Derivation of Type II Pneumocytes from Murine
Embryonic Stem Cells: In Vivo Role in Lung
Regeneration and Repair
David Fernandes Braga Malta
Dissertação para a obtenção do Grau de Mestre em
Engenharia Biológica
Júri
Presidente:
Orientadores:
Vogais:
Professor Luís Fonseca
Professor Joaquim Sampaio Cabral
Doutora Sile Lane (SCRM/ICL)
Doutora Cláudia Lobato da Silva
Doutora Raquel Gonçalves (IBMC/INEB)
Setembro 2007
i
Acknowledgments
Imperial College of London
I would like to thank my supervisor, Dr. Sile Lane, for teaching, guiding and helping me
throughout the course of my project and for her help with the manuscript.
I am thankful to Dr. Anne Bishop for allowing me to join her group.
I would also like to thank Dr. Helen Rippon for letting me participate in her project.
The contributions of the following people in this project are also gratefully acknowledged:
Dr. Siti Ismail for her help with the day-to-day work in the laboratory.
Dr. Masao Takata for providing the LPS-induced lung injury mice and performing the in vivo
experiments.
Niga Nawroly for her expertise with the FACS machine.
Instituto Superior Técnico
I would like to thank Professor Joaquim Cabral for opening the doors of his laboratory where I
was trained and for helping whenever I needed.
I am thankful to Dr. Cláudia Lobato for introducing me and sharing her passion for scientific
research and for all her help with the manuscript.
I would also like to thank Dr. Margarida Diogo for teaching me almost everything I know of
murine ESC culture and helping me revising the manuscript.
ii
Abstract
Lung diseases are estimated to be the third leading cause of death by 2020. For
many patients the only available clinical treatment is transplantation, but the number of
available organs is far surpassed by the demand. The possibility of an alternative means of
lung regeneration and repair would be of enormous clinical impact.
Embryonic stem cells (ESCs) are a potential source for cell therapy and tissue
engineering strategies and, for respiratory disease, distal gas exchange epithelium is an
obvious target.
The present study investigates the potential of murine ESCs to provide an unlimited
source of distal lung progenitor cells and evaluates for the first time their in vivo role in lung
regeneration and repair.
Murine ESC cultures were enriched for mature distal airway epithelial cells and their
progenitors using a well-established protocol. This population was labelled using fluorescent
markers and delivered to healthy and lung injured mice via tail vein injection. Mice were culled
at various time points and implanted cells were traced. Labelled cells were present in the
lungs of both healthy and injured mice up to 5 days after implantation.
Overall, the presented studies provide evidence for the potential of ESC-derived lung
progenitors to home to the lung in what is an important first step towards stem cell-based lung
therapies.
Lung; Tissue Engineering; Stem Cells; Regenerative Medicine
iii
Resumo
As doenças pulmonares resultam potencialmente em taxas de mortalidade elevadas,
estimando-se que em 2020 estas possam constituir a terceira maior causa de morte nos
países desenvolvidos. Esta elevada taxa de mortalidade resulta de o único tratamento
disponível para a maioria destas doenças, ser o transplante e de o número de órgãos
disponíveis ser claramente insuficiente. Assim, a possibilidade de um método alternativo de
regeneração do tecido pulmonar teria indubitavelmente um enorme impacto ao nível clínico.
As células estaminais embrionárias (CEE) assumem um papel central na área da
medicina regenerativa, pois representam uma fonte inesgotável de células para terapia
celular e engenharia de tecidos. No caso do pulmão, o objectivo central é a obtenção do
epitélio alveolar responsável pela troca gasosa que aí decorre.
Neste âmbito, este estudo investiga o potencial das CEE como fonte de células
progenitoras do pulmão e avalia o seu potencial in vivo na regeneração do tecido pulmonar.
Para atingir o objectivo proposto, as células progenitoras do pulmão foram derivadas
a partir de CEE de ratinho com base num protocolo previamente estabelecido. Esta
população foi então marcada com uma sonda fluorescente e administrada a ratos saudáveis
e doentes através de injecção na veia da cauda, sendo os ratos sacrificados após diferentes
intervalos de tempo. Verificou-se que as células administradas estavam presentes nos
pulmões dos animais até cinco dias após a implantação.
Este resultado constitui a primeira evidência da capacidade de células progenitoras
do pulmão derivadas a partir de CEE para participar in vivo na regeneração do pulmão.
Pulmão; Engenharia de Tecidos; Células Estaminais; Medicina Regenerativa
iv
Table of Contents
Acknowledgments ......................................................................................................................ii
Abstract...................................................................................................................................... iii
Resumo .....................................................................................................................................iv
List of Abbreviations ................................................................................................................. vii
List of Figures ............................................................................................................................ix
List of Tables ............................................................................................................................ xii
1
Introduction ....................................................................................................................... 1
1.1
Aims of the Study and Experimental Approach............................................................ 2
1.2
Lung.............................................................................................................................. 3
1.2.1
1.2.2
Lung Development .......................................................................................... 3
Lung Biology.................................................................................................... 3
1.3
Embryonic Stem Cells .................................................................................................. 5
1.4
Lung Injury and Repair ................................................................................................. 6
1.4.1
1.4.2
1.4.3
1.4.4
1.5
Tissue Engineering: Creating Lung Tissue Ex-Vivo ................................................... 12
1.5.1
1.5.2
2
2.1
Derivation of Type II Pneumocytes from Murine ESCs................................. 12
Implantation of Murine ESC-Derived Lung Cell Progenitors ......................... 13
Materials and Methods.................................................................................................... 15
Cell Culture ................................................................................................................. 15
2.1.1
2.1.2
2.2
Lung Endogenous Stem Cells......................................................................... 6
Tracheal and Bronchial Stem Cells ................................................................. 6
Bronchiolar Stem Cells .................................................................................... 7
Alveolar Stem Cells ......................................................................................... 7
Lung Exogenous Stem Cells ........................................................................... 8
Bone Marrow–Derived Cells............................................................................ 8
Side Population Cells .................................................................................... 10
Stem Cells and Inflammatory Response ....................................................... 10
Lung Injury Models ........................................................................................ 10
Maintenance of Murine ESCs........................................................................ 15
Differentiation of Murine ESCs into Lung Cell Progenitors ........................... 15
Cell Culture Characterization...................................................................................... 16
2.2.1 Flow Cytometry.............................................................................................. 16
2.2.2 Reverse Transcription-Polymerase Chain Reaction ..................................... 16
2.2.3 Immunocytochemical Characterization of the Murine ESC-Derived Lung Cell
Progenitors ................................................................................................................. 17
2.2.4 Microscopy .................................................................................................... 18
2.3
Cell Implantation......................................................................................................... 19
2.3.1
2.3.2
2.3.3
Labelling of Differentiated Cells..................................................................... 19
In vivo Studies ............................................................................................... 19
Tissue Recovery and Histological Analysis................................................... 20
Harvesting Tissues from Implanted Mice ...................................................... 20
v
2.3.4
3
Tissue Freezing ............................................................................................. 20
Cryostat Sectioning ....................................................................................... 20
Microscopy .................................................................................................... 20
Fluorescent In Situ Hybridization (FISH) for Y chromosome ........................ 20
Results ............................................................................................................................ 22
3.1
Differentiation and Characterization of Murine ESCs................................................. 22
3.2
Implantation of Murine ESC-Derived Lung Cell Progenitors ...................................... 28
Healthy Mice.................................................................................................. 33
LPS Injured Mice ........................................................................................... 36
Homing of ESC-Derived Lung Cell Progenitors ............................................ 40
Y-chromosome FISH: Preliminary Studies.................................................... 43
Electron Microscopy: Preliminary Studies ..................................................... 44
4
Discussion....................................................................................................................... 45
4.1
Differentiation and Characterization of Murine ESCs................................................. 46
4.2
Implantation of Murine ESC-Derived Lung Cell Progenitors ...................................... 47
4.2.1
4.2.2
4.2.3
Homing of Murine ESC-Derived Lung Cell Progenitors ................................ 48
Overtime Maintenance of Murine ESC-Derived Lung Cell Progenitors ........ 49
Homing of Murine ESC-Derived Lung Cell Progenitors and Injury ............... 50
5
Conclusions and Future Trends...................................................................................... 52
6
References...................................................................................................................... 54
vi
List of Abbreviations
3D
Three-dimensional
ALI
Acute Lung Injury
AQP5
Aquaporin 5
ARDS
Adult Respiratory Distress Syndrome
ATI
Alveolar Type I Pneumocytes
ATII
Alveolar Type II Pneumocytes
BASCs
BronchioAlveolar Stem Cells
BM
Bone Marrow
BrdU
Bromodeoxyuridine
CCSP
Clara Cell Secretory Protein
cDNA
Complementary Deoxyribonucleic Acid
CEE
Células Estaminais Embrionárias
CFDA SE
CarboxyFluorescein DiaAcetate Succinimidyl Ester
Cfrt-
Conformal Radiotherapy
CFSE
CarboxyFluorescein Succininidyl Ester
COPD
Chronic Obstructive Pulmonary Disease
DAPI
4,6 diamidino-2-phenylindole
dATP
DeoxyAdenine Triphosphate
dCTP
DeoxyCytosine Triphosphate
dGTP
DeoxyGuanine Triphosphate
DMEM
Dulbecco’s Modified Eagle’s Medium
DNA
Deoxyribonucleic Acid
dUTP
DeoxyUridine Triphosphate
EBs
Embryoid Bodies
eGFP
Enhanced Green Fluorescent Protein
ESCs
Embryonic Stem Cells
FBS
Foetal Bovine Serum
FISH
Fluorescent In Situ Hybridization
FITC
Fluorescein IsoThioCyanate
GFP
Green Fluorescent Protein
ICC
Immunocytochemistry
ICL
Imperial College of London
IL-1
Interleukin-1
IL-1RN
Interleukin-1 Receptor Antagonist
KOSR
KnockOut Serum Replacement
LIF
Leukaemia Inhibitory Factor
LPS
LypoPolySaccahride
vii
LRCs
Label-Retaining Cells
MAPCs
Multipotent Adult Progenitor Cells
mESCs
Murine Embryonic Stem Cells
MSCs
Mesenchymal Stem Cells
NHS
National Health Service
OCT
Optimal Cutting Temperature
PBS
Phosphate Buffered Saline
RNA
Ribonucleic Acid
rpm
Rotations per Minute
RT-PCR
Reverse-Transcription Polymerase Chain Reaction
SCRM
Stem Cells and Regenerative Medicine
SP
Side Population
SPC
Surfactant Protein C
TNF-α
Tumour Necrosis Factor α
UK
United Kingdom
US
United States
viii
List of Figures
Figure 1 – The pulmonary tree. Stem/progenitor cell niches in the lung. Noncilliated cells,
basal cells, Clara cells and type II pneumocytes are stem cells in their local epithelial niches
(Adapted from 4). ....................................................................................................................... 4
Figure 2 – Foxa2 expression in day 7 EBs. ESCs committed to an endoderm lineage at day 7
were detected by fluorescent ICC for foxa2. Foxa2 expression was detected mostly in the
peripheral area of the EB. A – Foxa2 (x20). B – Merging of Foxa2 (green) and DAPI (blue,
x20). C – Foxa2 (x40). D – Merging of Foxa2 (green) and DAPI (blue, x40)............................ 1
Figure 3 – Sox17 expression in day 7 EBs. ESCs committed to an endoderm lineage at day 7
EBs were detected by fluorescent ICC for Sox17. Sox17 expression was detected mostly in
the peripheral area of the EB. A – Sox17 (x20). B – Merged Sox17 (green) and DAPI (blue)
(x20). C – Sox17 (x40). D – Merged Sox17 (green) and DAPI (blue) (x40).............................. 1
Figure 4 – SPCeGFP expression in adherent EBs at day 21. ESCs committed to a distal lung
lineage were detected by eGFP expression at day 21. The images represent the overlapping
of transmitted light and fluorescent images. SPCeGFP expression occurs mostly at peripheral
areas of the attached EBs (x40). ............................................................................................... 1
Figure 5 – FACS results from 2 experiments. The mixed population of murine ESCs-derived
lung cells progenitors was sorted by FACS for eGFP expression. The proportion of SPCeGFP
positive cells was of approximately 1%. A, D – Distribution of unsorted cells. B, E –
Percentage of SPCeGFP positive and negative cells. C, F – Distribution of cell number with
fluorescence intensity. ............................................................................................................... 1
Figure 6 – RT-PCR results. The day 25 mixed population of ESCs-derived lung cell
progenitors sorted by FACS was analysed for the expression of lung specific, endoderm,
mesoderm, ectoderm, hematopoietic and pluripotency markers by PCR. Lung specific
markers SPC, CCSP and TTF-1 are restricted to SPCeGFP positive cells. (Data generously
provided by Doctor Helen Rippon) ............................................................................................ 1
Figure 7 - The expression of SPC in SPCeGFP positive cells. SPC is a surfactant protein
assembled in the cytoplasm. SPC (red) and nuclei (DAPI blue). A, C – SPC positive cells. B,
D – Overlapping of blue light, green light and UV fluorescence. (A and B x20, C and D x40). 1
Figure 8 - The expression of AQP5 in SPCeGFP positive cells. AQP5 is a membrane
transporter present in ATI. AQP5 (red) and nuclei (DAPI blue). A, C – AQP5 positive cells. B,
D – Overlapping of blue light, green light and UV fluorescence. (A and B x20, C and D x40). 1
Figure 9 – Experimental layout of the implantation of murine ESC-Derived Lung Cell
Progenitors. ESCs were driven toward a distal lung cell lineage by culture with a combination
of activin A and noggin. The population of cells was labelled then injected into both healthy
and LPS injured mice. Mice were sacrificed at different times post-implantation and organs
harvested for analysis.............................................................................................................. 28
Figure 10 – Iron oxide cell labelling. Prior to implantation the population of lung cell
progenitors was labelled with a green fluorescent cell tracker protein, CFSE, and with iron
oxide nanoparticles with a FITC tag (green FITC tag and blue nuclei (DAPI)). A and B x40. C
and D x60. ................................................................................................................................. 1
Figure 11 – Representation of the changes in body weight of mice between implantation and
cull. Comparison of healthy and LPS injured mice. Control mice received only saline solution.
Error bars represent standard deviation from the average value............................................ 30
Figure 12 - Representation of the changes in body weight of healthy mice between
implantation and cull. Comparison of the different types of labelled cells administered to
healthy mice. Control mice received saline solution only. Error bars represent standard
deviation from the average value. ........................................................................................... 31
Figure 13 – Lung sections of healthy mice culled 1 day after cell implantation. The presence
of murine ESCs-derived lung cell progenitors in lungs of healthy mice 1 day after implantation
ix
was assessed by fluorescence microscopy. Sections were observed under blue light
fluorescence for the presence of the labelled cells (A, B, C, D and G), this presence was
confirmed by green light fluorescence (E and H) and both images and UV fluorescence
(nuclei, DAPI) were overlapped (F and I). A, B and C x4. D, E and F x 10. G, H and I x20. .... 1
Figure 14 – Lung sections of healthy mice culled 2 days after cell implantation. The presence
of murine ESCs-derived lung cell progenitors in lungs of healthy mice 2 days after
implantation was assessed by fluorescence microscopy. Sections were observed under blue
light fluorescence for the presence of the cells (A, B, C, D and G; white arrows indicate green
fluorescent cells), this presence was confirmed by green light fluorescence (E and H) and
both images and UV fluorescence (nuclei DAPI) were overlapped (F and I). A, B and C x4. D,
E and F x 10. G, H and I x20. .................................................................................................... 1
Figure 15 - Lung sections of healthy mice culled 5 days after cell implantation. The presence
of murine ESCs-derived lung cell progenitors in lungs of healthy mice 5 days after
implantation was assessed by fluorescence microscopy. Sections were observed under blue
light fluorescence for the presence of the cells (A, D and G; white arrows indicate green
fluorescent cells), this presence was confirmed by green light fluorescence (B, E and H) and
both images and UV fluorescence (nuclei DAPI) were overlapped (C, F and I). A, B and C x4.
D, E and F x 10. G, H and I x20. ............................................................................................... 1
Figure 16 – Lung sections of LPS injured (6 hours pre-implantation) mice culled 1 day after
cell implantation. The presence of labelled murine ESCs-derived lung cell progenitors in lungs
of LPS injured (6 hours before implantation) mice 1 day after implantation was assessed by
fluorescence microscopy. Sections were observed under blue light fluorescence for the
presence of the cells (A, B, C, D and G; white arrows indicate green fluorescent cells), this
presence was confirmed by green light fluorescence (E and H) and both images and UV
fluorescence (nuclei DAPI) were overlapped (F and I). A, B and C x4. D, E and F x 10 G, H
and I x20. ................................................................................................................................... 1
Figure 17 – Lung sections of LPS injured (6 hours pre-implantation) mice culled 2 days after
cell implantation. The presence of murine ESCs-derived lung cell progenitors in lungs of LPS
injured (6 hours before implantation) mice 2 days after implantation was assessed by
fluorescence microscopy. Sections were observed under blue light fluorescence for the
presence of these cells (A, B, C, D and G; white arrows indicate green fluorescent cells), this
presence was confirmed by green light fluorescence (E and H) and both images and UV
fluorescence (nuclei DAPI) were overlapped (F and I). A, B and C x4. D, E and F x 10. G, H
and I x20. ................................................................................................................................... 1
Figure 18 - Lung sections of LPS injured (6 hours pre-implantation) mice culled 5 days after
cell implantation. The presence of murine ESCs-derived lung cell progenitors in lungs of LPS
injured (6 hours prior to implantation) mice 5 days after implantation was assessed by
fluorescence microscopy. Sections were observed under blue light fluorescence for the
presence of these cells (A, D and G; white arrows indicate green fluorescent cells), this
presence was confirmed by green light fluorescence (B, E and H) and both images and UV
fluorescence (nuclei DAPI) were overlapped (C, F and I). A, B and C x4. D, E and F x 10. G,
H and I x20. ............................................................................................................................... 1
Figure 19 - Lung sections of mice LPS injured 24 hours pre-implantation culled 2 days after
cell implantation. The presence of murine ESCs-derived lung cell progenitors in lungs of LPS
injured mice 2 days after implantation was assessed by fluorescence microscopy. Sections
were observed under blue light fluorescence for the presence of these cells (A, D and G;
white arrows indicate green fluorescent cells), this presence was confirmed by green light
fluorescence (B, E and H) and both images and UV fluorescence (nuclei DAPI) were
overlapped (C, F and I). A, B and C x4. D, E and F x 10. G, H and I x20................................. 1
Figure 20 – Intestine sections. The presence of murine ESCs-derived lung cell progenitors in
the intestine of the implanted mice was investigated by fluorescence microscopy. Sections
were observed under blue light fluorescence for the presence of the cells (A and D), this
presence was confirmed by green light fluorescence (B and E) and both images were merged
(C and F). A, B and C x4. D, E and F x 10. ............................................................................... 1
Figure 21 – Liver sections. The presence of murine ESCs-derived lung cell progenitors in the
liver of the implanted mice was investigated by fluorescence microscopy. Sections were
x
observed under blue light fluorescence for the presence of the cells (A and D), this presence
was confirmed by green light fluorescence (B and E) and both images were merged (C and
F). A, B and C x4. D, E and F x 10. ........................................................................................... 1
Figure 22 – Spleen sections. The presence of murine ESCs-derived lung cell progenitors in
the spleen of the implanted mice was assessed by fluorescence microscopy. Sections were
observed under blue light fluorescence for the presence of the cells (A and D), this presence
was confirmed by green light fluorescence (B and E) and both images were merged (C and
F). A, B and C x4 magnification. D, E and F x 10...................................................................... 1
Figure 23 –Kidney sections. The presence of murine ESCs-derived lung cell progenitors in
the kidney of the implanted mice was assessed by fluorescence microscopy. Sections were
observed under blue light fluorescence for the presence of the cells (A and D), this presence
was confirmed by green light fluorescence (B and E) and both images were merged (C and
F). A, B and C x4. D, E and F x10. ............................................................................................ 1
Figure 24 – Heart sections. The presence of murine ESCs-derived lung cell progenitors in the
heart of the implanted mice was assessed by fluorescence microscopy. Sections were
observed under blue light fluorescence for the presence of the cells (A and D), this presence
was confirmed by green light fluorescence (B and E) and both images were merged (C and
F). A, B and C x4. D, E and F x 10. ........................................................................................... 1
Figure 25 – Ovary sections. The presence of murine ESCs-derived lung cell progenitors in the
ovary of the implanted mice was assessed by fluorescence microscopy. Sections were
observed under blue light fluorescence for the presence of the cells (A and D), this presence
was confirmed by green light fluorescence (B and E) and both images were merged (C and
F). A, B and C x4. D, E and F x10. ............................................................................................ 1
Figure 26 – Brain sections. The presence of murine ESCs-derived lung cell progenitors in the
brain of the implanted mice was assessed by fluorescence microscopy. Sections were
observed under blue light fluorescence for the presence of the cells (A and D), this presence
was confirmed by green light fluorescence (B and E) and both images were merged (C and
F). A, B and C x4. D, E and F x10. ............................................................................................ 1
Figure 27 - Y-FISH preliminary study. The presence of implanted murine ESC-derived lung
cell progenitors in the lungs of the implanted mice was assessed by Y-FISH. Sections were
observed under blue light fluorescence for the presence of the cells (A), the presence of YFISH positive cells assessed under green light fluorescence (B) and both images and UV
fluorescence (nuclei DAPI) were overlapped (C). A, B and C x20. (White arrow – Green
fluorescent-labelled cell; Grey arrow – Y-FISH labelled cell) .................................................... 1
Figure 28 – Electron microscopy preliminary study. The presence of implanted murine ESCderived lung cell progenitors in the lungs of the implanted mice was assessed by electron
microscopy. Lung samples were processed and analysed for the presence of iron oxide
nanoparticles (White arrow). A - x34000. B - x46000 . C - x64000........................................... 1
xi
List of Tables
Table 1 - Reverse transcription-polymerase chain reaction primers....................................... 17
Table 2 – Summary of the antibodies used in ICC.................................................................. 18
Table 3 – Summary of body weights for the healthy mice. Mice received CFSE and iron oxide
(Fe2O3) labelled cells. Controls received saline solution only. (*reduced dose 50%). ............ 31
Table 4 - Summary of body weights for LPS injured mice. Mice received CFSE and iron oxide
(Fe2O3) labelled cells. Controls received only saline solution. (*reduced dose 50%). ............ 32
xii
1 Introduction
Lung is the vital organ that ensures, in animals, the ability to breathe. Breathing is
essential to life and lung damage equals, in most cases, severe illness or death. Although the
lung is exposed to several types of external aggressions, it has slow turnover rates.
Therefore, an efficient way to repair, regenerate or even create lung would have an enormous
clinical impact and would be lifesaving in many cases.
Respiratory diseases are estimated to become the third leading cause of death in the
world by 2020 1. In fact, in the United Kingdom (UK), one in every five deaths is related to
lung damage and every year the National Health Service (NHS) spends over £6 billion on
respiratory diseases
2
. In the United States (US), the costs associated with Chronic
Obstructive Lung Disease (COPD) for the next 20 years are estimated to be over $800 billion
3
. At present, for many lung diseases the only available clinical treatment is transplantation.
However, the number of available organs is far surpassed by the demand.
Tissue engineering aspires to fill this gap by aiming to restore normal cellular
architecture and function where tissues have been compromised by injury or disease.
Unfortunately, lung is a particularly difficult target as it combines structural complexity, cellular
diversity and slow turnover rates. Nonetheless, recent advances are taking us closer to
achieving targeted lung regeneration. These advances include the clarification of the events
that take place during lung embryonic development and the discovery of regenerative
pathways in adult lung, which were previously unknown. In particular, stem cell research has
moved to the forefront of medical research in the last decade, with some of the most crucial
discoveries in this area 4.
Stem cells are the first line of intrinsic pathways for tissue regeneration and repair
representing a pivotal target to mediate in vivo repair. The selective activation of stem cell
pools could allow the manipulation and enhancement of the body’s innate regenerative
capability. On the other hand, implantation of ex-vivo created pulmonary epithelium, derived
from stem cells, could represent the treatment for more extensive lung damage.
1
1.1
Aims of the Study and Experimental Approach
The necessity to develop alternative means to repair damaged lung has urged the
efforts to create lung epithelium. In this context, this study aims to evaluate the potential of
murine embryonic stem cells (ESCs)-derived alveolar type II pneumocytes to home and
engraft to healthy and damaged lungs. This could represent an important step in tissue
engineering of the lung, since it will inevitably require the production of a stable source of
alveolar tissue, the gas exchange unit of the lung.
The alveoli are responsible for the gas exchange between blood and air being the
central unit of the lung. These extremities of a long branching tree are lined by alveolar type I
and II pneumocytes (ATI and ATII, respectively). The first are responsible for the gas
exchange itself, whilst the second produce the surfactant proteins that allow maintaining
alveolar structure and lowering surface tension. ATII are also able to differentiate into ATI
thus representing a stem cell niche in the alveoli. This capability means that delivering ATII to
lungs would allow replacing the two cell types that line the alveoli, which could represent an
effective mechanism to reverse lung damage.
An ATII cell enriched population was derived following a modification of the three step
protocol published by Bishop’s group in 2006
5
. The cell line used (E14-Tg2α) was
transfected with a SPCeGFP construction, meaning that when surfactant protein C (SPC) is
expressed, so is enhanced green fluorescent protein (eGFP). Since SPC is an ATII specific
protein, one can conclude that eGFP positive cells have become ATII. The obtained cell
population enriched for ATII was injected into C57BI/6 female mice via the tail vein. Mice were
killed at different time points post-implantation and organs harvested for analysis. The study
was carried out using both healthy and LypoPolySaccahride (LPS) injured mice (mouse lungs
were damaged by intratracheal inhalation of LPS toxin thus simulating a lung inflammation
model).
Homing and engraftment of cells into the lungs was evaluated by fluorescence
microscopy. Implanted cells are traceable by the presence of a green fluorescent label (eGFP
and Carboxyfluorescein Succinimidyl Ester (CFSE) positive cells), by co-localisation of
specific immunohistochemical markers with the green label and by electron microscopy, as
cells were also labelled with iron particles. On the other hand, all the remaining organs were
screened in order to access homing of the derived population of cells to the lungs.
Furthermore, this study aimed at the fully characterization of the ATII enriched
population using specific lung, endothelial cell and differentiation markers and the evaluation
of the type and potential function of the engrafted cells in healthy and damaged lung tissue.
2
1.2
Lung
1.2.1 Lung Development
In animals, the normal adult lung has its origin in the primitive gut. It develops from a
diverticulum of the ventral wall of the primitive oesophagus within the fourth to fifth week of
gestation (humans). This stage marks the beginning of the dichotomous branching of the
endoderm into the splanchnic mesenchyme that surrounds it. This process follows a highly
ordered and repeated pattern of bud outgrowing and divisions of the terminal units, known as
branching morphogenesis 6.
Branching morphogenesis gives origin to the pulmonary tree and defines the
proximal-distal axis of the lung. In humans, the process is divided into four different phases:
embryonic (0-5 weeks of gestation), glandular (5-16 weeks), canalicular (16-26 weeks) and
saccular (26 weeks to term) 7. Throughout this complex process, mature lung is formed
having distinct anatomical regions lined by different types of epithelial cells. This complex
architectural structure of different cells that interact during normal function make lung a very
difficult target for regenerative medicine (reviewed in 8).
1.2.2 Lung Biology
The pulmonary tree can be divided into three distinct anatomical regions,
characterized by different types of epithelial cells (Figure 1). In the mature lung, the trachea
and major bronchi are lined by pseudostratified epithelium. In the proximal airways, the
predominant phenotypes are ciliated and mucous secretory (or goblet) cells, with the more
infrequent neuroendocrine cells and the less well-differentiated basal cells lying in a basal
position. A different type of cells possessing a different phenotype, known as Clara cells (nonciliated), line the bronchioles. Clara cells play an important role in detoxifying inhaled
pollutants and secrete Clara cell secretory protein (CCSP). In their turn, alveoli are lined by
flattened squamous ATI pneumocytes and cuboidal ATII cells. The ATI is the cell type across
which gas exchange occurs. This capacity is enhanced by its long and thin cytoplasmic
extensions that represent the smallest barrier to gas diffusion possible whilst maintaining
cellular and alveolar epithelial integrity. ATI occupy the majority of the surface area of the
2
normal adult lung (~70 m ). ATII are more numerous than ATI, nevertheless they represent
only around 5% of alveolar surface area, due to their cuboidal shape. These cells are crucial
for maintaining alveolar homeostasis, clearing the alveolar airspace of edema and secreting
pulmonary surfactant to lower surface tension and prevent airway collapse, thus facilitating
gas exchange. Another cell type, which populates the lungs, are the neuroendocrine cells that
first appear around 8 weeks of gestation. These cells are relatively common in the developing
lung, but form less than 1 % of epithelial cells in adult lung (reviewed in 8,4).
3
Figure 1 – The pulmonary tree. Stem/progenitor cell niches in the lung.
Noncilliated cells, basal cells, Clara cells and type II pneumocytes are stem
4
cells in their local epithelial niches (Adapted from ).
Not only is lung epithelial architecture complex, but its vasculature differs from that of
systemic circulation too. In the lungs, the endothelial cell layer is continuous, bathed on one
side by blood and by interstitial fluid on the other. Lung vasculature is relatively regular
throughout all its extension, with only small differences associated with the function of each
region. While alveolar endothelial cells have an avesicular zone, whose basal lamina fuses
with that of ATI cells to form the air-blood barrier, venous endothelial cells are thinner,
polygonal and have fewer organelles. The space between the epithelium lining the air space,
the vascular endothelium and the pleural mesothelium is known as the interstitium. The
interstitium in formed by a spectrum of cell types, ranging from smooth muscle cells to
fibroblasts and immune cells. These cells are responsible for the formation of the extracellular
matrix that supports the structural integrity of the lung whilst allowing plastic deformation
4
during respiration (reviewed in ).
4
1.3
Embryonic Stem Cells
The prevalence of lung diseases and the lack of an effective clinical treatment other
than a transplant for the majority of lung injuries have driven the scientific community from the
classical chemical drug discovery towards new approaches in lung repair and regeneration.
The perspective of tissue-engineered lungs that would allow facing the lack of donor organs
for transplant is still far from being reality and stem cell research assumed the lead of
scientific research concerning lung regeneration and repair.
Stem cell definition is still a source of wide debate within the scientific community.
Nonetheless, it is generally accepted that clonogenicity, ability to self-renew and multilineage
differentiation potential are sufficient conditions for this definition
9-13
. Among stem cells in
general, embryonic stem cells (ESCs) are of particular interest due to their pluripotency and
high proliferative capacity, making them a potential unlimited source of cells to tissue
engineering.
ESCs are pluripotent cells derived from the inner cell mass of the blastocyst, an early
stage of embryonic development
and in 1998 from humans
14,15
. Their derivation from mice was first reported in 1981
16-18
. These cells can be cultured for long periods while maintaining
a normal karyotype and retain the ability to differentiate into a wide variety of tissue specific
cells derived from all three germ layers: ectoderm, endoderm and mesoderm
19
. The
undifferentiated state of ESCs can be maintained by culturing them on a feeder layer of
murine embryonic fibroblasts
20
or in the presence of the cytokine leukaemia inhibitor factor
19,21
. On the other hand, the most common method of ESCs differentiation is the spontaneous
formation of three-dimensional (3D) spherical structures in suspension, the so called
embryoid bodies (EBs), which contain derivates from all three germ layers.
The production of alveolar tissue from stem cells would be a major step towards lung
regeneration and repair.
However, despite their potential, there are still many biological
questions regarding stem cells to be answered and manipulation of ESCs for tissue
engineering is subject to debate in ethical, political and religious contexts.
5
1.4
Lung Injury and Repair
In the lung, subsets of stem cells have been identified and characterized. These
subsets have been studied as local stem cell niches that are able to react locally to injury and
restore the normal physiology of the lungs. On the other hand, recent descriptions have
changed the perception of organ regeneration, as tissues have been shown to be
regenerated by circulating stem cells. These cells appear to detect tissue injury signals being,
mobilized towards injury areas where they engraft and promote regeneration (reviewed in 4).
1.4.1 Lung Endogenous Stem Cells
The complex architecture of the lung is also present in what is believed to be its
specific stem cells niches. Basal, Clara and ATII cells are stem cells for their local niches
(Figure 1). This fact is of particular interest if a comparison between lung and gut is made.
Although both have their origin in endoderm, there is only one stem cell type described for
gut. These cells undergo a cycle of differentiation in the crypt, changing from one cell
precursor type to the other and covering all the gut specific cell types. In contrast, in the
lungs, there are several types of stem cells. This diversity allows lungs to respond quickly and
specifically to lung injury as every lung niche has its specific and local cell source avoiding
mobilization and long differentiation cycles.
Tracheal and Bronchial Stem Cells
In both trachea and bronchi, it is widely accepted that basal and mucous secretory
cells are stem cells. The first evidence that basal cells could be stem cells dates from 40
years ago, when they were shown to uptake [3H]-thymidine, which was later found in ciliated
and goblet cells
13
. Moreover, they accumulate at injury sites
22
and their histological
appearance suggests an intermediate phenotype, having characteristics both from ciliated
and goblet cells
23
. In vitro it was shown that these cells are able to generate all the major
epithelial phenotypes found in the trachea (basal, ciliated, goblet and granular secretory cells)
24-26
.
The evidence that mucous secretory cells are stem cells is not so abundant.
Nevertheless, Bromodeoxyuridine (BrdU) label-retaining cells are believed to be stem cells
27
and this type of cells has been found in gland ducts of the upper trachea following injury 28.
6
Bronchiolar Stem Cells
Clara cells (firstly described in 1937
29
) have been shown to be progenitors of
themselves and of ciliated cells in the bronchioles 30-33. This notion has been modified since it
was established that a subset of Clara cells fulfils the criteria of niche-specific stem cells.
Pools of stem cells that produce CCSP were discovered, but these are not typical Clara cells,
as they show resistance to pollutants such as naphthalene
neuroepithelial bodies
37-39
34-40
. These cells reside in
and at the broncho-alveolar duct junctions
40
and ablation of this
population eliminates bronchiolar renewal completely. A population of cells expressing
markers for both Clara cells and alveolar epithelium has recently been identified as a stem
cell population for Clara cells and ATII cells
41
and are known as bronchioalveolar stem cells
(BASCs).
In contrast to the many descriptions of lung epithelial stem cells, lung mesenchymal
stem cells (MSCs) have only recently been identified
42
. These bronchial cells were first
described as having fibroblast-like morphology and exhibiting the phenotype and multilineage
differentiation potential characteristic of MSCs, although the authors were unable to show that
these cells were lung endogenous cells. More recently, another group proved that these cells
were indeed lung endogenous
43
. MSCs were isolated from adult respiratory tracts after
sex-mismatched transplants and it was found that these MSCs were donor derived and thus
resident in the lung 43.
Alveolar Stem Cells
More than 50 years ago, ATII cells were shown to proliferate following injury 44. These
cells are able to restore the alveolar epithelium following generalized damage by oxidants by
dividing to generate new ATII and differentiating to replace the ATI (mostly destroyed
following injury)
45-50
. ATII cells also respond, by proliferating, to selective damage by
butylated hydroxytoluene 51 and bleomycin 52,53. Inflammatory infiltration, as a consequence of
particle inhalation, has a similar effect on these cells 54. In fact, recent work suggests that two
different populations of ATII cells may exist
55
. The new population of cells shows an
E-cadherin negative phenotype and a high telomerase activity and is described as fitting
closer to the stem cell definition 55.
7
1.4.2 Lung Exogenous Stem Cells
The severity of an injury may induce the recruitment of stem cells from other sources
to supplement the endogenous repair mechanisms. Lung injury has been shown to trigger the
mobilization of bone marrow (BM)-derived stem cells. Recently, another population of cells,
the so-called side population (SP) cells has been identified has a potential stem cell source
for lungs.
Bone Marrow–Derived Cells
Adult BM has been shown to contain two populations of cells that have the ability to
self-renew and differentiate into hematopoietic and mesenchymal cell lineages
56
. More
interestingly, BM-derived MSC have been shown to retain the ability to differentiate in vitro not
only into cells of the mesenchymal lineages, such as adipocytes 56, osteocytes 57,58, myocytes
59
, and cardiomyocytes
60
, but also towards the ectodermal lineage
lineage, such as hepatocytes
62-65
and renal parenchymal cells
61
and the endodermal
66
. These facts prove that
there exists a population of stem cells in the BM of the adult organism that retains
pluripotency throughout all developmental process. Supporting this fact, a population of
multipotent adult progenitor cells (MAPCs) that has been isolated from murine BM has been
shown to differentiate in vitro at a single cell level into cells of all three germ layers 67.
The mechanism of recruitment of BM stem cells to repair a certain tissue is not
known, although engraftment seems to be dependent or at least enhanced by injury
68-74
. In
fact, there is a considerable controversy about whether or not MAPCs are able to migrate and
engraft in tissues and the effect of variables such as starting cell population or the degree of
injury, if any, are unclear.
Most of the studies regarding homing and engraftment of BM-derived cells to lungs
rely on co-localization of BM specific markers with those of the lungs by microscopy.
However, recent studies have shown, by confocal microscopy, that these findings are in fact a
consequence of separate overlapping cells or autofluorescence, and thus not genuine
co-localization of markers 75,76.
BM-derived cells have been identified in the pulmonary epithelium of recipient mice
and the rate of engraftment was positively correlated with injury
68-83
. One of these studies
suggested the existence of a long-term renewal mechanism by reporting the presence of
marrow-derived cells 11 months after transplant
78
. Another study showed the importance of
the potential BM-derived cells mediated repair as it demonstrated that the presence of healthy
BM was essential to full recovery following LPS injury
81
. Moreover, MSCs isolated from BM
engraft in distal airways and the degree of engraftment is enhanced by bleomycin injury
70
.
8
Radiation induces the engraftment of circulating cells as ATI and fibroblast-like interstitial cells
72
.
The accuracy of the previous reports was first doubted by Beckett and co-workers
83
.
They reported that, following BM transplantation, the engrafted cells in lung were almost all
donor-derived leucocytes. Moreover, they showed that the level of injury or even its absence
did not influence engraftment. Another group reported that the rate of engraftment of
marrow-derived cells into lungs of conformal radiotherapy knockout (Cfrt-) mice was so low
that it was impossible to characterize those cells
75
. Furthermore, Bruscia and colleagues
were unable to find relevant BM-derived cell engraftment in lungs of newborn mice when
transplanted just after birth
84
. On the other hand, the need of a threshold of injury for
BM-derived cells to engraft in the lungs was demonstrated by Herzog and co-workers
Another interesting fact is that some cells seem to be disease-causing
as protective
72
75
.
and others emerge
69
. In fact, the recruitment of circulating cells to injury sites may contribute to
undesired fibrosis in the alveolar wall as circulating MSCs will also be mobilised
72
. All this
controversy emphasises the necessity of standardization of the protocols for injury and
transplantation across laboratories, in order to evaluate truly the potential of BM cells for lung
regeneration and repair.
Even disregarding this controversy and assuming that BM-derived cells do engraft
into lung one question is still to be answered: what is the mechanism underling engraftment?
One possible mechanism is cell fusion where marrow-derived cells fuse with lung epithelial
cells assuming lung phenotype. Cell fusion has been demonstrated both in vitro
vivo in the liver and heart (hepatocytes and cardiomyocytes, respectively)
85-87
and in
87-94
, but tests on
the pulmonary epithelium are inconclusive.
Although in vitro tests clearly showed fusion with BM cells in epithelial repair
vivo tests did not confirm this result
and co-workers
78,79
95
, in
. Recently, another possibility was raised by Aliotta
96
. They hypothesize that injured lung is capable of inducing epigenetic
modifications of marrow cells, thus influencing them to assume phenotypic characteristics of
lung cells. These epigenetic changes are induced by RNA-filled microvesicles that are
produced by injured lung tissue and enter whole BM cells in co-culture experiments.
Moreover, these cells have a greater propensity to produce ATII after transplantation into
irradiated mice. This report represents an important breakthrough and reveals a new strategy
for the direct repair of injured tissue 96.
Studies on human lung have either found no engraftment of BM-derived cells into
lung or observed that engraftment occurs at very low rates
97-102
. These studies also rely on
co-localization of histological markers, which, along with the poor quality of available human
lung samples, plagued these studies with technical problems.
9
Side Population Cells
Side population cells have a unique flow cytometry profile when stained with the DNA
dye Hoescht 33342. SP cells bud from the main Hoescht-stained population probably
because of the expression of protein transporters such as bcrp1 which are capable of
effluxing this dye against the concentration gradient. These cells were first identified in the BM
as being highly enriched for hematopoietic stem cell activity
103
, but recently these cells have
been identified in several tissues and seem to act as tissue-specific stem cells
these cells have been identified in both proximal and distal lung
107-109
104-106
. Indeed,
. Although they were
thought to be tissue specific stem cells, recent work has shown that lung-specific SP cells
have in fact a hematopoietic origin in spite of being phenotypicaly different from BM SP cells
109
.
1.4.3 Stem Cells and Inflammatory Response
Stem cells have always been exploited as vectors to repair or regenerate injured
tissue more precisely as a source of fresh cells that would replace the damaged endogenous
ones. Although several studies have been published, the actual potential of these cells has
not been fully accessed. Interestingly, recent reports suggest that the actual role of stem cells
in regeneration is not the repopulation of tissue, but a modulation of the inflammatory
response of tissue to aggressions
110,111
. Following the observation that implanted MSCs
ameliorate lung injury after exposure to bleomycin, but only if administrated at the time of
injury, Ortiz and colleagues 110 studied the eventual production of soluble factors that would
modulate inflammation. They showed that the administered MSCs secrete high levels of
IL1RN. This protein is responsible, both in vitro and in vivo, for the protection of injured tissue
after bleomycin injury by blocking the production and/or the activity of Tumour Necrosis factor
(TNF) α and Interleukin-1 α (predominant proinflammatory cytokines in lung tissue). In what
seems to be a paradox, the authors reported that endogenous IL1RN produced in the
inflamed lung was not as effective as MSCs in modulating the inflammatory response, a fact
that could be explained by the different secretion times: while exogenous MSCs secrete
IL1RN from the beginning of the inflammation response, endogenous ones start secreting
later in the process.
1.4.4 Lung Injury Models
The need to understand molecular mechanisms of injury and regeneration urged the
development of various animal models. Two of the best characterised are the
elastase/emphysema model of chronic obstructive pulmonary disease (COPD) and the LPS
acute lung injury (ALI) model of adult respiratory distress syndrome (ARDS).
10
COPD is defined as a disease state characterized by the presence of airflow
obstruction due to chronic bronchitis or emphysema, usually associated with the smoker’s
lung. The first reproducible model of pulmonary emphysema was described in 1965
112
. This
model was achieved by instilling the plant protease, papain, directly into lungs of rats and
provided the basis for the protein-anti-proteinase hypothesis of human emphysema. Following
this first report, various modifications of the protocol emerged which allowed the description of
the emphysematous reaction. The elastase model has been widely use for the study of
therapies based on the administration of chemicals or for the exploration of the potential for
regeneration and repair of tissue engineering strategies 113,114 (reviewed in 115).
ARDS consists of the presence of pulmonary edema in the absence of volume
overload or depressed left ventricular function. ARDS occurs in children, as well as adults,
and the condition originates from a number of insults involving damage to the alveolocapillary
membrane, with subsequent fluid accumulation within the airspaces of the lung.
LPS is a macromolecular cell wall surface antigen of Gram-negative bacteria. The
presence of LPS in the lungs results in early deterioration of respiratory function and induction
of severe pulmonary edema with recruitment of leukocytes from peripheral blood into the
interstitial pulmonary tissue 116. LPS models vary with administration method. While intranasal
administration of LPS induces controlled ALI, intravenous and intraperitoneal administration
may result in non-specific tissue damage and the degree of injury is much more difficult to
control.
New alternatives for lung regeneration and repair would clearly be of enormous
clinical potential as available therapies, in most cases transplant, are clearly insufficient to
supply the existing demands. Moreover, the complexity of lung architecture urges the
necessity for the development of therapies that would allow in a simple way the enhancement
of lung specific regeneration ability (stem cells niches) or the recruitment of circulating stem
cells to achieve the same purpose. Either way, the ability of stem cells to repair damaged
tissue is a matter of discussion within the scientific community and further proof of its potential
is needed.
11
1.5
Tissue Engineering: Creating Lung Tissue Ex-Vivo
Tissue engineering aims to build new tissues ex vivo to replace or restore damaged
tissue function. To accomplish this, it is necessary to join knowledge from life sciences and
engineering in an attempt to produce a functional tissue based on three basic components:
cells, scaffolds and signalling.
Lung is a particularly difficult target for tissue engineering due to the combination of
several cell and tissue types with a specific vasculature. This combination makes lung
architecture one of the most complexes in the human body. Thus, the prospect of achieving
the ex-vivo construction of a functional lung is still far in the future.
Lung tissue engineering is a multi-disciplinary area of research, requiring culture and
differentiation of stem cells into functional lung derivates for tissue implantation. Lung specific
characteristic urges the need for the production of the alveolar gas exchange units. Lung
particular stem cell niches allow that the alveolar gas exchange units may be replaced by ATII
instead of directly by ATI, by a mechanism existent in normal lungs as a response to damage.
ESCs could provide an inexhaustible cell source for the production of the desired specific cell
types. This unlimited resource is of extreme importance as the complexity of lung makes it
almost impossible to retrieve endogenous stem cells both in the quantity and quality needed
to develop tissue ex-vivo.
1.5.1 Derivation of Type II Pneumocytes from Murine ESCs
ATII were first derived from murine ESCs by a supplemented medium approach
117,118
. Since then, the protocol has evolved to a three-step strategy that allows obtaining
distal lung epithelial progenitors, thought to be representative of those present at early
branching at approximately embryonic day 10-11 of murine foetal development 5. The present
work adopted a modification of the most recent protocol where a new endodermic
differentiation factor, noggin, is added in combination with activin A i . Activin A is known to
induce the formation of both mesoderm and endoderm, by the activation of the nodal
signalling pathway, crucial for the formation of definitive endoderm in the embryo 5. This
simultaneous induction is established by the analyses of the expression of endoderm
markers, such as Sox17, GATA4 and Foxa2, and the mesoderm marker Brachyury T 5.
Moreover, endothelial markers (such as CD31, Flk1/KDR and CD133) are also induced
following activin A induction of nodal signalling. Finally, distal lung commitment can be verified
by the expression of adult progenitor cell markers (Sca1 and Abcg2/Bcrp1), the absence of
i
Work currently in progress.
12
the pluripotency marker Oct4 and the expression of early distal lung markers (TTF-1 and
SPC).
Several other strategies for the differentiation of pulmonary epithelial cells from
murine ESCs have been employed. For example, a combination of specific medium
supplementation and growth at the air interface can induce the formation of tracheobronchial
airway epithelium
T-cell extracts
88
119
and a method originally used to convert fibroblasts into T cells using
was adapted and applied to murine ESCs to derive ATII 89.
Alveolar epithelium markers were found after 5 days of culture of ESCs with
microdissected lung mesenchyme, patterning the alveolar stimuli that occurs in vivo
90
. This
stimulus was also found in a co-culture experiment of ESCs with dissociated embryonic lung
91
.
Recently, it was demonstrated that ATII have the ability to reduce collagen deposition
and the severity of lung fibrosis, hence demonstrating the potential role of ATII in lung
regeneration and repair 92. The authors of this study investigated the role of ATII in the fibrosis
process by intratracheal transplantation of isolated ATII in an experimental model of
bleomycin-induced lung fibrosis in rats.
In human cells, Wang and co-workers were the first to derivate pulmonary epithelium
in vitro from human non-pulmonary somatic stem cells
120
. They showed that adult
BM-derived MSCs differentiate to airway epithelium when co-cultured with human airway
epithelial cells. Recently, the differentiation of ATII from human ESCs was achieved, by a
supplementing medium approach
121,122
respiratory epithelial-like phenotypes
. Moreover, foetal mouse lung was shown to induce
in human
differentiation was observed to a very limited extent
ECSs
when co-cultured, although
123
.
1.5.2 Implantation of Murine ESC-Derived Lung Cell Progenitors
The prevalence of lung diseases and the lack of an effective means to restore normal
lung physiology besides transplantation, urges the need to an alternative method to promote
lung regeneration. Although several works suggest that circulating cells may home to and
engraft at injury sites offering exciting perspectives for lung regeneration and repair, the
controversy surrounding the accuracy of these results makes it impossible to assess the
efficiency and utility of this approach.
Tissue engineering could fulfil the existing lack of means to repair and regenerate
injured lungs. Even though the development of a stem cell-based therapy is still a distant
prospect, recent research has identified several strategies to produce lung cells from ESCs in
13
vitro. These advances open the door to the initial stages of development of cell therapies
particularly for the exploration of the alveolar stem cell niche. The ex-vivo derivation of ATII
allows the study of the potential of an exogenous source of ATII to integrate into the
endogenous stem cell niche and improve the lungs’ natural regeneration cycle.
The implantation of murine ESC-derived lung cell progenitors constitutes the first step
towards the evaluation of the real potential of ESCs in lung regeneration and repair,
envisaging the human lung regenerative medicine in a near future.
14
2 Materials and Methods
2.1
Cell Culture
2.1.1 Maintenance of Murine ESCs
The murine ESC line E14-Tg2α (male cells, a gift from Prof. Austin Smith, University
of Edinburgh, UK) stably transfected with SPC/eGFP (Doctor Helen Rippon, Imperial College
of London, UK) was routinely cultured in an undifferentiated state on gelatine (0.1% v/v,
Sigma-Aldrich, Dorset, UK) coated cell culture flasks in the presence of 1000 U/mL of
leukaemia inhibitory factor (LIF, Chemicon, USA). Cells were maintained in complete medium
consisting of Dulbecco’s Modified Eagle’s Medium (DMEM, Invitrogen, Paisley, UK)
supplemented with 10% (v/v) batch tested foetal bovine serum (FBS, PAA Laboratories,
Austria), 0.1 mM 2-mercaptoethanol (Sigma-Aldrich) and 2 mM L-Glutamine (Invitrogen).
Cells were cultured in an incubator at 37ºC under a humidified atmosphere of 5% CO2 and
medium was changed every other day.
2.1.2 Differentiation of Murine ESCs into Lung Cell Progenitors
Undifferentiated murine ESCs cultured as described previously were harvested by
trypsin treatment (0.05%, 10 minutes at 37ºC, Invitrogen) and cultured in suspension in
non-tissue specific Petri dishes in complete medium without LIF (day 0 (d0)) to allow the
formation of EBs. Cells were cultured in suspension from d0 until d10 when EBs were plated
into gelatine-coated flasks. On d3 EBs were transferred to serum-free medium (DMEM
supplemented with 10% KnockOut Serum Replacement (KOSR) and 2mM L-Glutamine)
containing 100 ng/mL of activin A (R&D systems, MN, USA) and 50 ng/mL of noggin (R&D
systems, Abingdon, UK) and medium was replaced on d5. On d7, cells were removed from
the differentiation medium and culture was continued in serum-free medium (DMEM
supplemented with 10% KnockOut Serum Replacement (KOSR) and 2mM L-Glutamine). EBs
were plated on d10, medium was changed on d15 and, from then, every 3 days until a
maximum of 35 days.
15
2.2
Cell Culture Characterization
2.2.1 Flow Cytometry
Differentiated cells were harvested for cell sorting once SPC-eGFP expression was
detected (d21-d35). Cell clumps were dissociated by treatment with 0.05% trypsin containing
2% (v/v) chicken serum (15 minutes, 37ºC, Invitrogen) and cells were resuspended in DMEM
with 0.1 mM EDTA to reduce cell clumping. The mixture was sieved through a 100µm mesh
to remove any existent clumps. Viable cells were counted by trypan blue exclusion and cell
density was adjusted to 7-10×106 cells/mL. Cells were sorted by fluorescence-activated cell
sorting (FACS, St. Mary’s Campus, ICL) based on eGFP fluorescence measured in the FL1
channel. Autofluorescence was detected in the FL2 channel (orange fluorescence). Both
eGFP positive and negative cells were retrieved for further characterization.
2.2.2 Reverse Transcription-Polymerase Chain Reaction
RNA was extracted from differentiated ESCs using TRIzol reagent (Invitrogen) and
quantified by spectrophotometry. RNA was DNase I-treated using RQ1 RNase-free DNaseI
(Promega, Madison, WI), and then 3 µg of RNA was reverse-transcribed into cDNA using the
Superscipt III reverse transcription-polymerase chain reaction (RT-PCR) system (Invitrogen)
and a random hexamer primer.
Real-time PCR was performed using a GeneAmp SDS 5700 thermal cycler and the
Kit (both Applied Biosystems, Foster City, CA). PCR reaction mixtures contained cDNA
template, primers, 1×SYBR Green PCR buffer, 3 mM MgCl2, 200 nM each of dATP, dCTP,
dGTP, and 400 nM dUTP, 0.75 U of AmpliTaq Gold, and 0.25 U of AmpErase UNG in a final
volume of 25 µl. Each PCR reaction was performed in triplicate, and positive controls and
non-template negative controls were also included in each PCR run. Primers were designed
using Primer-Express software (Applied Biosystems) and primer concentrations were
optimized for each primer pair according to the PCR kit protocol. Primer sequences are
shown in Table 1. Thermal cycling parameters were: 50°C, 2 minutes; 95°C, 10 minutes;
followed by 40 cycles of 95°C, 15 seconds; and 60°C, 1 minute.
PCR products were separated on 2% agarose gel and visualised by ethidium bromide
fluorescence. All gels were run for 20 minutes at 77V (Bio-Rad Model 200/2.0 power supply,
Richmond, USA). Gels were visualised using Gene Flash Gel Documentation System with
GelVue UV transilluminator at 245 nm and images were captured with a prefitted Pulnix High
Performance CCD camera (Syngene Bio Imaging, Cambridge, UK).
16
Table 1 - Reverse transcription-polymerase chain reaction primers
Gene
SPC
F:
R:
TTF-1
F:
R:
F:
R:
CCSP
F:
R:
eGFP
F:
R:
Sox17
F:
R:
GATA4
F:
R:
CD31/PECAM1 F:
R:
Flk1/KDR
F:
R:
CD133
F:
R:
Oct4
F:
R:
Abcg2/Bcrp1
F:
R:
Sca1
F:
R:
Brachyury T
F:
R:
AQP5
F:
R:
18s
F:
R:
Primer sequence (5'-3')
CTCCACTGGCATCGTTGTGT
GGTTCCTGGAGCTGGCTTATAG
CGTACCAGGACACCATGAGGAAC
TTGCTTGAAGCGTCGCTCC
TAACAGCAATGAGGCTGACG
AGTTTTCCCTTCCGATGCTT
GCCTCCAACCTCTACCATGA
GGGCAGTGACAAGGCTTTAG
CTGACCCTGAAGTTCATCTGCA
AGTTGTACTCCAGCTTGTGCCC
GTCTGCCACTTGAACAGTTGAAG
AGTGGGATCAAGACTTTTGGAA
TGCTCTAAGCTGTCCCCACAAG
AACCCGGAACACCCATATCCT
ACTCACGCTGGTGCTCTATGC
GAGCCTGAGGAATGACGTAGCT
AGCCGGCCAGTGAGTGTAAAA
GGACAAGTCCCTTGCAGTCTGA
GAAAAGTTGCTCTGCGAACC
CTTGTTGCTTGTTTGCTGGA
CTGCTGAAGCAGAAGAGGATC
TGGTTCCTGTAAACCGGCGCCAG
CGCAGAAGGAGATGTGTTGA
CATCCAGGAAGAGGATGGAA
CCCTTCTCTGAGGATGGACA
AAGGTCTGCAGGAGGACTGA
CCTATGCGGACAATTCATCTGC
ATCGGAGAACCAGAAGACGAGG
AGATCTCTCTGCTCCGAGCCAT
AACAGCCGGTGAAGTAGAT
AAGCATTTGCCAAGAATGTTTT
AAATCGCTCCACCAACTAAGAA
2.2.3 Immunocytochemical Characterization of the Murine ESC-Derived
Lung Cell Progenitors
Immunocytochemical (ICC) characterization was carried out both in EB culture
samples (days 7 and 21) and on cytospun sorted cells.
EBs samples were fixed, frozen and cryosectioned (6 µm) as described for tissue
samples (Section 2.3.3, below). The sections were then fixed in blocking buffer for 30 minutes
(phosphate buffered saline (PBS), 20% normal serum (serum from the animal in which the
secondary antibody was raised), 0.1% Triton X-100) incubated overnight with the primary
antibody (Table 2), washed three times in PBS and incubated at room temperature for 1 hour
with the secondary antibody (Table 2). Cell were coverslipped with an anti-fade mounting
medium (Vectashield with 4’,6 diamidino-2-phenylindole (DAPI), Vector laboratories,
17
Burlingame, UK). Appropriate positive and negative controls were included in each ICC
experiment.
Cytospins were prepared by resuspending sorted cells in serum-containing medium
(DMEM + 10% FBS) at a density of 25×103 cells/mL for the negative sorted cells and
12.5×103 cells/mL for the SPCeGFP positive cells. Cells were spun onto Polilysine slides
(VWR) for 5 minutes at 1500 rpm (200 µL of cell suspension per cuvette) in a Shandon
Cytospin centrifuge. Since cell density was low, the centrifuge was pre-run with 50 µL of
serum-containing medium (20%), to wet the filter cartridges and reduce cell adherence to the
filter. Cytospins were fixed in 4% paraformaldehyde for 5 minutes and slides were stored at
4ºC in PBS. ICC was carried out as described before.
Table 2 – Summary of the antibodies used in ICC.
Source
Primary antibidies
Sox17
Goat
foxa2
Goat
SPC
Rabbit
AQP5
Rabbit
Secondary antibodies
anti-goat
Rabbit
antiGoat
rabbit
Dilution
1:100
1:100
1:2000
1:100
Supplier
Refrence
S.C.Biotech. sc-17355
S.C.Biotech. sc-9187
Whittset
Chemicon
AB3069
1:100
Chemicon
AP106F
1:100
Chemicon
AP307R
2.2.4 Microscopy
All
microscopic
observations
were
performed
using
an
Olympus
LG-60
epifluorescence microscope and pictures captured using a Zeiss Axiocam digital camera and
analysed using KS-300 3.0 software (Imaging Associates, Thames, UK).
18
2.3
Cell Implantation
2.3.1 Labelling of Differentiated Cells
The mixed population of murine ESC-derived lung cell progenitors was labelled using
the Vybrant CFDA-SE ii Cell Tracer kit (Invitrogen) and/or with paramagnetic dextran-coated
iron oxide nanoparticles (provided by Doctor Kishore Bhakoo, Stem Cell Imaging Group, ICL).
These iron oxide particles include a Fluorescein Isothiocyanate (FITC) label. This double label
strategy was employed to allow cell tracking by fluorescent microscopy and electron
microscopy. The first will be employed for the initial screening of tissue sections by
fluorescent microscopy; the second will allow engraftment confirmation and the clear
assessment of cell phenotype.
Briefly, cells were harvested (by trypsin treatment) into single cell suspensions and
resuspended in the label solution at a density of 1×106 cells/mL of probe (the solution was
prepared by diluting the stock in 90 µL of DMSO). Cells were incubated for 10 minutes at
37ºC and resuspended in pre-warmed medium (DMEM + 10% KOSR). The solution was then
incubated for 30 minutes after which the reaction was stopped (cells were spun and
resuspended in PBS) and cells washed 3 times in PBS and resuspended at a density of
5×106 cells/mL. Notice that CFSE fluorescence intensity will half at each subsequent cellular
division, since the dye is inherited equally by both daughter cells.
For the iron oxide staining, cells were incubated overnight in culture with the
nanoparticles (dilution 1:200) and the particles taken into the cell in small vesicles. The
harvesting procedure was carried out as described for the CFDA-SE labelling.
2.3.2 In vivo Studies
In vivo sex-mismatched animal studies were carried out in collaboration with Doctor
Masao Takata (Department of Anaesthetics, ICL). C57BI/6 female mice (originally derived
from the 129/Ola strain) were treated with LPS intra-tracheally (50 ng) to induce lung injury
via inflammation (6 or 24 hours before implantation). Healthy and LPS injured mice were
injected into the tail vein with a dose of 1×106 cells in 200 µL saline solution or with 200μl
saline alone as controls. Mice were sacrificed at different time points post-implantation (1, 2, 5
and 7 days) and organs harvested for histological analysis.
ii
CFDA-SE once inside the cells is cleaved by intercellular esterases to become
carboxyfluorescein succininidyl ester (CFSE), which is fluorescent.
19
2.3.3 Tissue Recovery and Histological Analysis
Harvesting Tissues from Implanted Mice
At cull organs were recovered (lungs, liver, spleen, heart, gut, ovary, kidney and
brain), fixed overnight in 4% paraformaldehyde and cryoprotected in 30% (w/v) sucrose.
Tissue Freezing
Organs were mounted in OCT mounting medium (Bright Instruments, UK) in foil
molds of approximately 1 centimetre in diameter and left resting for half an hour at least (this
resting time ensures that all the sucrose solution is replaced by OCT). The preparations were
snap frozen in isopentane previously cooled down in liquid nitrogen, wrapped in tin-foil,
labelled and stored at -80ºC.
Cryostat Sectioning
Frozen organs were sectioned using a cryostat (Bright Instrument) at approximately 20ºC. Section thickness was adjusted to 7 µm for lung and 30 µm for the remaining organs.
Sections were collected onto charged slides (Polilysine glass slides, VWR International,
WitterWhorth, UK), wrapped in tinfoil and stored at -20ºC.
Microscopy
All microscopy observations were made using as Olympus BX-60 epifluorescence
microscope and pictures captured using a Zeiss Axiocam digital camera and analysed using
KS-300 3.0 software (Imaging Associates, Thames, UK).
2.3.4 Fluorescent In Situ Hybridization (FISH) for Y chromosome
Fluorescent in situ hybridization (FISH) assays of frozen tissue sections were used to
identify the Y-chromosomes in any engrafted, male cells. Briefly, frozen sections of 7 µm
were thawed and incubated in saline sodium citrate (4×SSC (sodium chloride-sodium citrate
in distilled/deionised water) buffer, pH 7.0) for 30 minutes. Slides were incubated in pepsin for
5 min and washed twice in PBS for 5 minutes, washed once with formaldehyde PBS/CMgCl2
for 1.5 minutes and with PBS for other 1.5 minutes, then followed by serial ethanol
dehydration steps (3 min each). Sections were denatured at 65ºC for 2 minutes in preheated
70% formamide and 2×SSC buffer, pH 7.0, and subsequently ‘quenched’ with ice-cold 70%
ethanol for 1.5 min. Serial ethanol dehydration was performed again. The mouse Y
chromosome probe is conjugated with a Cy3 tag (STAR*FISH; Cambio, Cambridge, England)
was denatured at 65ºC for 10 minutes and applied to the sections at 45 C. The sections were
20
coverslipped and sealed with rubber cement for incubation overnight in a hydrated slide box
at 42ºC. The next day, coverslips were carefully removed in preheated 2×SSC buffer, pH 7.0,
at 45ºC. Sections were placed in preheated 50% formamide in 2×SSC buffer for 5 minutes
each at 45ºC and gently washed twice in preheated 0.1×SSC buffer for 5 minutes each at 45
ºC. Appropriate positive and negative controls were included in each Y-FISH experiment.
21
3 Results
3.1
Differentiation and Characterization of Murine ESCs
Murine ESC-derived lung cell progenitors were derived following a modification of the
Rippon protocol 5. Culture was carried out in three steps according to Material and Methods
description. Endoderm differentiation was induced in EBs suspension cultures by the addition
of a combination of activin A and noggin. Lung cells, derived from the endoderm layer of the
embryo, and endoderm markers can be detectable from day 7 of culture 5.
Cultures were characterised at various time points. The presence of the endodermal
markers Foxa2 (Figure 2) and Sox17 (Figure 3) was evaluated by ICC.
A
B
C
D
Figure 2 – Foxa2 expression in day 7 EBs. ESCs committed to an endoderm lineage at day 7 were detected
by fluorescent ICC for foxa2. Foxa2 expression was detected mostly in the peripheral area of the EB. A –
Foxa2 (x20). B – Merging of Foxa2 (green) and DAPI (blue, x20). C – Foxa2 (x40). D – Merging of Foxa2
(green) and DAPI (blue, x40).
22
A
B
C
D
Figure 3 – Sox17 expression in day 7 EBs. ESCs committed to an endoderm lineage at day 7 EBs were
detected by fluorescent ICC for Sox17. Sox17 expression was detected mostly in the peripheral area of the
EB. A – Sox17 (x20). B – Merged Sox17 (green) and DAPI (blue) (x20). C – Sox17 (x40). D – Merged Sox17
(green) and DAPI (blue) (x40).
As can be observed, foxa2 and Sox17 expression was detected mostly in peripheral
regions of the EBs.
By day 21, green fluorescence appeared indicating the presence of SPC-expressing
cells (Figure 4). SCPeGFP fluorescence will be present in culture on average between days
21 and 35, being at maximum around day 25 5. SPC is an ATII specific marker, meaning that
the presence of eGFP-positive cells indicates differentiation of murine ESCs to ATII. The
observed SPCeGFP expression followed the special pattern shown by the endoderm
markers, being mostly detected in the periphery of the EBs, suggesting that SPCeGFP cells
are derived from those identified at day 7 as positive for endoderm markers.
23
A
B
C
D
Figure 4 – SPCeGFP expression in adherent EBs at day 21. ESCs committed to a distal lung lineage were
detected by eGFP expression at day 21. The images represent the overlapping of transmitted light and
fluorescent images. SPCeGFP expression occurs mostly at peripheral areas of the attached EBs (x40).
To further characterize the cultured cells and to quantify the ESCs expressing distal
lung lineage markers, cells were sorted by FACS at day 25, based on eGFP expression. This
time point corresponds to SPCeGFP maximum expression (Figure 5). The proportion of
SPCeGFP positive cells is 1% of total cells. Both SPCeGFP positive and negative cells were
retrieved and studied for specific markers (Figure 6 and Figure 7).
The sorted population was characterized by mRNA expression analysed by RT-PCR
(Figure 6). The population was studied for lung specific markers (SPC, TTF-1 and CCSP),
endoderm markers (Sox17, GATA4, and foxa2), mesoderm markers (Brachyury T), adult
progenitor cell markers (Sca1 and Abcg2/Bcrp1), endothelial markers (CD133, flk1/KDR and
CD31) and pluripotency markers (Oct4). The expression of lung specific markers was
observed only in SPCeGFP positive cells indicating their commitment to a distal lung lineage.
Pluripotency was assessed by the expression of Oct4. Neither eGFP positive nor eGFP
negative cells expressed Oct4 indicating the differentiated status of the population.
24
A
D
B
E
C
F
Figure 5 – FACS results from 2 experiments. The mixed population of murine ESCs-derived lung cells
progenitors was sorted by FACS for eGFP expression. The proportion of SPCeGFP positive cells was of
approximately 1%. A, D – Distribution of unsorted cells. B, E – Percentage of SPCeGFP positive and negative
cells. C, F – Distribution of cell number with fluorescence intensity.
Figure 6 – RT-PCR results. The day 25 mixed population of ESCs-derived lung cell progenitors sorted
by FACS was analysed for the expression of lung specific, endoderm, mesoderm, ectoderm,
hematopoietic and pluripotency markers by PCR. Lung specific markers SPC, CCSP and TTF-1 are
restricted to SPCeGFP positive cells. (Data generously provided by Doctor Helen Rippon)
25
The expression of endoderm markers was found in eGFP-positive and negative cells,
as was expected following activin A induction 5. The same expression pattern was found for
the endothelial markers. It should be noticed that some eGFP expression was detected in
cells of the supposedly eGFP-negative population, which could be due to contaminating
positive cells in the negative cell fraction resulting from the sorting procedure itself.
In parallel to mRNA analysis, both positive and negative sorted cells were cytospun
onto slides for ICC characterization. These results are presented in Figure 7 and Figure 8.
A
B
C
D
Figure 7 - The expression of SPC in SPCeGFP positive cells. SPC is a surfactant protein assembled in the
cytoplasm. SPC (red) and nuclei (DAPI blue). A, C – SPC positive cells. B, D – Overlapping of blue light,
green light and UV fluorescence. (A and B x20, C and D x40).
In fact, and most importantly, the presence of the SPCeGFP construct was evaluated
by confirming the expression of SPC in SPCeGFP-positive sorted cells (Figure 7) and the
potential for differentiation of ATII into ATI evaluated by the presence of Aquaporin 5 (a ATI
specific marker) in SPCeGFP positive cells (Figure 8). Unfortunately, SPCeGFP fluorescence
was lost during cell sorting.
26
A
B
C
D
Figure 8 - The expression of AQP5 in SPCeGFP positive cells. AQP5 is a membrane transporter present in
ATI. AQP5 (red) and nuclei (DAPI blue). A, C – AQP5 positive cells. B, D – Overlapping of blue light, green
light and UV fluorescence. (A and B x20, C and D x40).
27
3.2
Implantation of Murine ESC-Derived Lung Cell Progenitors
The potential of murine ESCs-derived distal lung progenitors to home and engraft to
lung was evaluated in vivo in C57BI/6 mice. The mixed population of cells was injected into
the tail vein of both healthy and LPS injured mice. Mice were administered unsorted
populations of cells (harvested between days 25 and 30 of culture) and were sacrificed at
different times post-implantation (Figure 9).
Figure 9 – Experimental layout of the implantation of murine ESC-Derived Lung Cell Progenitors. ESCs
were driven toward a distal lung cell lineage by culture with a combination of activin A and noggin. The
population of cells was labelled then injected into both healthy and LPS injured mice. Mice were
sacrificed at different times post-implantation and organs harvested for analysis.
The homing of implanted cells to the mouse lungs was confirmed by fluorescent
microscopy as cells were labelled with a green fluorescent cell tracker (CFSE). As the
co-localization of markers by fluorescent microscopy is a subject of controversy within the
28
scientific community, cells were also labelled with iron oxide nanoparticles (Figure 10)
allowing their detection by electron microscopy. Electron microscopy would confirm not only
the presence of the cells, but would also allow the confirmation of their phenotype.
Unfortunately, electron microscopy results were not ready in time for the submission of this
Master Thesis.
A
B
C
D
Figure 10 – Iron oxide cell labelling. Prior to implantation the population of lung cell progenitors was labelled
with a green fluorescent cell tracker protein, CFSE, and with iron oxide nanoparticles with a FITC tag (green
FITC tag and blue nuclei (DAPI)). A and B x40. C and D x60.
29
In vivo Studies
Sex-mismatched in vivo studies were carried out using female black C57BI/6 mice.
The studies were run in parallel in healthy and LPS injured mice. LPS injury is a well establish
model of ARDS. Injury was induced by intratracheal instillation of LPS toxin 6 or 24 hours
prior to murine ESCs implantation to evaluate the potential of the implanted cells at different
time points of injury evolution. Mice received 1×106 cells in 200 µL saline solution by tail vein
injection according to Materials and Methods description. Both health and injured mouse
controls received saline solution only. Mice were sacrificed at 1, 2, 5 and 7 days
post-implantation and organs harvested for analysis.
Weight gain is an indicator of the degree of mouse injury and recovery. Animal
weights were registered throughout these in vitro studies (Table 3 and Table 4). Mouse
weights were analysed in terms of percentage of body weight to allow data comparison.
Unfortunately, some time points lack duplicates, which limits the possible conclusions of the
weight variation study. This factor is clear when mice culled at 1 and 5 days are included
(Figure 11 and Figure 12). For these time points, there seems to be a decrease in body
weight that is out of the global tendency. If one ignores these time points, the results would be
comparable for healthy and injured mice and weight gains would be similar to the controls.
For the correct assessment of weight gains, more replicas of time points are needed.
Figure 11 – Representation of the changes in body weight of mice between implantation and cull.
Comparison of healthy and LPS injured mice. Control mice received only saline solution. Error bars
represent standard deviation from the average value.
30
Figure 12 - Representation of the changes in body weight of healthy mice between implantation and cull.
Comparison of the different types of labelled cells administered to healthy mice. Control mice received
saline solution only. Error bars represent standard deviation from the average value.
Table 3 – Summary of body weights for the healthy mice. Mice received CFSE and iron
oxide (Fe2O3) labelled cells. Controls received saline solution only. (*reduced dose 50%).
Weight (g)
% body Weight
Implantation
Cull
Cull
Cull (days)
Healthy
20.3
20.2
100
1
Healthy
19.9
21.0
106
2
Healthy
20.2
20.7
102
2
Healthy (Fe2O3)
17.4
18,7
107
2
Healthy
19.5
19.3
99
5
Healthy
19.3
19.5
101
7
Healthy
18.5
19.6
106
7
Healthy (Fe2O3) *
16.5
18.4
112
7
Healthy Control
19.6
20.5
105
2
Healthy Control
19.7
20.2
103
2
Healthy Control
19.5
19.0
97
7
Healthy Control
18.0
20.3
113
7
31
Table 4 - Summary of body weights for LPS injured mice. Mice received CFSE and iron oxide
(Fe2O3) labelled cells. Controls received only saline solution. (*reduced dose 50%).
Weight (g)
% body Weight
Implantation
Cull
Cull
Cull (days)
LPS 6 h
19.2
18.8
98
1
LPS 6 h
19.3
20.4
106
2
LPS 6 h
18.6
19.4
104
2
LPS 6 h (Fe2O3)
19.7
19.6
99
2
LPS 24 h
18.1
18.3
101
2
LPS 24 h (Fe2O3)
19.5
19.4
99
2
LPS 6 h
18.3
18.6
102
5
LPS 24 h *
19.2
20.0
104
7
LPS 24 h
18.2
18.8
103
7
LPS 24 h (Fe2O3) *
20.0
20.5
103
7
LPS 24 h (Fe2O3/CSFE)
18.5
20.5
111
7
LPS Control
19.7
20.0
102
1
LPS Control
18.9
19.6
104
7
32
Healthy Mice
Implanted distal lung progenitor cells were found in lungs of healthy mice at 1 (Figure
13), 2 (Figure 13) and 5 (Figure 14) days post-implantation. By day 7, no fluorescently
labelled cells were found in the lungs. The quantity of cells decreases with time postimplantation, with the maximum of cells found in mice culled after just 1 day (Figure 13).
Interestingly and contrarily to the descriptions of experiments implanting BM-derived
cells 71-77, injury does not seem to be necessary for the detection of cells in the lungs. Cells
were detected only in the distal lung and not in proximal airways or near large blood vessels.
Sections were analysed under blue fluorescence for the presence of the CFSE labelled cells,
green fluorescence to confirm that presence (unspecific fluorescence would be detectable
using all fluorescence filters) and under UV light for detection of nuclei (DAPI). The three
images were overlapped and the presence of labelled cells was confirmed by the
maintenance of the green colour in the overlapped image.
A
B
C
D
E
F
G
H
I
Figure 13 – Lung sections of healthy mice culled 1 day after cell implantation. The presence of murine
ESCs-derived lung cell progenitors in lungs of healthy mice 1 day after implantation was assessed by
fluorescence microscopy. Sections were observed under blue light fluorescence for the presence of the
labelled cells (A, B, C, D and G), this presence was confirmed by green light fluorescence (E and H)
and both images and UV fluorescence (nuclei, DAPI) were overlapped (F and I). A, B and C x4. D, E
and F x 10. G, H and I x20.
33
A
B
C
D
E
F
G
H
I
Figure 14 – Lung sections of healthy mice culled 2 days after cell implantation. The presence of murine
ESCs-derived lung cell progenitors in lungs of healthy mice 2 days after implantation was assessed by
fluorescence microscopy. Sections were observed under blue light fluorescence for the presence of the
cells (A, B, C, D and G; white arrows indicate green fluorescent cells), this presence was confirmed by
green light fluorescence (E and H) and both images and UV fluorescence (nuclei DAPI) were
overlapped (F and I). A, B and C x4. D, E and F x 10. G, H and I x20.
34
A
B
C
D
E
F
G
H
I
Figure 15 - Lung sections of healthy mice culled 5 days after cell implantation. The presence of murine
ESCs-derived lung cell progenitors in lungs of healthy mice 5 days after implantation was assessed by
fluorescence microscopy. Sections were observed under blue light fluorescence for the presence of
the cells (A, D and G; white arrows indicate green fluorescent cells), this presence was confirmed by
green light fluorescence (B, E and H) and both images and UV fluorescence (nuclei DAPI) were
overlapped (C, F and I). A, B and C x4. D, E and F x 10. G, H and I x20.
35
LPS Injured Mice
Labelled cells were found in lungs of mice LPS-injured 6 hours before implantation at
1 (Figure 16), 2 (Figure 17) and 5 (Figure 18) days post-implantation. The apparent number of
cells found in LPS injured mice seems to be lower than in healthy mice at the same time
points, though the same decreasing trend of cell number for later days post-implantation was
observed. Once more, the presence of cells was detected only in the distal lung and not in
proximal airways. The lower level of cells detected in this case could be explained by the
administration method. Cells were delivered intravenously and LPS injury is known to affect
lung vasculature, which might have destroyed the delivery channels.
Once again, sections were analysed under blue light fluorescence for the presence of
green labelled cells, green light fluorescence to confirm that presence, and UV light
fluorescence for the presence of the nuclei (DAPI).
A
B
B
C
D
E
F
G
H
I
Figure 16 – Lung sections of LPS injured (6 hours pre-implantation) mice culled 1 day after cell
implantation. The presence of labelled murine ESCs-derived lung cell progenitors in lungs of LPS
injured (6 hours before implantation) mice 1 day after implantation was assessed by fluorescence
microscopy. Sections were observed under blue light fluorescence for the presence of the cells (A, B,
C, D and G; white arrows indicate green fluorescent cells), this presence was confirmed by green light
fluorescence (E and H) and both images and UV fluorescence (nuclei DAPI) were overlapped (F and I).
A, B and C x4. D, E and F x 10 G, H and I x20.
36
A
B
C
D
E
F
G
H
I
Figure 17 – Lung sections of LPS injured (6 hours pre-implantation) mice culled 2 days after cell
implantation. The presence of murine ESCs-derived lung cell progenitors in lungs of LPS injured (6
hours before implantation) mice 2 days after implantation was assessed by fluorescence microscopy.
Sections were observed under blue light fluorescence for the presence of these cells (A, B, C, D and G;
white arrows indicate green fluorescent cells), this presence was confirmed by green light fluorescence
(E and H) and both images and UV fluorescence (nuclei DAPI) were overlapped (F and I). A, B and C
x4. D, E and F x 10. G, H and I x20.
37
A
B
C
D
E
F
G
H
I
Figure 18 - Lung sections of LPS injured (6 hours pre-implantation) mice culled 5 days after cell
implantation. The presence of murine ESCs-derived lung cell progenitors in lungs of LPS injured (6
hours prior to implantation) mice 5 days after implantation was assessed by fluorescence microscopy.
Sections were observed under blue light fluorescence for the presence of these cells (A, D and G;
white arrows indicate green fluorescent cells), this presence was confirmed by green light fluorescence
(B, E and H) and both images and UV fluorescence (nuclei DAPI) were overlapped (C, F and I). A, B
and C x4. D, E and F x 10. G, H and I x20.
38
Mice LPS injured 24 hours pre-implantation were culled at 2 and 7 days postimplantation. As for the studies with mice injured 6 hours pre-implantation, by day 7, no green
labelled cells were found in the lungs; however, positive cells were present at day 2 (Figure
19). In fact, the results for this particular time point are comparable to those for 6 hours LPS
injury (Figure 17) and the same reduction in the numbers of cells detected, when compared to
healthy mice, was observed (Figure 14).
A
B
C
D
E
F
G
H
I
Figure 19 - Lung sections of mice LPS injured 24 hours pre-implantation culled 2 days after cell
implantation. The presence of murine ESCs-derived lung cell progenitors in lungs of LPS injured mice
2 days after implantation was assessed by fluorescence microscopy. Sections were observed under
blue light fluorescence for the presence of these cells (A, D and G; white arrows indicate green
fluorescent cells), this presence was confirmed by green light fluorescence (B, E and H) and both
images and UV fluorescence (nuclei DAPI) were overlapped (C, F and I). A, B and C x4. D, E and F x
10. G, H and I x20.
39
Homing of ESC-Derived Lung Cell Progenitors
Specific homing of implanted distal lung progenitors to the lung was confirmed by
analysing the major organs: intestine, liver, spleen, kidney, heart, ovary and brain. Both
intestine and liver have the same embryonic origin as lung, the endoderm. The activin A and
noggin combination induces the formation of this germ layer and BM-derived cells are known
to engraft in these organs following injury 84. In the present study, no labelled cells were found
in the intestine or liver (Figure 20 and Figure 21, respectively) of the sacrificed animals.
A
B
C
D
E
F
Figure 20 – Intestine sections. The presence of murine ESCs-derived lung cell progenitors in the
intestine of the implanted mice was investigated by fluorescence microscopy. Sections were observed
under blue light fluorescence for the presence of the cells (A and D), this presence was confirmed by
green light fluorescence (B and E) and both images were merged (C and F). A, B and C x4. D, E and F x
10.
A
B
C
D
E
F
Figure 21 – Liver sections. The presence of murine ESCs-derived lung cell progenitors in the liver of
the implanted mice was investigated by fluorescence microscopy. Sections were observed under blue
light fluorescence for the presence of the cells (A and D), this presence was confirmed by green light
fluorescence (B and E) and both images were merged (C and F). A, B and C x4. D, E and F x 10.
40
In addition, no labelled cells were found in the spleen (Figure 22) or kidneys (Figure
23). Their presence in the spleen would indicate the triggering of an acute inflammatory
response. Labelled cells were likewise not detected in the heart (Figure 24), ovaries (Figure
25) or brain (Figure 26)
A
B
C
D
E
F
Figure 22 – Spleen sections. The presence of murine ESCs-derived lung cell progenitors in the spleen
of the implanted mice was assessed by fluorescence microscopy. Sections were observed under blue
light fluorescence for the presence of the cells (A and D), this presence was confirmed by green light
fluorescence (B and E) and both images were merged (C and F). A, B and C x4 magnification. D, E
and F x 10.
A
B
C
D
E
F
Figure 23 –Kidney sections. The presence of murine ESCs-derived lung cell progenitors in the kidney
of the implanted mice was assessed by fluorescence microscopy. Sections were observed under blue
light fluorescence for the presence of the cells (A and D), this presence was confirmed by green light
fluorescence (B and E) and both images were merged (C and F). A, B and C x4. D, E and F x10.
41
A
B
C
D
E
F
Figure 24 – Heart sections. The presence of murine ESCs-derived lung cell progenitors in the heart of
the implanted mice was assessed by fluorescence microscopy. Sections were observed under blue
light fluorescence for the presence of the cells (A and D), this presence was confirmed by green light
fluorescence (B and E) and both images were merged (C and F). A, B and C x4. D, E and F x 10.
A
B
C
D
E
F
Figure 25 – Ovary sections. The presence of murine ESCs-derived lung cell progenitors in the ovary of
the implanted mice was assessed by fluorescence microscopy. Sections were observed under blue
light fluorescence for the presence of the cells (A and D), this presence was confirmed by green light
fluorescence (B and E) and both images were merged (C and F). A, B and C x4. D, E and F x10.
42
A
B
C
D
E
F
Figure 26 – Brain sections. The presence of murine ESCs-derived lung cell progenitors in the brain of
the implanted mice was assessed by fluorescence microscopy. Sections were observed under blue
light fluorescence for the presence of the cells (A and D), this presence was confirmed by green light
fluorescence (B and E) and both images were merged (C and F). A, B and C x4. D, E and F x10.
Y-chromosome FISH: Preliminary Studies
Fluorescent in situ hybridisation (FISH) for the mouse Y chromosome was carried out
in order to confirm the origin of green-labelled cells observed in lung sections (Figure 27). The
co-localization of a green fluorescent marker with the red fluorescent Y-FISH (Y-FISH probe
in conjugated with a Cy3 tag) staining would indicate that the green labelled cell were male
cells. Since the in vivo studies were sex-mismatched, co-localization would confirm the
presence of the implanted distal lung progenitor cells.
A
B
C
Figure 27 - Y-FISH preliminary study. The presence of implanted murine ESC-derived lung cell
progenitors in the lungs of the implanted mice was assessed by Y-FISH. Sections were observed under
blue light fluorescence for the presence of the cells (A), the presence of Y-FISH positive cells assessed
under green light fluorescence (B) and both images and UV fluorescence (nuclei DAPI) were
overlapped (C). A, B and C x20. (White arrow – Green fluorescent-labelled cell; Grey arrow – Y-FISH
labelled cell)
The preliminary studies did not allow the confirmation of the phenotype of the green
fluorescent cells. In fact, Y-FISH positive cells were observed indicating the presence of male
43
cells that were not green fluorescent. This fact could indicate unspecific hybridisation, being
necessary to optimize the present protocol. On the other hand, this absence of co-localization
could mean the presence of male cells unlabelled. The presence of unlabelled cells can be
explained by the lost of CFSE fluorescence with cell proliferation or cell fusion of implanted
cells with lung cells, as hypothesised for BM-derived cells 85-87. Nevertheless, FISH protocol is
being optimized to assure the reliability of the preliminary results.
Electron Microscopy: Preliminary Studies
Electron microscopy was carried out to confirm homing and engraftment of implanted
cells. Electron microscopy experiments are, in fact, part of ongoing work and at the time of
submission of this Master Thesis, only preliminary results for the identification of the
nanoparticles were available (Figure 28). Iron oxide nanoparticles are internalised in vesicles.
A
B
C
Figure 28 – Electron microscopy preliminary study. The presence of implanted murine ESC-derived
lung cell progenitors in the lungs of the implanted mice was assessed by electron microscopy. Lung
samples were processed and analysed for the presence of iron oxide nanoparticles (White arrow). A x34000. B - x46000 . C - x64000
44
4 Discussion
This study evaluates the potential of murine ESC-derived distal lung epithelial
progenitors to home to injured lungs and promote epithelial regeneration and repair.
Alveolar epithelial cell damage is an important initial event in several lung disorders
such as ALI or COPD. Epithelial cell damage and cell death leads to the formation of gaps in
the epithelial basement membrane. Normal repair of the epithelial layer occurs through the
proliferation of ATII and their subsequent differentiation into the ATI needed for normal lung
function. However, the presence of lung injury alters significantly this regeneration process.
The number of ATII decreases markedly in areas of severe inflammation and extensive injury.
In fact, in injury, ATI and ATII die and are replaced by a large number of fibroblasts and
smooth muscle cells in a process that may lead to lung fibrosis. The availability of an
exogenous source of ATII to restore its pool, might promote lung regeneration and repair.
ATII have a number of important physiological functions such as the production,
secretion and turnover of pulmonary surfactant. Surfactant maintains a low surface tension at
the air-liquid interface of the alveoli, necessary for a proper respiratory function, thus the
presence of exogenous ATII would improve the maintenance of normal lung function and
promote normal epithelial repair. Although the effect of the administration of an exogenous
source of ATII in lung repair is not clear yet, a recent report suggests that these cells prevent
lung fibrosis
92
. ATII are also a rich source of chemokines, including inhibition factors for
fibroblast proliferation and the secretion of collagen
124
. The presence of these compounds in
the injured lung, from an exogenous source, might induce degradation of the new collagen
deposition and halt the fibrotic process
124
. Moreover, the secretion of these compounds by a
cell could constitute a local factory that allows the production to be controlled endogenously in
response to injury stimulus.
The pivotal role played by ATII in alveolar physiology and normal lung regeneration
enhances the importance of the present study. The evaluation of the potential of an ex-vivo
derived source of ATII to home and engraft to injured lungs is a first step toward tissue
engineering and cell therapy strategies for the lung. In vivo studies using mouse models is the
most appropriate approach for the first evaluation of ESC-based therapies in a process that
will culminate in the differentiation of ATII from human ESCs and their administration.
45
4.1
Differentiation and Characterization of Murine ESCs
Murine ESCs were driven to a distal lung progenitor cell lineage following a
modification of Rippon three step protocol
5
where mESCs were cultured in the presence of
activin A and noggin at the initial stages of suspension culture iii . As previously described, this
combination allows the induction of endoderm and mesoderm and the inhibition of ectoderm
formation. Activin A has been shown to induce endoderm formation by the activation of nodal
signalling, necessary for the formation of definitive endoderm in the embryo 5. Moreover, the
cell line used has a SPCeGFP construction, meaning that when SPC (an ATII specific
marker) is being expressed, eGFP is also produced.
The detection of the desired markers was achieved by PCR and ICC studies at
different time points. The first evidence of differentiation appears around day 7 of culture
when the first endoderm markers are express (Figure 2 and Figure 3). By day 21, the first
evidence of a distal lung lineage commitment rises as eGFP expression starts to be
noticeable (Figure 4). The differentiation yields of ATII were very low, between 1 and 5%
(Figure 5), with variation between differentiation rounds, and are comparable to those in the
literature 4,88-91.
SPCeGFP-positive and negative cells were sorted, and then analysed by PCR for the
presence of several markers (Figure 6). Some cells were cytospun and the expression of
SPC confirmed by ICC (Figure 7). The confirmation of SPC expression allowed evaluation of
the SPCeGFP construct used to detect initial commitment to a distal lung cell lineage, thus
validating simultaneous expression of SPC and GFP. However, it should be noted that eGFP
fluorescence was lost during the sorting process, probably by the destruction of the protein by
the shear forces present in the process. The presence of ATI cells was also evaluated by ICC
(Figure 8). This present can probably be explained by the differentiation of ATII cells that were
derived from the mESCs, indicating that the derived ATII have the potential to differentiate
into ATI as occurs in vivo.
The analysis of mRNA expression allowed the confirmation of activin A and noggin
induction of endoderm, following what was previously reported within the research group 5.
Cells expressed both late (foxa2 and Sox17) and early (gata4) endoderm markers; the
expression of mesoderm, as previously described
5
was also observed (Brachyury T). As
expected, expression of SPC, TTF-1 and CCSP was observed only in SPCeGFP positive
cells, although expression of CCSP (a Clara cell marker and thus a mature lung cell marker)
appears to be lower than early differentiation markers for lung (SPC and TTF-1). The
confirmation of the commitment to a distal lung cell progenitor lineage was obtained by the
simultaneous expression of early differentiation lung markers (TTF-1 and SPC) and adult
iii
Ongoing work within the group.
46
progenitor cell markers (Abcg2/Bcrp1 and Sca1). Moreover, no Oct4 expression was found,
indicating the loss of pluripotency of the injected population of cells. The loss of pluripotency
reduces the tumour-induction risk associated with the administration of exogenous cells,
making them more suitable for clinical use. Finally, the expression of endothelial markers
suggests the potential of the implanted population of cells to participate in endothelial
regeneration.
4.2
Implantation of Murine ESC-Derived Lung Cell Progenitors
The population of distal lung progenitor cells was delivered intravenously to healthy
and LPS injured mice in order to evaluate their potential for homing and engraftment. LPS
injury is a well established model of ARDS, a lung disorder
116
. One of the most important
ARDS consequences is inflammation a common symptom to the major lung disorders. LPS
injury is induced by intratracheal instillation of toxin and cell administration was intravenous,
both reducing animal suffering.
Since weight gain is a well-established method of assessing mouse injury, these were
registered at implantation and at cull. The pilot data collected (Figure 11 and Figure 12) does
not allow a precise evaluation of mouse health, as the lack of duplicates for some time points
enhances the mouse to mouse variability. However, it is clear from the analysis of the
evolution of weight gains that the results for mice culled at 1 and 5 days after implantation are
out of the global and expected tendency (Figure 11). Interanimal variability probably plays an
important role in the observed discrepancies.
Healthy mouse weight increases in a similar way to the respective control. Although
the need for more duplicates is clear, these pilot results suggest that implanted cells do not
affect the normal development of the mice
The evaluation of lung injury is also possible by evaluating tissue structure. In normal
lung, the airspaces occupy the majority of the lung’s section area (Figure 13 G). In injured
lungs, the fibrotic process leads to the reduction of airspace and fibrotic tissue starts to be
predominant (Figure 16 G). If one compares the appearance of injured lungs 1 day (Figure 16
G) and 5 days (Figure 18 G) after implantation, the reduction of fibrotic tissue is clear. Indeed,
by day 5, airspace has recovered the predominance over the section area and the structure of
the injured lungs, as observed under the fluorescent microscope, are comparable to those of
healthy mice (Figure 13 G). Any role of administered cells in this process is unclear, however
ATII are known to play a major role in lung regeneration and the presence of injury is known
to disrupt the normal activity of endogenous ATII. The presence of a fresh source of these
47
cells could prevent the fibrotic process as the disruption of lung epithelium could be repaired
with fresh ATI cells generated from the ATII.
From the tissue engineering point of view, the implantation of progenitor cells has
several advantages. First, the implantation of proliferative progenitor cells instead of fully
differentiated cells should facilitate their integration in the host tissue: the differentiation
potential allows these cells to integrate into any of the lung niches. Moreover, proliferative
cells are more likely than mature cells to continue to proliferate within the host tissue, thus
reducing the initial cell number of implanted cells needed. Third, early distal lung progenitor
cells are capable of differentiating into several types of mature lung cells: ATI, ATII and Clara
cells. Their implantation would allow the cells to mature and integrate into lungs where they
are most needed, facilitating lung regeneration and repair. Their differentiation into the several
lung cell types could be induced in vivo by tissue specific signals and the lung
microenvironment, allowing the initial population to adapt to the host tissue’s needs and
further promoting exogenous cell integration.
The implantation of ATII cells or distal lung progenitor cells could also have a
significant advantage over the recruitment of circulating cells. In fact, recent evidence
suggests that BM cells migrate to wound-healing sites and serve as sources of fibroblasts 77.
In the lung, this could represent an addition to the undesired fibrotic process in response to
injury. Thus, the implantation of ATII cells has been shown to prevent this process
77
and so
an exogenous source of these cells could be clearly a more effective means of repairing
damaged lungs than the recruitment of BM-derived cells.
4.2.1 Homing of Murine ESC-Derived Lung Cell Progenitors
Homing of murine ESC-derived lung cell progenitors was assessed by fluorescence
microscopy of thin sections. All of the major organs were screened to fully evaluate the
potential of distal lung progenitors to home specifically to damaged lungs. All sections were
observed under blue light fluorescence for the presence green labelled cells, green light
fluorescence to confirm the specificity of the observed fluorescence (since unspecific
fluorescence would be present in both) and under UV fluorescence for DAPI stained nuclei.
The presence of green fluorescent cells was confirmed in the lungs of both healthy
and LPS injured mice. The majority of observed cells were found in the distal lung and not in
the proximal lung or upper airways. In all other screened organs, no labelled cells were found.
The presence of cells only in lungs could be a result of one of two major factors. One,
the cells were administered to the mice via the tail vein. This vein conducts the cells directly
48
into the lungs and no signal dependant/specific homing mechanism is present in the observed
result. Two, a homing mechanism, probably a tissue specific signal, promotes the homing of
the implanted progenitor cells to the lungs. The last hypothesis is particularly interesting if one
relates the possible homing signal with the cell type administered.
Lung progenitor cells may be considered as niche specific stem cells for the lung.
Therefore, it might be reasonable to assume that their natural habitat, the distal lung, may
affect the ability of these cells to home specifically to lungs. Once in the lung, these cells
would recognise their niche specific signals and would not be mobilised to other organs.
One very important issue must be raised within this discussion: homing of murine
ESC-derived distal lung progenitors was assessed by fluorescent microscopy only. At
present, this evaluation method is subject of a wide debate concerning its accuracy. Several
reports have been published were the validity of homing and engraftment of BM-derived cells
to lungs assessed by co-localization of markers was questioned
75,76
. In fact, the scientific
community was able to reach an agreement and methods that are more accurate are needed
to be used to confirm the co-localization of markers, such as confocal and electron
microscopy.
In this context, the implanted distal lung progenitor cells were also labelled with iron
oxide nanoparticles with a FITC tag, traceable by both fluorescence and electron microscopy.
Unfortunately, electron microscopic results were not ready in time for the submission of this
report. These results would allow the confirmation of the presence of exogenous cells in the
lungs of experimental mice. Moreover, electron microscopy would be an accurate way to
confirm the phenotype of the implanted cells and would allow confirmation of the engraftment
of exogenous cells in the host tissue and facilitating the characterization process usually done
by co-localization of markers.
4.2.2 Overtime Maintenance of Murine ESC-Derived Lung Cell Progenitors
Murine ESC-derived lung cell progenitors were found in lungs of both healthy and
LPS injured mice 1, 2 and 5 days after implantation. Initial studies and ongoing experiments
suggest that they are not present after 7 days. Although no quantification was performed, the
number of cells present in the lung seems to reduce over time post-implantation, until their
complete absence at the latest time point analysed, 7 days. In fact, recently, other groups
have realized that the mouse strain used in the present study show an unusual and
unexpected rejection response to exogenous cells (personal communication). This might
suggest that the observed results are a function of the mouse immune response. Therefore, it
49
will be necessary to compare the presented results with future similar studies using different
strains of mice eliminating specific strain constrictions.
Another possibility to assess eventual strain specific immune responses is to change
the administration method. A recent study showed that adult ATII transplanted intratrachealy
have a pivotal role in preventing and reversing the fibrotic process developed in response to
bleomycin injury
92
. Nevertheless, it is important to emphasise that intravenous administration
would be the simplest way to administer cells in clinical practice.
Although the rejection of the cells by the lungs is a valid explanation for the observed
results, one could hypothesise that cells are retained in the lungs only for the period that they
are needed. Recent reports suggest that the presence of exogenous cells in injured lungs
may result in a modulation of the inflammatory response
110,111
. Assuming that distal lung
progenitor cells could have the same modulator role as implanted MSCs in the above-cited
studies, their presence in the lung may be necessary only for the initial response to lung
damage. Therefore, it is reasonable to assume that after having an important role in the initial
response and having lost injury signals, exogenous cells could be expelled. In this context, it
is necessary to assess the potential role of distal lung progenitor cells in the modulation of
lung inflammatory response to be able to ensure that the reduction observed in implanted
distal lung progenitor cells is a consequence of the decreasing level of injury with time.
4.2.3 Homing of Murine ESC-Derived Lung Cell Progenitors and Injury
Distal lung progenitor cells were found in lungs of both healthy and LPS injured mice.
The level of injury assessed by the administration of LPS 6 and 24 hours prior to implantation
seems to indicate no difference in terms of cell engraftment. Although cells were found in both
healthy and injured lungs, one difference is clear: the number of distal lung progenitors found
in the lungs of injured mice was much lower than in healthy mice. One explanation for the
observed difference is the administration route. As previously described, cells were
administered intravenously and LPS toxin is known to have a disruptive effect on vasculature.
This disruptive effect may destroy the capillary network of the lung and diminish the
administration route efficiency. This diminishment of the administration route would also be
promoted by the undesired triggering of the fibrosis process, which results in a general
thickening of the endothelium, thus making it more difficult for the cell to cross the endothelial
barrier between circulation and alveolar environment.
Another possible explanation for the differences observed is the loss of the cell tracer
green fluorescence with cell proliferation. In the presence of injury, ATII are known to
proliferate and replace their own pool as the existent ATII would differentiate into ATI, which
50
have been destroyed by injury. This active proliferation in response to injury could induce the
loss of the CFSE staining. At each division, the quantity of CFSE dye in each cell is reduced
by half in each of its daughter cells. This CFSE halving could have resulted in an apparent
lower number of exogenous cells in injured mice compared to healthy ones.
The presence of distal lung progenitor cells in healthy and injured mice is a rather
surprising result. Several reports suggested the existence of a threshold value of injury for the
recruitment of BM-derived cells to injured lungs and no cells were found in healthy lungs
71,77,84
. For the recruitment of BM cells it seems reasonable to assume that a threshold of
injury is needed. The same assumption is not straight when one explores the administration
of ex-vivo lung lineage committed cells. Moreover, when the population of cells administered
is composed of distal lung progenitor cells, which can be considered niche specific stem cells
for the lung, it is reasonable to assume that those cells would be able to integrate both
healthy and injured lungs. In fact, a recent report using adult ATII shows that these cells are
present in both healthy and injured mice 92 .
Although no threshold of injury seems to be needed, the study of other types of injury,
like elastase-induced emphysema or bleomycin-induced fibrosis could be of particular interest
to evaluate the real relation between the administration of distal lung progenitor cells and
injury.
51
5
Conclusions and Future Trends
This study provides the first evidence of homing of mESC-derived distal lung
progenitor cells to lungs of healthy and LPS injured mice. Although further confirmation of
engraftment and homing is needed, the presented results constitute a preliminary evidence of
the capability a mixed population of murine ESC-derived distal lung progenitor cells to home
and participate in lung regeneration and repair. This might be regarded as the first step
towards the evaluation of the possible role of ESCs in lung regeneration and repair, aiming to
reach human lung regenerative medicine in the future.
In a first attempt to improve the previously established mESC culture system, new
protocols for the derivation of distal lung progenitor cells that would allow greater yields of
differentiation should be explored. These would be cost and time reducing and would allow an
easier development of the proposed strategy for lung regeneration and repair.
Also in terms of future trends, one of the major goals will be the confirmation of
engraftment by more accurate techniques such as confocal microscopy for the co-localization
of markers (lung markers and Y chromosome, for example – ongoing work) or electron
microscopy (also ongoing work).
Moreover, the role of exogenous murine-derived distal lung cell progenitor in lung
injury and repair must be clarified, by other lung injury models and evaluating the potential
effect of these exogenous cells in the modulation of the inflammatory response and the
fibrotic process.
For tissue engineering and regenerative medicine of the lung, the possibility of
administrating an exogenous population of distal lung cell progenitor intravenously has
several clear clinical advantages. First, intravenous administration is a common clinical
practice procedure. Second, a rather immature, but also lineage-committed population of
cells, instead of an undifferentiated ESCs cell population with tumourogenic potential, would
allow cell differentiation only in the host microenvironment, thus contributing for a more
specific response to injury and allowing the exogenous pool of cells to differentiate towards
the different mature cells existent in the lung. This differentiation could be promoted by
signals present in the host microenvironment. Finally, an active population of progenitor cells,
rather than fully differentiated cells, could proliferate in the injured microenvironment, thus
reducing the initial cell number administrated to the patient.
The possibility of an exogenous unlimited source of cells that are able to promote
lung injury repair would be of doubtless clinical impact and would represent in the majority of
52
severe lung injuries, an alternative means of cure allowing to save millions of lives per year,
as lung diseases are estimated to be the third leading cause of death by 2020.
The potential of the population of cells studied is not restricted only to lung
regeneration. A population of distal lung progenitor cells could provide the means for the
development of lung toxicity assays or ex-vivo drug testing. At present, the first artificial lungs,
based on membrane technology, are in clinical use in Germany (NovaLung
®
). The
replacement of membranes by a stem cell-derived lung epithelium would clearly represent a
major breakthrough. Moreover, the mixed population of cells express several endoderm
markers suggesting that they may have potential to participate in regeneration and repair of
other endoderm-derived organs, such as gut or pancreas.
Finally, in terms of the in vivo cell studies using the mice model, more duplicates for
the different time points should be performed. In addition, the time of cell injection should be
studied regarding the evolution of lung injury in order to assess in which period of LPS injury
this potential treatment is more effective.
Overall, if the potential of distal lung progenitor cells in lung regeneration and repair is
confirmed, the further development of the derivation of distal lung progenitor cells from human
ESCs must concern the need to scale-up the ex-vivo culture process. In fact, for clinical
implementation of ESC cell technology, a quality controlled and reproducible system is
needed for the controlled differentiation of those cells into functional progeny.
53
6 References
1 – Murray, JL and Lopez, AD (1997) Alternative projections of mortality and disability by cause 19902020: Global Burden of Disease Study. The Lancet, 349
2 – The British Thoracic Society (2006) Burden of Lung Disease (2nd edition) Press Release
3 - The American Thoracic Society (2006) COPD will cost U.S. $800+ billion over the next 20 year.
Press Release
4 – Sile, L. Rippon, HJ, Bishop, AE (2007) Stem cells in lung repair and regeneration. Article in press
5 - Rippon, HJ, Polak, JM, Qin, M, Bishop, AE (2006) Derivation of distal lung epithelial progenitors from
murine embryonic stem cells using a novel 3-step differentiation protocol. Stem Cells 24;1389-1398
6 – Hogan BLM (1999) Morphogenesis. Cell 96, 225.
7 – Adamson IY (1991) Development of lung structure. In: Crystal RG, West JB, eds. The Lung:
Scientific Foundations. New York: Raven Press Ltd
8 – Bishop, AE (2004) Pulmonary epitheliam cells. Cell Prolif. 37; 89-96
9 - Bindreiter M, Schuppler J, Stockinger L (1967) Zell proliferation and differenzerung im tracheal
epithel der ratte. Exp. Cell Res. 50, 377.
10 - Mezey, E, Chandross, KJ, Harta, G, Maki, RA, McKercher, SR (2000) Turning blood into brain: cells
bearing neuronal antigens generated in vivo from bone marrow. Science 290:1779-1782.
11 - Fuchs E and Segre JA (2000) Stem cells: a new lease on life. Cell 100:143-155.
12 - Weissman IL (2000) Stem cells: units of development, units of regeneration, and units in evolution.
Cell 100:157-168.
13 - Blau HM, Brezelton TR, Weimann JM (2001) The evolving concept of a stem cell: entity or function?
Cell 105:829-841.
14 – Samadikuchaksaraei, A, Cohen, S, Isaac, K, Rippon, HJ, Polak, JM, Bielby, RC, Bishop, AE (2002)
Derivation of distal epithelium from human embryonic stem cells. Tissue Eng. 12: 867-75
15 – Sylvester, KG and Longaker, M.T. (2004) Stem cells-review and update. Arch Surg. 139, 93-99
16 – Evans, M.J. and Kaufman, M. (1981) Establishment in culture of pluripotent cells from mouse
embryos. Nature. 292, 154-156.
17 – Martin, G.R. (1981) Isolation of a pluripotent cell line from early mouse embryo cultures in medium
conditioned by teratocarcinom stem cells. Proc. Natl. Acad. Sci. USA. 78, 7634-7.
18 –Thomson, JA, Itskovitz-Eldor, J, Shapiro, SS, Waknitz, MA, Swiergiel, JJ, Marshall, VS, Jones , JM
(1998) Embryonic stem cells lines derived from human blastocysts. Science. 282, 1145.
19 – Itskovitz-Eldor J, Schuldiner M, Karsenti D, Eden A, Yanuka O, Amit M, Soreq H, Benvenisty N.
(2000) Differentiation of human embryonic stem cells into embryoid bodies compromising the three
embryonic germ layer. Mol Med, 6, 88-95.
20 –Coraux, C, Nawrocki-Raby, B, Hinnrasky, J, Kileztky, C, Gaillard, D, Dani, C and Puchelle,E (2005)
Embryonic stem cells generate airway epithelial tissue. Am J Respir Cell Biol. 32, 87-92.
21 – Ronald G. Crystal, John B. West , Peter J. Barnes and Ewald R. Weibel (1991) The Lung: scientific
foundations. New York: Raven Press. 2 v (xxxix, 2224 p.).
22 - Breeze RG, Wheeldon EB (1977) The cells of the pulmonary airways. Am. Rev. Respir. Dis. 116,
705.
23 - Lane BP, Gordon R (1974) Regeneration of rat tracheal epithelium after mechanical injury. Proc.
Soc. Exp. Biol.Medical 145, 1139.
24 - Inayama Y, Hook GE, Brody AR, Jetten AM, Gray T, Mahler J, Nettesheim P (1989) In vitro and in
vivo growthand differentiation of clones of tracheal basal cells. Am. J. Pathol. 134, 539.
25 - Nettesheim P, Jetten AM, Inayama Y, Brody AR, George MA, Gilmore LB, Gray T, Hook GE (1990)
Pathways of differentiation of airway epithelial cells. Environ. Health. Perspect. 85, 317.
26 - Liu JY, Nettesheim P, Randell SH (1994) Growth and differentiation of tracheal epithelial progenitor
cells. Am. J.Physiol. 266, 296.
54
27 - Engelhardt JF (2001) Stem cell niches in the mouse airway. Am. J. Respir. Cell Mol. Biol. 24, 649.
28 - Borthwick DW, Shahbazian M, Krantz QT, Dorin JR, Randell SH (2001) Evidence for stem cell
niches in the tracheal epithelium. Am. J. Respir. Cell Mol. Biol. 24, 662.
29 - Clara M (1937) Zur Histobiologie des Bronchialepithels. Z. Microsk Anat. Forsch. 41, 321.
30 - Evans MJ, Cabral LJ, Stephens RJ, Freeman G (1975) Transformation of alveolar type II cells to
type I cells following exposure to nitrogen dioxide. Exp. Mol. Pathol. 22, 145.
31 - Evans MJ, Johnson LV, Stephens RJ, Freeman G (1976) Renewal of the terminal bronchiolar
epithelium in the rat following exposure to NO2 or O3. Lab. Invest. 35, 246.
32 - Plopper CG, Dungworth DL (1987) Structure, function, cell injury and cell renewal of bronchiolar
and alveolar epithelium. In: Mcdowell EM, ed. Lung Carcinoma, p. 29. London: Churchill Livingstone.
33 - Boers JE, Ambergen AW, Thunnissen FB (1999) Number and proliferation of clara cells in normal
human airway epithelium. Am. J. Respir. Crit. Care Med. 159, 1585.
34 - Mahvi D, Bank H, Harley R (1977) Morphology of a naphthalene-induced bronchiolar lesion. Am. J.
Pathol. 86, 559.
35 - Plopper CG, Suverkropp C, Morin D, Nishio S, Buckpitt A (1992) Relationship of cytochrome P-450
activity to Clara cell cytotoxicity. I. Histopathologic comparison of the respiratory tract of mice, rats and
hamsters after parenteral administration of naphthalene. J. Pharmacol. Exp. Ther. 26, 353.
36 - Stripp BR, Maxson K, Mera R, Singh G (1995) Plasticity of airway cell proliferation and gene
expression after acute naphthalene injury. Am. J. Physiol. 269, L791.
37 - Reynolds SD, Giangreco A, Power JHT, Stripp BR (2000a) Neuroepithelial bodies of pulmonary
airways serve as a reservoir of progenitor cells capable of epithelial regeneration. Am. J. Pathol. 156,
269.
38 - Reynolds SD, Hong KU, Giangreco A, Mago GW, Guron C, Morimoto Y, Stripp BR (2000b)
Conditional Clara cell ablation reveals a self-renewing progenitor function of pulmonary neuroendocrine
cells. Am. J. Physiol. Lung Cell Mol. Physiol. 278, L1256.
39 - Hong KU, Reynolds SD, Giangreco A, Hurley CM, Stripp BR (2001) Clara cell secretory proteinexpressing cells of the airway neuroepithelial body microenvironment include a label-retaining subset
and are critical for epithelial renewal after progenitor cell depletion. Am. J. Respir. Cell Mol. Biol. 24,
671.
40 - Giangreco A, Reynolds SD, Stripp BR (2002) Terminal bronchioles harbor a unique airway stem
cell population that localizes to the bronchoalveolar duct junction. Am. J. Pathol. 161, 173.
41 - Kim CFB, Jackson EL, Woolfenden AE. (2005) Identification of bronchioalveolar stem cells in
normal lung and lung cancer. Cell 121, 823-835
42 - Sabatini F, Petecchia L, Tacian M, de Villeroche VJ, Rossi GA, Brouty-Boye D (2005) Human
bronchial fibroblasts exhibit a mesenchymal stem cell phenotype and multilineage differentiating
potentialities. Lab Invest 85, 962-971
43 - Lama VN, Smith L, Badri L (2007) Evidence for tissue resident mesenchymal stem cells in human
adult lung from studies of transplanted allografts. J. Clin. Invest. 117(4), 1-8.
44 - MacKin CC (1954) The pulmonary alveolar mucoid film and the pneumocytes. Lancet 29, 1099.
45 - Evans MJ, Stephens RJ, Freeman G (1971) Effects of nitrogen dioxide on cell renewal in the rat
lung. Arch. Intern.Med. 128, 57.
46 - Adamson IY, Bowden DH (1974a) The type 2 cell as progenitor of alveolar epithelial regeneration.
A cytodynamic study in mice after exposure to oxygen. Lab. Invest. 30, 35.
47 - Evans MJ, Cabral LJ, Stephens RJ, Freeman G (1975) Transformation of alveolar type II cells to
type I cells following exposure to nitrogen dioxide. Exp. Mol. Pathol. 22, 145.
48 - Witschi H (1978) Proliferation of type II alveolar cells: a review of common responses in toxic lung
injury. Toxicology 5, 267.
49 - Kauffman SL (1980) Cell proliferation in the mammalian lung. Int. Rev. Pathol. 22. XXX.
50 - Bowden DH (1981) Alveolar response to injury. Thorax 267, 277.
51 - Adamson IY, Bowden DH, Cote MG, Witschi H (1977) Lung injury induced by butylated
hydroxytoluene: cytodynamic and biochemical studies in mice. Lab. Invest. 36, 26.
55
52 - Adamson IY, Bowden DH (1974b) The pathogenesis of bleomycin-induced pulmonary fibrosis in
mice. Am. J. Pathol. 77, 185
53 - Adamson IY, Bowden DH (1979) Bleomycin-induced injury and metaplasia of alveolar type 2 cells.
Relationship of cellular responses to drug presence in the lung. Am. J. Pathol. 96, 531.
54 - Shami SG, Evans MJ, Martinez LA (1986) Type II cell proliferation related to migration of
inflammatory cells into the lung. Exp. Mol. Pathol. 44, 344.
55 - Reddy R, Buckley S, Doerken M, Barsky Y, Weinberg K, Anderson KD, Warburton D, Driscoll B
(2003) Isolation of a putative progenitor subpopulation of alveolar epihtelial type 2 cells. Am. J. Physiol.
Lung Cell Mol. Physiol. Available online at: 10.1152/ajplung.00159.2003.
56 - Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA, Simonetti
DW, Craig S, Marshak DR (1999) Multilineage potential of adult human mesenchymal stem cells.
Science 284:143-147.
57 - Prockop DJ (1997) Marrow stromal cells fo non hemapoietic tissues. Science 276:71-74.
58 - Pereira RF, O’Hara MD, laptev AV (1998) Marrow stromal cels as a source of progenitor cells for
nonhemapoietic tissues in transgenic mice with a phenotype of osteogenesis imperfecta. Proc. Natl.
Acad. Sci. USA 95:1142-1147.
59 - Ferrari G, Cusella-De Angelis G, Coletta M, Paolucci E, Stornaiuolo A, Cossu G, Mavilio F. (1998)
Muscle regeneration by bone marrow-derived myogenic progenitors. Science 279:1528-1530.
60 - Jens M Nygren, Stefan Jovinge, Martin Breitbach, Petter Säwén, Wilhelm Röll, Jürgen Hescheler,
Jalal Taneera, Bernd K Fleischmann & Sten Eirik W Jacobsen (2001) Bone marrow cells generate
infarcted myocardium. Nature 410:701-705.
61 - Mezey E, Chandross KJ, Harta G, Maki RA, McKercher SR (2000) Turning blood into brain: cells
bearing neuronal antigens generated in vivofrom bone marrow. Science 290:1779-1782.
62 - Petersen BE, Bowen WC, Patrene KD, Mars WM, Sullivan AK, Murase N, Boggs SS, Greenberger
JS, Goff JP (1999) Bone marrow as a potential source of hepatic oval cells. Science 284:1168-1170.
63 - Alison, MR, Poulsom, R, Jeffery, R, Dhillon, AP, Quaglia, A, Jacob, J, Novelli, M, Prentice, G,
Williamson, J, Wright, NA (2000) Hepatocytes from non-hepatic adult stem cells. Nature 406:257.
64 – Lagasse, E, Connors, H, Al-Dhalimy, M, Reitsma, M, Dohse, M, Osborne, L, Wang, X, Finegold, M,
Weissman, IL (2000) Purified hematopoietic stem cells can differentiate into hepatocytes in vivo. Nat.
Med. 6:1229-1234.
65 – Theise, ND, Nimmakayalu, M, Gardner, R, Illei, PB, Morgan, G, Teperman, L, Henegariu, O,
Krause, DS (2000) Liver from bone marrow in humans. Hepatol. 32:11-16
66 - Poulsom R. Forbes S.J.; Hodivala-Dilke K.; Ryan E.; Wyles S.; Navaratnarasah S; Jeffery R.; Hunt
T.; Alison M.; Cook T.; Pusey C.; Wright N.A (2001) Bone marrow contributes to renal parenchymal
turnover and regeneration. J. Pathol. 195:229-235.
67 – Jiang, Y , Jahagirdar, BN , Reinhardt, RL, Schwartz, RE, Keene, CD, Ortiz-Gonzalez, XR, Reyes,
M, Lenvik, T, Lund, T, Blackstad, M, Du, J, Aldrich, S, Lisberg, A, Low, WC, Largaespada, DA, Verfaillie,
CM (2002) Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 418:41-49.
68 - Kotton DN, Ma BY, Cardoso WV (2001).Bone marrow-derived cells as progenitors of lung alveolar
epithelium. Development 128, 5181-5188
69 - Okamoto R, Yajima T, Yamazaki M (2002) Damaged epithelia regenerated by bone marrow-derived
cells in the human gastrointestinal tract. Nat. Med. 8, 1011-1017.
70 - Luis A. Ortiz, Frederica Gambelli, Christine McBride, Dina Gaupp, Melody Baddoo, Naftali
Kaminski, and Donald G. Phinney (2003) Mesenchymal stem cell engraftment in lung is enhanced in
response to bleomycin exposure and ameliorates its fibrotic effects. Proc. Natl. Acad. Sci. U.S.A. 100,
8407-11
71 – Theise ND, Henegariu O, Grove J, Jagirdar J, Kao PN, Crawford JM, Badve S, Saxena R, Krause
DS (2002) Radiation pneumonitis in mice: a severe injury model for pneumocyte engraftment from bone
marrow. Exp. Hematol. 30, 1333-1338.
72 - Abe S, Lauby G, Boyer C, Rennard S, Sharp J (2004) Transplanted BM and BM side population
cells contribute progeny to the lung and liver in irradiated mice. Cytotherapy 5, 523-533.
73 - Hashimoto N, Jin H, Liu T, Chensue SW, Phan SH (2004) Bone marrow-derived progenitor cells in
pulmonary fibrosis. J Clin Invest 113, 243-252.
56
74 - Ishizawa K, Kubo H, Yamada M, Kobayashi S, Numasaki M. Ueda S, Suzuki T, Sasaki, H. (2004)
Bone marrow-derived cells contribute to lung regeneration after elastase-induced pulmonary
emphysema. FEBS Lett. 556, 249-52.
75 - Kotton DN, Fabian AJ, Mulligan C (2005) Failure of bone marrow to reconstitute lung epithelium.
Am. J. Respir. Cell Mol. Biol. 33, 328-334.
76 - Chang JC, Summer R, Sun X, Fitzsimmons K, Fine A (2005) Evidence that bone marrow cells do
not contribute to the alveolar epithelium. Am. J. Respir. Cell Mol. Biol. 33, 335-342
77 - Krause D.S.; Theise N.D.; Collector M.I.; Henegariu O.; Hwang S.; Gardner R.; Neutzel S.; Sharkis
S.J. (2001) Multi-organ, multi-lineage engraftment by a single bone marrow-derived stem cell. Cell
105:369-377.
78 – Grove, JE, Lutzko, C, Priller, J, Henegariu, O, Theise, ND, Kohn, DB and Krause, DS (2002)
Marrow-derived cells as vehicles for delivery of gene therapy to pulmonary epithelium. Am. J. Respir.
Cell Mol. Biol. 27:645-651.
79 - Harris RG, Herzog EL, Bruscia EM, Grove JE, van Arnam JS, Krause DS (2004) Lack of a fusion
requirement of development of bone marrow-derived epithelia. Science 305:90-93.
80 - Mattsson J, Jansson M, Wernerson A, Hassan M (2004) Lung epithelial cells and Type II
pneumocytes of donor origin after allogeneic hematopoietic stem cell transplantation. Transplantation
78:154-157.
81 – Yamada, M, Kubo, H, Kobayashi, S, Ishizawa, K, Numasaki, M, Ueda, M, Suzuk, T and Sasaki , H
(2004) Bone marrow-derived progenitor cells are important for lung repair after lipopolysaccharideinduced lung injury.J. Immunol. 172:1266-1272.
82 - Beckett, T Loi, R Prenovitz, R Poynter, M Goncz, KK Suratt, BT Weiss DJ (2005) Acute
lung injury with endotoxin or NO2 does not enhance development of airway epithelium from bone
marrow. Mol. Ther. 12:680-686.
83 - Loi R, Beckett T, Goncz KK, Suratt BT, Weiss DJ (2006) Limited restoration of cystic fibrosis lung
epithelium in vivo with adult bone marrow-derived cells. Am. J. Respir. Crit. Care Med.
84 - Bruscia EM, Ziegler EC, Price JE, Weiner S, Egan ME, Krause DS (2006) Engraftment of donorderived epithelial cells in multiple organs following bone marrow transplantation into newborn mice.
Stem Cells. 24, 2299-2308.
85 - Terada N, Hamazaki T, Oka M (2002) Bone marrow cells adopt the phenoype of other cells by
spontaneous cell fusion. Nature 416:542-545.
86 - Ying QL, Nichols J, Evans EP, Smith AG (2002) Changing potency by spontaneous fusion. Nature
416:545-548.
87 - Alvarez-Dolado, M, Pardal, R, Garcia-Verdugo, JM, Fike, JR, Lee, HO, Pfeffer, K, Lois, C, Morrison,
CJ and Alvarez-Buylla, A (2003) Fusion of bone marrow derived cells with Purkinje neurons,
cardiomyocytes and hepatocytes. Nature 425:968-973.
88 - Håkelien AM, Landsverk HB, Robl JM, Skalhegg BS, Collas P (2002) Reprogramming fibroblasts to
express T-cell functions using cell extracts. Nat Biotechnol, 20, 460-466.
89 - Qin MD, Tai GP, Collas P, Polak JM, Bishop AE (2005) Cell extract-derived differentiation of
embryonic stem cells. Stem Cells 23, 712-718.
90 - Shannon JM (1994) Induction of alveolar type II cell differentiation in fetal tracheal epithelium by
grafted distal lung mesenchyme. Dev Biol, 166, 600-614
91 - Van Vranken B, Romanska HM, Polak JM, Rippon HJ, Shannon JM, Bishop AE (2005) Co-culture
of embryonic stem cells with pulmonary mesenchyme: a microenvironment that promotes differentiation
of pulmonary epithelium. Tiss. Engin. 11, 1177-1187.
92 –Serrano-Mollar, A, Nacher, M, Gay-Jordi, G, Clos, D, Xaubet, A, and Bulbena, O (2007)
Intratracheal transplantation of alveolar type II cells reverse bleomycin-induced lung fybrosis. AJRCCM
Article in press. Available online at: 10.1164/rccm.200610-1491OC.
93 - Vassilopoulos G, Wang PR, Russell DW (2003) Transplanted bone marrow regenerates liver by cell
fusion. Nature 422:901-904.
94 - Deb A, Wang S, Skelding KA, Miller D, Simper D, Caplice NM (2003) Bone marrow-derived
cardiomyocytes are present in adult human heart: a study of gender-mismatched bone marrow
transplantation patients. Circulation 107:1247-1249.
95 - Jeffrey L. Spees, Scott D. Olson, Joni Ylostalo, Patrick J. Lynch, Jason Smi, Anthony Perry,
Alexandra Peister, Meng Yu Wan, and Darwin J. Prockop (2003) Differentiation, cell fusion, and nuclear
57
fusion during exvivo repair of epithelium by human adult stem cells from bone marrow stroma. Proc.
Natl. Acad. Sci. USA 100:2397-2402
96 – Jason M. Aliotta, Fermin M. Sanchez-Guijo, Gerri J. Dooner, Kevin W. Johnson, Mark S. Dooner,
Kenneth A. Greer, Deborah Greer, Jeffrey Pimentel, Luiz M. Kolankiewicz, Napoleon Puente, Sam
Faradyan, Paulette Ferland, Elaine L. Bearer, Michael A. Passero, Mehrdad Adedi, Gerald A. Colvin,
Peter J. Quesenberry (2006) Alteration of Marrow Cells Gene Expression, Protein Production and
Engraftment into Lung by Lung-derived Microvesicles: A Novel Mechanism for Phenotype Modulation.
Stem Cells article in press. Available online at 10.1634/stemcells.2007-0128
97 - Kubit V, Sonmez-Alpan E, Zeevi A, Paradis I, Dauber JH, Iacono A, Keenan R, Griffith BP, Yousem
SA (1994) Mixed allogeneic chimerism in lung allograft recipients. Hum. Pathol. 25:408-412.
98 - Bittmann, I, Dose, T, Baretton, GT, Müller, G, Schwaiblmair, M, Kur, F, and Löhrs, U (2001) Cellular
chimerism of the lung after transplantation. An interphase cytogenetic study. Am. J. Clin. Pathol.
115:525-533.
99 – Kleeberger, W, Versmold, A, Rothämel, T, Glöckner, S, Bredt, M, Haverich, A, Lehmann, U and
Kreipe, h (2003) Increased chimerism of bronchial and alveolar epithelium in human lung allografts
undergoing chronic injury. Am. J. Pathol. 162:1487-1494.
100 - Benjamin T. Suratt, Carlyne D. Cool, Amanda E. Serls, Lin Chen, Marileila Varella-Garcia,
Elizabeth J. Shpall, Kevin K. Brown and G. Scott Worthen (2003) Human pulmonary chimerism after
hematopoietic stem cell transplantation. Am. J. Respir. Crit. Care Med. 168:318-322.
101 - Albera C, Polak JM, Janes S and Bishop AE (2005) Repopulation of human pulmonary epithelium
by bone marrow cells: a potential means to promote repair. Tissue Eng. 11:1115-1121.
102 - Zander DS, Baz MA, Cogle CR (2005) Bone marrow-derived stem-cell repopulation contributes
minimally to the Type II pneumocyte pool in transplanted human lungs. Transplantation 80:206-212.
103 - Goodell MA, Brose K, Paradis G, Conner AS, Mulligan RC (1996) Isolation and functional
properties of murine hematopoietic stem cells that are replicating in vivo. J. Exp. Med. 183:1797-1806.
104 – Alvi, AJ, Clayton, H, Joshi, C, Enver, T, Ashworth, A, Vivanco, MdM, Dale, TC and Smalley, MJ
(2006) Functional and molecular characterisation of mammary side population cells. Breast Cancer Res.
5:R1-R8. 758 Expert Opin. Biol. Ther. 6(8)
105 - Wulf G, Jackson K, Brenner M, Goodell M (2003) Cells of the hepatic side population contribute to
liver regeneration and can be replaced with BM stem cells. Haematologica 88:368-378.
106 - Poliakova L, Pirone A, Farese A, Macvittie T, Farney A (2004) Presence of nonhematopoietic side
population cells in the adult human and nonhuman pancreas. Transplant Proc. 36:1166-1168.
107 - Summer R, Kotton DN, Sun X, Ma B, Fitzsimmons K, Fine A (2003) SP (side population) cells and
Bcrp1 expression in lung. Am. J. Physiol. Lung Cell Mol. Physiol. 285:L97-L104.
108 - Giangreco A, Shen H, Reynolds SD, Stripp BR (2004) Molecular phenotype of airway side
population cells. Am. J. Physiol. Lung Cell Mol. Physiol. 286:L642-L630.
109 - Summer R, Kotton DN, SIN X, Fitzsimmons K, Fine A (2004) Origin and phenotype of lung side
population cells.Am. J. Physiol. 287:477-483.
110 – Luis A. Ortiz, Maria DuTreil, Cheryl Fattman, Amitabh C. Pandey, German Torres, Kristina Go,
and Donald G. Phinney (2007) Interleukin 1 receptor antagonist mediates the anti-inflammatory and
antifibrotic effect of mesenchymal stem cells during lung injury. PNAS 104: 11002-11007
111 – Luis A. Ortiz, Frederica Gambelli, Christine McBride, Dina Gaupp, Melody Baddoo, Naftali
Kaminski, and Donald G. Phinney (2003) Proc Natl Acad sci USA 100:8407-8411
112 – Gross, P (1965) Experimental emphysema: its production with papin in normal and silicotic rats.
Arch Environ Health 11, 50-58.
113 – Laurell, C.B. and Erikkson, S. (1963) The electrophoretic alpha-globulin pattern of serum in
alpha-1-antitrypsin deficiency. Sacnd. J. Clin. Invest. 15, 132-140.
114 – Kaplan PD, Kuhn C, Pierce JA. (1973) The induction of emphysema with elastase I the evolution
of the lesion and the influence of serum. J. Lab. Clin. Med. 82, 349-365.
115 – Fox and Fitzgerald (2004) Models of chronic obstructive pulmonary disease: a review of the
current status. Drug Discovery Today vol.1 n.3.
116 – Szarka, R.J. (1997) A murine model of pulmonary damage induced by LPS via intranasal
instillation. Journal of Immunological Methods 202, 49-57.
58
117 - Ali NN, Edgar AJ, Samadikuchaksaraei A, Timson CM, Romanska HM. Polak JM, Bishop AE:
(2002) Derivation of type II alveolar epithelial cells from murine embryonic stem cells. Tiss. Engin. 8,
541-550.
118 - Rippon HJ, Ali NN, Polak JM, Bishop AE (2004) Initial observations on the effect of medium
composition on the differentiation of murine embryonic stem cells to alveolar type II cells. Cloning &
Stem Cells 6, 49-56.
119 - Coraux C, Nawrocki-Raby B, Hinnrasky J (2005) Embryonic stem cells generate airway epithelial
tissue. Am. J. Respir. Cell Mol. Biol. 32, 87-92.
120 – Wang, G, Bunnell, BA, Painter, RG, Quiniones, BC, Tom, S, Lanson Jr., NA, Spees, JL, Bertucci,
D, Peister, A, Weiss, DJ, Valentine, VG, Prockop, DJ, and Kolls, JK (2005) Adult stem cells from bone
marrow stroma differentiate into airway epithelial cells: potential therapy for cystic fibrosis. Proc. Natl.
Acad. Sci. USA. 102, 186-191
121 - Samadikuchaksaraei A, Cohen S, Polak JM, Bielby RC, Bishop AE (2006) Derivation of type II
pneumocytes from human embryonic stem cells. Tiss. Engin. 12, 867-875.
122 - Wang D, Haviland DL, Burns AR, Zsigmond E, Westel RA (2007) A pure population of lung
alveolar epithelial type II cells derived from human embryonic stem cells. Proc. Natl. Acad. Sci. U.S.A.
104(11), 4449-4454
123 - Denham M, Conley BJ, Olsson F, Gulluyan L, Cole T, Mollard R (2007) A murine inducing niche
displays variable efficiency across human and mouse embryonic stem cell species. Am J Physiol Lung
Cell Mol Physiol
124 – Witherden IR, Vanden Bon EJ, Goldstraw P, Ratcliffe C, Pastorino U,Tetley TD. (2004) Primary
human alveolar type II epithelial cell chemokine release: effects of cigarette smoke and neutrophil
elastase. Am. J. Respir. Cell. Mol. Biol.;30: 500-509.
59