
View course website animations on
Glycolysis
2. Intermediate Step (Fig. 7.7)
a. Each pyruvate is broken down further into
Acetyl CoA
b. Electron (hydrogen) is removed by electron
carrier NAD+ forming NADH (high energy
electron)
c. CO2 is released
d. Location of this step?
INPUTS:
OUTPUTS:
3. Krebs (Citric Acid) Cycle (Fig. 7.8)
a. Acetyl CoA is broken down and CO2 is
produced and released
b. Electrons (hydrogens) are removed by
electron carriers NAD+ & FAD forming
NADH and FADH2 (high energy electrons)
c. 2 ATP are produced
d. Location of this step?
INPUTS:
OUTPUTS:
View course website animations on the Krebs (Citric Acid) Cycle
4. Electron Transport Chain (Fig. 7.9) (bulk of ATP is produced here)
a. Receives the high energy electrons (hydrogens) from NADH and FADH2 (produced from previous
steps)
b. Electrons (hydrogens) are run along enzymes
c. This powers the process of the 3rd phosphate group to attach to ADP to make ATP (recompressing the
spring) producing 32-34 ATP
d. Electrons (hydrogens) are finally
accepted by oxygen (the final
electron acceptor) producing water
e. Location of this step?
INPUTS:
OUTPUTS:
View course website animation on the
Electron Transport Chain
It takes about 10 million ATP molecules per second to power an active muscle cell!
Aerobic Cellular Respiration Review
E. Energy From Food: We concentrated on the breakdown of glucose but cellular respiration also breaks down
other foods to produce ATP (Fig. 7.10)
View course website animation on Cellular Respiration
II. Anaerobic Cellular Respiration (Fermentation) - the harvesting of chemical energy (ATP) from organic fuel
molecules (food) without using oxygen
What step in aerobic cellular respiration does not require oxygen? Does this step produce a lot or little ATP?
What kind of organisms can do this and why would they do this?
A. Fermentation in Microbes
1. Yeast – (a single-celled fungus) can live by glycolysis alone if it is placed in an environment that lacks
oxygen
a. What waste products are produced when
yeasts only use glycolysis to produce
their ATP?
b. How do we take advantage of these
waste products?
B. Fermentation in Animal Muscle Cells
1. During quick bursts of energy use, oxygen cannot be delivered
into muscle cells fast enough, so they turn to glycolysis to
supply ATP.
2. What waste product is produced when muscle cells only use
glycolysis to produce their ATP?
lactate
Cellular Respiration & Metabolic Rates (Activity Level)
Different types of animals will undergo cellular respiration and produce energy at different rates. And, their activity
levels will depend on how fast they produce energy.
I. Ectothermic animals (ecto = outside; therm = heat) - internal body temperature is controlled by temperature of
environment
A. Examples??
B. Ectothermic animal characteristics:
1. Are they able to internally regulate their body temperature?
2. Do they exist at same temperature as their surroundings?
3. How do they obtain their body heat?
4. How is metabolic rate (activity level) affected when environmental temperature changes?
5. How will the process of cellular respiration be affected when it is in a warm environment? When in a cold
environment?
II. Endothermic animals (endo = inside; therm = heat) - internal temperature is controlled by internal metabolism
A. Examples?
B. Endothermic animal characteristics:
1. Are they able to internally regulate their body temperature?
2. Do they exist at same temperature as their surroundings?
3. How do they obtain their body heat?
4. How is metabolic rate (activity level) affected when environmental temperature changes?
5. How will the process of cellular respiration be affected when it is in a warm environment? When in a cold
environment?
III. Advantages & Disadvantages of Being Ectothermic
IV. Advantages & Disadvantages of Being Endothermic
Energy for Life: Photosynthesis (Chapter 8)
I. Autotrophs vs. Heterotrophs
A. Autotrophs (producers) – “self-feeders”
B. Heterotrophs (consumers & decomposers) – “other-feeders”
II. Photosynthesis – the process that transforms simple molecules (CO2) into more complex molecules
(carbohydrates) using H2O, minerals and sunlight
Carbon dioxide and water are the end products of what process?
Where did the hydrogens (electrons) in water go?
How is energy being transformed during photosynthesis?
What is the fate of glucose produced from photosynthesis?
A. Components of Photosynthesis
1. Photosynthesis is driven by visible light (Fig. 8.3)
a. Why are plants green?
- What colors of light are absorbed?
- What color of light is reflected?
2. Chloroplasts – organelles where photosynthesis occurs (Fig. 8.4)
a. Thylakoids
b. Stroma
3. The Leaf (Fig. 8.4)
a. Stomata
Where are stomata located?
B. 2 Stages of Photosynthesis: (Fig. 8.9)
1. Light Reactions (“photo” part of photosynththesis) (Fig. 8.7): converts solar energy to chemical energy
H2O + light energy
O2 + electron (hydrogen) carriers (NADPH) + ATP
Location of this step?
INPUTS:
OUPUTS:
View course website animation on the Light Reactions
2. Calvin Cycle Reactions (“synthesis” part of photosynthesis) (Fig. 8.8): makes glucose from CO2
electron carriers (NADPH) + ATP + CO2
glucose
Location of this step?
INPUTS:
OUPUTS:
View course website animation on the Calvin Cycle and on Photosynthesis
Photosynthesis produces our planet’s oxygen as well as 155 billion tons of biomass each year (about 25 tons for
every person on earth)!
C. Variations of Photosynthesis in Different Climates
Read p149-152 “Photorespiration and the C4 Pathway” and p. 152-153 “CAM Photosynthesis” and visit
the website http://wc.pima.edu/~bfiero/tucsonecology/plants/plants_photosynthesis.htm to answer the
following questions:
1. What necessary molecule does the enzyme rubisco capture from the atmosphere for plants?
2. What unnecessary molecule will rubisco sometimes capture instead and what is this process known as?
3. Briefly state 1) when C3 plants open their stomata, 2) the adaptive value of C3 photosynthesis 3) the
problems with C3 photosynthesis when dealing with water loss and photorespiration in warm climates and
4) the types of plants that use this process.
4. Briefly state 1) when C4 plants open their stomata, 2) the adaptive value of C4 photosynthesis when
dealing with water loss and photorespiration in warm climates and 3) the types of plants that use this
process.
5. Briefly state 1) when CAM plants open their stomata, 2) the adaptive value of CAM photosynthesis when
dealing with water loss in hot, dry climates and 3) the types of plants that use this process.
D. Using Photosynthesis to Fight Climate Change
1. Read p. 150-151 “Using Photosynthesis to Fight Global
Warming” and answer the following:
a. Why are trees known as carbon sinks?
b. Describe a possible way to increase photosynthesis worldwide.
c. Describe a possible way to lock up the products of photosynthesis so that they don’t decay and then
don’t release carbon dioxide.
d. Describe two other possible carbon capture ideas.
2. Watch the video called “Capturing Carbon” and answer the following:
http://www.pbs.org/wgbh/nova/sciencenow/0302/03.html
a. Briefly describe this “green machine” that has been invented and state what it does.
b.
What problem can this invention help solve?
3. Watch the video called “Algae Fuel” and answer the following:
http://www.pbs.org/wgbh/nova/sciencenow/0406/02.html
a. Photosynthesizing algae produce oxygen, sugar, and what other product which can be converted into
biodiesel (biofuel)?
b. What are the two major disadvantages of producing corn based ethanol as biofuel?
c. What is the advantage of producing algae for biofuel?
d. What is the disadvantage of producing algae for biofuel?
III. The Big Picture: Energy flow in living things
DNA & Protein Synthesis (Chapter 13 & 14)
I. The Discovery of the Double Helix
A. Prior to the discovery of DNA structure:
1. By 1920 – knew that genetic info resided on chromosomes but nobody could really say what a gene looked
like and how it exactly worked
2. By 1930’s & 40’s knew that genes bring about the production of proteins
3. By 1940’s & 50’s knew that genes are composed of deoxyribonucleic acid (DNA) but did not know how it
carried out its function or how DNA can be copied.
B. The Scientists Involved in the Race to Discover the Structure of DNA:
1. Linus Pauling of Caltech: was most likely to solve DNA structure. He studied chemistry of large organic
molecules and was an expert in X-ray crystallography (diffraction) (bombarding crystals of organic
molecules such as DNA with X-rays and recorded how X-rays bounced off molecules.
2. Rosalind Franklin and Maurice Wilkins: researchers from King’s College London also experts in X-ray
diffraction and had good idea of general shape DNA but their approach was slow.
3. James Watson (23 year old American) & Francis Crick (35 year old Englishman): met in Cambridge
University, England in 1951. Did not have expertise on chemical bonds or X-ray crystallography like the
others and did no experiments like the other two. Built models based off of Franklin’s and Wilkin’s data
and pictures.
C. The Discovery and After:
1. In 1953, Watson and Crick discovered the double helix structure.
2. In 1958 at the age of 37 Rosalind Franklin died
3. In 1962 Watson, Crick & Wilkins were awarded he Nobel Prize for
Medicine or Physiology.
II. Deoxyribonucleic Acid (DNA) Structure (Fig. 13.5)
A. DNA Parts:
1) Phosphate group
2) Deoxyribose (sugar)
3) Bases: adenine (A), guanine (G), thymine (T) or cytosine (C)
What bases pair up?
B. DNA Replication (How DNA makes a copy of itself) (Fig. 13.6)
Do you see a template?
Because of the variety of base pairs, DNA is versatile enough to specify the
array of proteins that exists when strung together by the thousands.
View course website animation on DNA Replication
III. How is this genetic information used?
A. Genotype
B. Phenotype
Does genotype largely determine phenotype?
C. Relationship between genotype and protein molecules that determine the phenotype:
1. Gene
IV. How Proteins Are Made
A. Protein structure (fig. 14.1)
1. Monomer unit of a protein?
2. What is a protein polymer called?
3. When is a protein considered a “working protein”?
2 steps of protein synthesis:
B. Transcription – process by which genetic info in DNA is copied onto
messenger RNA (mRNA) (Fig. 14.2 & 14.4)
1. Where does transcription occur in a cell?
2. DNA is unwound and complementary RNA nucleotides pair up with
DNA strand to form a copy called messenger RNA (mRNA). What
does Adenine on DNA strand link with on RNA strand?
3. Three mRNA bases (codon) specifies a single amino acid
(Fig. 14.5)
View course website animation on Transcription
C. Translation – process by which info encoded in mRNA is
used to assemble a protein at a ribosome (Fig. 14.2, 14.6,
14.7, 14.8, 14.9)
1. Where does translation occur in a cell?
2. Transfer RNA (tRNA) brings amino acids to ribosome to
be strung together in the order specified by mRNA codons
View course website animation on Translation
Protein Synthesis: Transcription & Translation
View course website animation on Protein Synthesis: All Steps
TIME TO PRACTICE!
The following is a DNA strand (gene) that contains the instructions for building a specific protein:
TACGTTGCGATACCTGGGATT
1. Transcribe this gene by writing out its correct mRNA strand.
2. Where does this step occur in a cell?
3. Now translate the mRNA strand that you have just made by using the genetic code below. You are building an
amino acid chain (polypeptide)! You can just write the abbreviations for each amino acid. For this exercise we will
not use tRNA but keep in mind tRNA would bring the correct amino acid in by pairing its anti-codon to each
codon.
4. Where does this step occur in a cell and what organelle is responsible for this step?
3. Once the amino acid chain enters the rough ER and takes its proper shape, it is a working protein!
V. The Genetic Code
A. What is it?
1. The sequences of bases in mRNA codes for a particular sequence of amino acids in a polypeptide.
2. Triplet codes of mRNA bases specify each of the 20 amino acids
B. The genetic code is shared by all organisms, which means the code is universal! Why is this universality of the
genetic code important to science?
Read p. 254 Essay “The Importance of the Genetic Code” and answer the following:
1. The fact that the code is universal turned out to be important in two ways. The first way increased our
knowledge of evolution. In terms of evolution, what is this universality evidence of?
2.
The second importance of this universality turned out to have a practical consequence. What does this
mean in terms of genes functioning in different organisms?
State both a bad and good consequences of this universality.
VI. Genome – complete haploid set of an organism’s chromosomes (DNA)
- Human Genome Project was completed in 2004.
- Human genome is 3.2 billion base pairs long.
- Human genome is thought to have 20,000 – 25,000 genes
- DNA in just one of our cells would stretch to about 6 ft. in length if uncoiled. Only about 1 in. of this length is
DNA that codes for proteins. DNA in all of our cells (~ 100 trillion) would stretch from here to the moon!
VII. Gene Mutation
A. Types of Mutations
1. Point Mutation (Base Substitutions)
Ex. Sickle cell anemia
Will point mutations always change the amino acid sequence
of protein that is produced? Why or why not?
2. Frameshift Mutation (Nucleotide Insertion/Deletion)
What type of mutation has a greater overall effect on protein production and why?
B. What causes DNA to mutate?
1. Some mutagens cause cancer.
Cancerous growths are cells that have undergone a special kind of mutation that causes the affected cells to
reproduce wildly. Once cells start multiplying, they move into normal tissues & destroy ability to function.
C. Mutations can be good. How so?