Name: ____________________________
Stem Cells, Cell Cycle, Cancer, Protein Synthesis – Review Topics Academic
1. Why Do cells divide instead of growing: 2 reasons
2. What is a diploid cell? Provide an example.
3. What are homologous chromosomes? Provide a drawing.
4. Know the events of the cell cycle – Interphase (G1, S phase, G2) and M-phase (Mitosis)
and (Cytokinesis)
5. Be able to define Mitosis and Cytokinesis
6. What forms between an animal cell and a plant cell during Cytokinesis (cleavage
furrow(animal cells) and cell plate (plant cells)). Explain these terms.
7. What is the role of cyclin in cell division?.
Cell Cycle
a.Cancer
b.Cell Cycle
c.Cytokinesis
e.Interphase
f.Benign Tumor
g.Diploid Cell
d.Malignant tumor
h.Cyclin
i.Mitosis
Matching: Match the correct letter with the correct description. Words are used only once. (19)
______ 1. Uncontrolled cell growth of abnormal cells
______ 2. A fast growing tumor that spreads to other parts of
the body.
______ 3. A series of events a cell goes through as it grows and
divides.
______ 4. Cell that contains two sets of DNA. One set from
mom and the other set from dad.
______ 5. Division of the nucleus
______ 6. A slow growing tumor that does not spread to other
parts of the body.
______ 7. Division of the cytoplasm
______ 8. Part of the cell cycle where the cell grows and the
DNA replicates.
______9. Proteins that supervise the cell cycle.
Short Answer:
1. Why do cells need to make new ones? Provide three reasons.
2. Describe how a tumor forms.
3. How is a malignant tumor different from a benign tumor? Use the word metastasizes in
your answer.
4. A human somatic cell contained 46 pieces of DNA, how many pieces of DNA will be found
in the cell after Interphase?
5. A human somatic cell contained 46 pieces of DNA, how many pieces of DNA will be found
in the nuclei at the end of Mitosis?
6. A human somatic cell is said to be 2N. What does the 2 and the (N) stand for?
7. An Avatar somatic cell has an N value of 26, what is its diploid number for the Avatar’s
cell?
8. If you know that the diploid number for a cell is 64, how many pieces of DNA did mom
contribute to this cell?
9. What are the two parts of the cell cycle?
10. What is mitosis?
11. What is cytokinesis?
12. Complete the graphic organizer below for a made up cell:
12
Original Cell
Interphase
M-phase
Daughter Cells
Protein Synthesis –
Use the following DNA sequence to answer the questions that follow:
Gene: TACGCCGTAAATCGTGGTAACGCCATC
1.
What will be the mRNA that results from transcription?
2. What anticodons will the tRNAs have for this mRNA?
3. What amino acids will make up the protein?
Understand how the process of protein synthesis works:
1. Transcription: GOAL?
a. where does it occur?
b. What is the role of RNA polymerase in this process?
c. How is mRNA made?
d. Where does the mRNA go from here?
2. Translation: GOAL?
a. Where?
b. Role of ribosome?
c. Role of tRNA?
d. What is a codon?
e. What is the start codon?
f. What are the stop codons?
g. What could happen if one letter of the DNA was to change (mutate). Explain the
possibilities.
h. How do proteins generate traits?
i. How many different amino acids are there, and what is their role in translation?
j. Where did the amino acids floating in your cells’ cytoplasm come from?
3. Stem cells:
a. what are they?
b. why are they controversial?
c. what is stem cell differentiation?
d. How could stem cells help to treat diseases?