Marketplace winter savings High Quality Costs Less Thermo Scientific Molecular Biology Marketplace A quarterly publication containing special offers for significant savings on a variety of molecular biology products. p2 Molecular Biology Tools p5 PCR and qPCR 2 Thermo Scientific Molecular Biology Tools Thermo Scientific GeneJET Nucleic Acid Purification Kits – 30% Discount! Nucleic Acid Purification Plasmid DNA Miniprep 30% OFF Midiprep Maxiprep Genomic DNA Plant DNA Blood DNA DNA Fragments Total RNA DNA from Cells & Tissues Plant RNA Blood RNA RNA from Cells & Tissues From PCR From Gels 30% Discount on NEW GeneJET TM Kits GeneJET Plasmid Maxiprep Kit GeneJET Plasmid Midiprep Kit Centrifuge/Vacuum Protocol Pelleted bacteria Pelleted bacteria High quality plasmid DNA: A260/280 1.7 – 1.9 High yields and high concentration of purified DNA • Maxiprep – 750 μg, ≥ 400 ng/μL • Midiprep – 200 μg, ≥ 400 ng/μL Silica-based membrane technology Centrifuge and vacuum manifold protocols Purified DNA is ideal for transfection of robust cell lines Product Preps Alkaline lysate Alkaline lysate Clear lysate by centrifugation Clear lysate by centrifugation Bind DNA Bind DNA Cat. No. List Price 30% Off GeneJET Plasmid Maxiprep Kit 25 10 K0492 K0491 $475 $218 $333 $153 GeneJET Plasmid Midiprep Kit 100 25 K0482 K0481 $820 $230 $574 $161 Please quote promotion code MP33 and refer to the back cover for ordering details. Offers are valid until March 31st, 2012. Wash Wash Elute Elute GeneJET Whole Blood Genomic DNA Purification Mini Kit GeneJET Whole Blood RNA Purification Mini Kit GeneJET Whole Blood Genomic DNA Mini Purification Kit • Purify RNA-free genomic DNA • Fast 20-minute procedure with no separate cell lysis step GeneJET Whole Blood RNA Purification Mini Kit • Purify DNA-free RNA with no DNase step • High RNA Integrity (RIN > 8) Spin columns based on silica-membrane technology Specialized and detailed protocols for different sample types Purified DNA & RNA can be used in a wide range of downstream applications Product GeneJET Whole Blood Genomic DNA Purification Mini Kit GeneJET Whole Blood RNA Purification Mini Kit Offers are valid until March 31, 2012. Preps Cat. No. List Price 30% Off 250 50 K0782 K0781 $500 $125 $350 $88 50 K0761 $250 $175 Compatible with a wide variety of samples: • Fresh or frozen • Anticoagulants: EDTA, citrate, heparin • Buffy coat • Bone marrow • Body fluids (urine) • Multiple animal species 3 Thermo Scientific Molecular Biology Tools 30% OFF GeneJET Plant Genomic DNA Purification Kit GeneJET Plant RNA Purification Kit Compatible with a wide variety of samples: • Multiple plant species GeneJET Plant Genomic DNA Purification Kit • Purify DNA without column-clogging lysate filtration steps • Material-specific protocols provided GeneJET Plant RNA Purification Kit • Purify DNA-free RNA with no DNase step • High RNA Integrity (RIN > 8) Product Preps • Various plant tissues: • Leaves, roots, seeds, pine needles, etc. Cat. No. List Price 30% Off GeneJET Plant Genomic DNA Purification Kit 250 50 K0792 K0791 $625 $156 $438 $109 GeneJET Plant RNA Purification Kit 250 50 K0802 K0801 $1000 $250 $700 $175 Offers are valid until March 31, 2012. 30% Discount on our Most Popular GeneJET Kits 30% OFF GeneJET Plasmid Miniprep Kit High quality plasmid DNA: A260/280 1.7 – 1.9 High yields and high concentration of purified DNA: 20 μg ≥ 400 ng/μL GeneJET PCR Purification Kit GeneJET Gel Extraction Kit Consistent and Reproducible Miniprep Yields GeneJET PCR Purification Kit • DNA recovery up to 100% (25 bp – 20 kb) • Effective removal of primers, unincorporated nucleotides, enzymes and salts GeneJET Gel Extraction Kit • DNA recovery up to 95% (25 bp – 20 kb) • Purify DNA fragments from standard or low-melt agarose gels run with TAE or TBE buffer. GeneJET Genomic DNA Purification Kit GeneJET RNA Purification Kit GeneJET Genomic DNA Purification Kit • Purify RNA-free gDNA from a wide variety of tissues or cells in only 20 minutes GeneJET RNA Purification Kit • Purify high integrity (RIN > 8.0), DNA-free total RNA from a wide variety of sources Product Preps Relaxed Supercoiled M 1 2 3 4 5 6 A pBluescript-based high copy number plasmid was purified from E.coli culture with 6 different GeneJET Spin Columns M – Thermo Scientific FastRuler DNA Ladder, High Range, readyto-use (#SM1123) 1-6 – plasmid DNA isolated with 6 different GeneJET Spin Columns Cat. No. List Price 30% Off GeneJET Plasmid Miniprep Kit 250 50 K0503 K0502 $339 $83 $237 $58 GeneJET Gel Extraction Kit 250 50 K0692 K0691 $477 $106 $334 $74 GeneJET PCR Purification Kit 250 50 K0702 K0701 $477 $106 $334 $74 GeneJET Genomic DNA Purification Kit 250 50 K0722 K0721 $650 $146 $455 $102 GeneJET RNA Purification Kit 250 50 K0732 K0731 $1040 $265 $728 $185 Offers are valid until March 31, 2012. www.thermoscientific.com/mpcda 4 Thermo Scientific Molecular Biology Tools Upgrade to FastDigest Restriction Enzymes ® 30% OFF Experience the power and convenience of FastDigest Restriction enzymes • • • • One universal buffer for all 176 FastDigest enzymes Complete digestion in 5-15 minutes Direct loading on gels with FastDigest Green Buffer 100% buffer compatibility with downstream applications One universal buffer for all FastDigest enzymes To view a list of available enzymes and our FastDigest “The Great Double Digestion Day” video visit: www.thermoscientific.com/fastdigest Offers are valid until March 31, 2012. Superior Transfection Efficiency With Minimal Toxicity 30% OFF Thermo Scientific TurboFect Transfection Reagent is the reagent of choice for shRNA and plasmid transfection applications. • High transfection efficiency of a wide variety of cell types, including primary, differentiated and undifferentiated cells • Transfection can be performed in the presence or absence of serum • Demonstrates superior transfection efficiency and minimal toxicity when compared to lipid-based or other polymer-based transfection reagents • Simple 3-step transfection protocol compared with 6-7 steps for other transfection reagents Cat. No Description Quantity List Price 30% Off R0531 TurboFect Transfection Reagent 1.0 mL $341 $239 Offers are valid until March 31, 2012. 1500 75 1250 1000 50 750 500 25 250 0 NTC TurboFect Lipofect- Fugene 6 amine 2000 From April 1, 2012 TurboFect™ Transfection Reagent will replace ExGen 500, Arrest-In™ and Express-In Transfection Reagents. Orders for these discontinued products will continue to be processed until March 31, 2012. 0 GFP Positive Cells (%) Mean Fluorescence Intensity GFP Positive Cells (%) 1750 HepG2 Cells 50 1500 40 1250 1000 30 750 20 500 10 0 250 NTC TurboFect Lipofect- Fugene 6 amine 2000 0 Transfection efficiency Mean fluorescence intensity 60 1500 50 1250 40 1000 30 750 20 500 10 250 0 NTC TurboFect Lipofect- Fugene 6 amine 2000 0 TurboFect Reagent demonstrates higher transfection efficiency and improved plasmid expression across cell lines Cells were transfected with plasmid DNA encoding eGFP with the indicated transfection reagent (NTC; non-treated control). Transfections were performed according to manufacturers’ recommendations and subsequent GFP expression was analyzed by flow cytometry. Mean Fluorescence Intensity WEHI Cells 2000 Mean Fluorescence Intensity 100 GFP Positive Cells (%) HeLa Cells Thermo Scientific PCR and qPCR 5 Take A More Direct Route To PCR Thermo Scientific Direct PCR Kits FREE SAMPLE Get a free sample! Request your free kit at www. thermoscientific. com/ directpcrsample Direct PCR saves you time and cost by allowing amplification of DNA directly from the sample material. No DNA purification is needed. The Direct PCR approach is based on unique Thermo Scientific Phusion and Phire DNA Polymerases which are extremely tolerant of PCR inhibitors present in sample materials and guarantee high yields of specific PCR product. • No need for time consuming and expensive DNA purification steps • Simple and short protocols with minimal hands-on time • Very little starting sample material required • Control primers and detailed instructions for use included in each kit • Optimized kits for plant, animal tissues, blood and human specimen Cat. No Description Quantity F-130X Phire Plant Direct PCR Kit 20 rxns 50 µL each F-140X Phire Animal Tissue Direct PCR Kit 20 rxns 50 µL each F-150X Phusion Human Specimen Direct PCR Kit 20 rxns 20 µL each F-547X Phusion Blood Direct PCR Kit 20 rxns 20 µL each Campaign is valid until March 31st, 2012. Customer feedback on Phire Animal Tissue Direct PCR Kit: The quality of PCR results was as good or better than with more time-consuming extraction methods, followed by PCR (in terms of yield and clarity of bands on the agarose gel), so it allowed us to streamline the species ID assay. Given the small amount of tissue required, it will also allow us to refine our tissue collection methods so that we can take minute fin samples from live fish. - Dr. Margaret Docker, Department of Biological Sciences, University of Manitoba, Canada I used the Phire Animal Tissue Direct PCR Kit on the nematode C.elegans. I achieved good clean product with results comparable to using extracted DNA. By side stepping the need to extract and clean up the DNA we can save up to half a day using the Direct PCR kit, great when we are working with a number of different strains. - Laura Weldon, Technician, Nematode Biology Research, Bristol University, UK Find out more information about Direct PCR at www.thermoscientific.com/directpcr www.thermoscientific.com/mpcda 6 Thermo Scientific PCR and qPCR qPCR Reagents and First Strand cDNA Synthesis Kits For Fast Real-Time qPCR Thermo Scientific DyNAmo Flash and ColorFlash qPCR kits for SYBR Green and probe chemistries optimized 2x master mixes for extremely fast qPCR protocols. • The engineered Tbr DNA polymerase allows a combined annealing and extension Time savings using fast qPCR reagents step of only 15 seconds 120 • Specific and sensitive detection • Included dUTP allows the use of UNG for prevention of carry-over contamination 100 • Blue master mix combined with yellow sample buffer turns the reaction mix green 80 that helps ensure correct pipetting (DyNAmo ColorFlash Kits) Minutes 30% OFF 60 40 Thermo Scientific Maxima First Strand Synthesis Kits utilize Maxima Reverse Transcriptase, an advanced enzyme derived from in vitro evolution of M-MuLV RT that 20 delivers faster cDNA synthesis than ever before. 0 • Increased synthesis rates - complete cDNA synthesis in 15 minutes Standard qPCR Fast qPCR instrument instrument • Sensitive and reproducible - cDNA synthesis from a wide range of total RNA Reagent for standard cycling G C G A T A T C G A T C G A T C G A T C G A T C G A T C G A T C G A amounts (1 pg - 5 μg) Fast qPCR reagent • Increased reaction temperatures A T C G A T C -Gactive A T C up G AtoT65°C CGATCGATCGGCGATATCG A • Increased reproducibility reduced bias ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA ATCGATCGATCGATCGATCGATCGATCGAGATCGCGATATCGATCGATCGCGA Quantity List Price 30% OFF CGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATC F-416L DyNAmo ColorFlash SYBR Green qPCR Kit 500 x 20 μL rxns $428 $300 CGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGA F-415L DyNAmo Flash SYBR Green qPCR Kit 500 x 20 μL rxns $428 $300 CGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATC F-456L DyNAmo ColorFlash Probe qPCR Kit 500 x 20 μL rxns $449 $314 CGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGA F-455L DyNAmo Flash Probe qPCR Kit 500 x 20 μL rxns $449 $314 CGATCGATCGCGATATCGATCGATCGCGATATCGTCGATCGATCGCGATATCG K1641 50 rxns $357 $250 Maxima First Strand cDNA Synthesis Kit for RT-qPCR G Acomponents) TCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCG (pre-mixed kit K1642 200 rxns $1122 $785 TATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCG Maxima Universal First Strand cDNA Synthesis Kit K1661 G A TinCseparate G C G A tubes) T A T C G A T C G A T C G C50Grxns A T A T C G A T C $357 G A T C G C$250 GATGCGATATCGATC (kit components C G31, A T2012. CGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGGAT Offers are valid until March TCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG Cat. No Description Order Your Free Thermo Scientific PCR and qPCR Product Guide Benefits • State-of-the-art products from the Thermo Scientific ABgene, Finnzymes and Fermentas product lines • Contains a complete workflow of PCR and qPCR products including reagents, instruments and plastic consumables. • Features product selection tables to assist in finding the best solution for your application Order a free copy at www.thermoscientific.com/pcr For further information visit www.thermoscientific.com/mpcda © 2012 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific Inc. and its subsidiaries.