Plasmid-Mediated Restriction Evasion Mechanisms
Thesis subm itted for the degree of
Doctor of Philosophy
at the
U niversity of Leicester
Nicola Jayne A lthorpe BSc
D epartm ent of Genetics
U niversity of Leicester
September 1999
UMI Number: U594550
All rights reserved
INFORMATION TO ALL USERS
The quality of this reproduction is dependent upon the quality of the copy submitted.
In the unlikely event that the author did not send a complete manuscript
and there are missing pages, these will be noted. Also, if material had to be removed,
a note will indicate the deletion.
Dissertation Publishing
UMI U594550
Published by ProQuest LLC 2013. Copyright in the Dissertation held by the Author.
Microform Edition © ProQuest LLC.
All rights reserved. This work is protected against
unauthorized copying under Title 17, United States Code.
ProQuest LLC
789 East Eisenhower Parkway
P.O. Box 1346
Ann Arbor, Ml 48106-1346
Abstract
Plasm id-M ediated R estriction Evasion M echanism s
N icola Jayne A lthorpe
Plasm id ColIb-P9 (Incll) encodes m echanism s w hich allow it to avoid
d e stru ctio n by type I and type II restriction enzym es d u rin g transfer by
A genetic system was
co n ju g atio n b etw een strain s of Escherichia coli.
developed to analyse these m echanism s. The system relied on m easuring
C ollb-m ediated rescue of the restriction-sensitive plasm id R751 (IncPp) from
destruction by EcoKI (type I) and EcoRI (type II). One Collb m echanism was
k n o w n to involve a plasm id-encoded antirestriction gene k n o w n as ar dA ,
the p ro d u ct of w hich is active against type I enzym es. Tests for alleviation
of EcoKI restriction of R751, show ed strong protection by a co-transferring
C ollb (A rd+) p lasm id, slight protection w hen Collb w as resid en t in the
recip ien t and no effect w h en Collb w as im m obilised in th e d o n o r by
rem o v al of its n ic site. H ence, expression of a r d A is activated in the
recipient cell follow ing transfer; no detectable transfer of the A rdA protein
occurs from the donor to the recipient.
The a r d A gene is found in the leading region of C ollb, w hich is
defined as the first segm ent of the plasm id to enter the recipient cell during
conjugation. N ucleotide sequencing of 11.7 kb of this region identified ten
open reading fram es. Furtherm ore, the region also contains three dispersed
rep e at sequences hom ologous to a novel single-stranded DN A prom oter
described by Masai and A rai (1997, Cell 89, 897-907). It is proposed that these
secondary structures form in the transferring T-strand of Collb and function
as prom oters for tran scrip tio n of genes encoded on the u n iq u e plasm id
stran d transferred d u rin g conjugation.
A nother m echanism , w hich acts independently of a r d A , alleviates
restriction of both type I and type II enzym es in the recipient in second or
su b seq u en t ro u n d s of transfer. Two separate m echanism s ap p ear to be
o p e ra tin g since a llev iatio n of type I restriction occurs in trans and is
constitutive. In contrast, alleviation of type II restriction is by a cis- acting
m echanism . The 's u b stra te sa tu ratio n ' h y pothesis, w h e reb y increasing
am o u n ts of tran sferred D N A saturates the restriction system (Read et a l
1992, Mol Microbiol 6, 1933-1941) is ruled out by data presented.
Acknowledgements
I w o u ld like to thank the following;
Brian W ilkins,
A ngela Thomas,
M atthew Thrower,
Emm a 'C hick' Sw anston,
Lynn Cook,
Kerry 'K esser' Byrne,
Pat W ilson,
Stevey Bates,
Bill Bram m ar,
Steve Saville,
The M edical Research Council,
and all the Yeasty Boys,
I w o u ld also like to thank any friends and colleagues not m entioned above and
m y fam ily for p u ttin g up w ith me during the past four years.
Abbreviations
A la
Arg
A sn
Asp
ATP
A
R
Ap
bp
BSA
Collb
CCC
CmR
C lm R
Cys
DNA
D N A se
dA TP
dCTP
dGTP
dTTP
drd
ds
EDTA
e.o.p
G in
G lu
Gly
HGT
H is
HTH
lie
Inc
IPTG
IR
kb
kDa
KmR
K anR
A la n in e
A rg in in e
Aspartic acid
A sparagine
A denosine trip h o sp h ate
A m picillin resistance
Base pair
Bovine Serum A lbum in
ColIb-P9
Covalently closed circle
Plasm id-encoded chloram phenicol resistance
C hrom osom al-encoded chloram phenicol resistance
Cysteine
Deoxyribonucleic acid
D eoxyribonuclease
D eoxyribo-adenosine triphosphate
Deoxyribo-cytosine triphosphate
D eoxyribo-guanidine triphosphate
D eoxyribo-thim idine triphosphate
D erepressed for transfer
D ouble-stranded
D iam inoethanetetra-acetic acid
Efficiency of plating
Glutam ic acid
G lu tam in e
Glycine
H igh gelling tem perature
H istidine
H elix-turn-helix
Iso-leucine
Incom patibility group
Isopropylthio- p-D-galactoside
Inverted repeat
Kilobase
K ilodalton
Plasm id-encoded kanam ycin resistance
C hrom osom e-encoded kanam ycin resistance
Leu
LPS
Lys
m + m~
M et
N a lR
nt
OD
ORF
PCR
P he
Pro
r r
rbs
RifR
*+■
-
Leucine
Lipopolysaccharide
Lysine
M odification proficient
M odification deficient
M e th io n in e
Chrom osom e-encoded Naladixic acid resistance
N ucleotide
Optical density
O pen reading fram e
Polym erase chain reaction
P heny lalan in e
P roline
Restriction proficient
Restriction deficient
Ribosome binding site
C hrom osom e-encoded rifam picin resistance
SDS
Ser
Sm R
SpR
Ribonucleic acid
R ibonuclease
Rotations per m inute
Sodium dodecyl sulphate
Serine
Plasm id-encoded streptom ycin resistance
Plasm id-encoded spectom ycin resistance
ss
SSB
ssi
StrR
Single-stranded
Single-stranded D N A -binding protein
Single-stranded initiation sequence
Chrom osom e-encoded streptom ycin resistance
TAE
T cr
TetR
Tris-acetate EDTA buffer
Plasm id-encoded tetracycline resistance
Chrom osom e-encoded tetracycline resistance
Thr
Tn
Trp
Tyr
UV
V al
T h reo n in e
T ransposon
T ryptophan
RNA
R N A se
rp m
X-Gal
Tyrosine
U ltraviolet
V alin e
5-brom o-4-chloro-3-indolyl-p-D -galactoside
Contents
Abstract
A cknow ledgem ents
A bbreviations
General Intro d u ctio n
1
1.1
Prologue
1
1.2
Enterobacterial Plasm ids
3
1 .2.1
Incll plasm ids
4
1.3
Enterobacterial Conjugation
6
1.3.1
Conjugative cell-cell interactions
6
1.3.2
DNA processing reactions
9
1.3.3
Plasm id-encoded exclusion
15
1.4
Barriers to H orizontal DNA Transfer by
18
C hapter One
Plasm ids
1.5
Bacterial Restriction-M odification Systems
20
1.5.1
Type I R-M systems
21
1.5.2
Type I enzym e activity
24
1.5.3
Regulation of expression of type I R-M genes 25
1.5.4
Type II R-M system s
29
1.5.5
Regulation of type II R-M genes
31
1.5.6
Ecological roles of bacterial R-M system s
32
1.6
Collb Leading Region Genes and Their
34
Roles in Plasm id Establishm ent
1 . 6.1
Single-stranded D N A -binding protein (SSB) 35
1. 6.2
Plasm id SOS inhibition (PsiB)
36
1.6.3
Alleviation of restriction of DNA (ArdA)
37
1.6.4
Zygotic Induction of leading region genes
38
1.6.5
Hypotheses for zygotic Induction
40
1.6.5. Modes of positive regulation
40
1.6.5.2 Modes of negative regulation
41
1.7
Restriction-Avoidance by Plasm ids
41
1.8
Aims and D irection of this Study
43
C hapter Two
M aterials and M ethods
2.1
Plasm ids and Bacterial Strains
45
2.2
Media and Chem icals
46
2.2.1
M edia
46
2.2.2
Antibacterial agents
48
2.2.3
11.1 x PCR buffer
48
2.3
Phenotypic Characterisation of Bacterial
48
Strains
2.3.1
Colicin production
48
2.3.2
recA m utants
49
2.3.3
recD m utants
49
2.3.4
Sensitivity to bacteriophage
49
2.4
Strain M anipulations
50
2.4.1
Bacterial conjugation
50
2.4.2
Transform ation of bacterial strains
50
2.4.3
Bacteriophage propagation
51
2.4.4
Transposon insertion m utagenesis
51
2.5
DNA M anipulations
52
2.5.1
Small scale plasm id DNA isolation
52
2.5.2
Large scale plasm id DNA isolation
53
2.5.3
Analysis of the concentration and pu rity
53
of DNA samples
2.5.4
Restriction enzym e analysis of DNA
53
2.5.5
Isolation of DNA restriction fragm ents
54
2.5.6
D ephosphorylation of DNA fragm ents
54
2.5.7
Ligation of DNA fragm ents
54
2.5.8
Prim ers
55
2.5.9 DNA sequencing reactions
55
2.6
55
Standard and Inverse PCR
2.6.1 O ptim isation of the inverse-PCR protocol
56
for am plification of tem plate pN A 2 using
prim er 5 and prim er 6
Genetic Analysis of a Plasm id-M ediated
C h ap ter Three
Restriction E vasion M echanism
3.1
In tro d u ctio n
58
3.2
Results and D iscussion
59
3.2.1
Effects of restriction on the conjugative
59
transm ission of plasm ids R751 and Collbdrd
3.2.2
Effects of co-transferring R751 w ith C o U b d r d 61
to a restricting recipient
3.2.3
Rescue of R751 from restriction by C o U b d r d
63
resident in the restricting recipient
3.2.4
Is conjugative transfer of CoUbdrd a
65
prerequisite for alleviation of restriction?
3.3
S u m m ary
68
C onstruction of an oriT M utant of
C h ap ter Four
Collbdrd and its Conjugative Properties
4.1
In tro d u ctio n
70
4.2
R esults
71
4.2.1
Cloning and determ ination of the nucleotide 71
sequence of the Collb oriT locus
4.2.2
Strategy em ployed to delete the nic sequence 74
from the cloned Collb oriT
4.2.3
C onstruction of pN A 8 containing the om ega 75
(Q) intersposon
4.2.4
Construction of a Collbdrd m utant lacking
the nic reg io n
76
4.2.5
C onjugative properties of p N A ll and
76
pN A 12
4.3
C h a p te r Five
D iscussion
78
A nalysis of the A lleviation of Type I and
Type II Restriction U sing N on-T ransfer able
M utants p N A ll an d pN A 12
5.1
In tro d u c tio n
80
5.2
R esults
80
5.2.1
Rescue of R751 from EcoRI restriction by
80
C o l l b d r d oriT m u ta n t p N A ll
5.2.2
M obilisation of EcoRI pro d u cin g plasm id
81
NTP14 by C o l l b d r d
5.2.3
A non-transferable Collbdrd confers no
82
EcoKI protection on R751
5.2.4
Collbdrd transfer does not m ediate
83
retrotransfer of NTP14
5.3
D iscussion
84
C onstruction of a mob M utant
C h a p te r Six
of Plasm id NTP14
6.1
In tro d u c tio n
86
6.2
R esults
6.2.1
Restriction analysis of plasm id NTP14
88
6.2.2
C onstruction of pNA 16 and pNA17
89
6.2.3
C haracterisation of pN A 16 and pN A 17
89
6.2.4
Collb does not alleviate EcoRI
91
restriction in trans.
6.2.5
Conjugative transfer of the EcoRI R-M
92
genes causes som e killing of recipient cells
6.3
D iscussion
93
D eterm ination and Analysis of the N ucleotide
Chapter Seven
Sequence Of the Collb Leading Region
7.1
In troduction
96
7.2
Results and D iscussion
97
7.2.1
Strategy for determ ining the nucleotide
97
sequence of the Collb leading region
7.2.2
Identification of putative protein coding
98
regions (or/s) in the Collb leading region
7.2.3
Similarities betw een DNA and p rotein
99
sequences found in the leading region
to those present in the databases
7.2.4
G + C content of the Collb leading region
103
7.2.5
Similarity of the Collb leading region to
104
other conjugative plasm ids
7.2.6
Examination of the Collb leading region for 104
type I restriction enzym e cleavage sites
7.2.7
Repeat sequences w ithin the leading region 105
7.3
S um m ary
106
C hapter Eight
General Discussion
108
A ppendices
A ppendix I
Literature cited
Chapter One
General Introduction
1.1
Prologue
Extrachrom osom al genetic elem ents know n as plasm ids are comm only
found in bacteria and determ ine functions involved in their stable replicationm aintenance.
M any plasm ids also possess transfer genes (tra ) th at sup p o rt
h o riz o n ta l tra n sfe r of the elem ent b e tw ee n b acteria by the process of
conjugation. The first conjugative plasm id to be recognised was the F fertility
factor of Escherichia coli (Lederberg and Tatum , 1946). Since the discovery of F,
the m ajority of research has focused on developing a m olecular understanding
of the conjugation system of F and other enterobacterial plasm ids (W ilkins
and Lanka, 1993). To date, the m ost docum ented transfer system s belong to
p lasm id s of the incom patibility (Inc) com plexes F, I, P, N and W. Essential
fea tu res of th ese tra n sfe r system s, in clu d in g strateg ies for m atin g -p air
form ation and tran sm issio n of genetic m aterial, are conserved betw een an
extensive collection of plasm ids representing m ore than 25 Inc groups isolated
from G ram -negative bacteria (Wilkins and Lanka, 1993).
These co n serv ed features apply less to the conjugation system s of
p lasm id s isolated from G ram -positive bacteria.
In fact, the sim ilarities that
exist are that they require physical contact betw een donor and recipient cells
and th at conjugation is m ediated by plasm ids or a special class of conjugative
transposon.
T hus, a global definition of conjugation is that it is a "process
w hereby a DNA m olecule is transferred from a donor to a recipient bacteria via
a specialised protein com plex called the conjugation apparatus" (Zechner et ah,
1999).
In a d d itio n to h o u sek eep in g fu n ctio n s in v o lv e d in rep licatio n m aintenance and transfer, m any plasm ids carry an array of specialised genes of
hig h environm ental and m edical im portance.
1
The m ost interesting of these
g en es are th o se th a t encode resistan ce to a n tib io tics an d v iru le n ce
d eterm in an ts.
O ne feature of plasm id transfer th at has b ro u g h t it m uch
attention is its so-called prom iscuity; th at is, the ability of certain types of
plasm ids to m ediate transfer betw een bacteria exceeding their m aintenancerange. D uring such transfer, there is the potential for the exchange of genetic
m aterial by the process of recom bination.
T herefore, p lasm id s m ake a
significant contribution to the gene pool and hence, play an im portant role in
the ecology of bacteria (Datta and H ughes, 1983; M azodier and Davis, 1991;
Am abile-Cuevas and Chicurel, 1992).
O ne potential barrier to horizontal transfer of DNA is that im posed by
bacterial restriction-m odification (R-M) system s.
These are u b iq u ito u s in
n atu re and are therefore likely to be encountered frequently by transferring
DNA.
The restriction endonuclease com ponent operates to cleave infecting
DNA recognised as foreign by its lack of cognate m ethylation at target sites for
the enzym e. Plasm ids transferring and replicating w ithin a single host strain
w ill acq u ire the a p p ro p ria te m ethylation an d avoid d e stru c tio n by the
restriction enzym es of the host. In contrast, plasm ids transferring to new host
strains w ill not carry the appropriate m ethylation.
Therefore, prom iscuous
transfer raises the intriguing question of how plasm ids avoid destruction from
new ly encountered R-M systems.
B acteriophages, like plasm ids, are also subject to d estru ctio n by hostencoded restriction enzym es during infection of a new strain.
H ow ever,
bacteriophages are know n to encode a variety of anti-restriction m echanism s.
It is now becom ing clear that certain plasm ids also encode such protective
m echanism s. This thesis focuses on one such plasm id, ColIb-P9 of the In cll
g ro u p of plasm ids, and attem pts to characterise fu rth er the p lasm id 's tw o
restriction-evasion m echanism s.
Data described in th is thesis have been
published in the papers Althorpe et ah (1999) and Bates et al. (1999).
2
1.2
Enterobacterial Plasmids
The m ajority of large plasm ids (> 20 kb) isolated from G ram -negative
bacteria carry transfer genes that prom ote transm ission of the elem ent to a new
bacterial cell by the process of conjugation.
conjugative or self-transm issible.
Such plasm ids are described as
M ost plasm id s are generally classified
according to incom patibility (Inc) relationships based initially on the inability
of tw o closely related or identical plasm id replicons to be p ropagated in the
sam e cell line.
The phenom enon of incom patibility reflects the id en tity
betw een the two plasm ids and their replication control and active partitioning
system s (Couturier et al., 1988). Further classification of plasm ids m ay involve
c riteria
such as i) rep lico n -ty p in g , ii) D N A h y b rid is a tio n
tests, iii)
m orphological and serological typing of conjugative pili and iv) sensitivity to
pilus-specific bacteriophages (Bradley, 1980). As a result of these tests, it is the
tren d th a t p lasm ids from the sam e Inc g ro u p often share sim ilar if n o t
identical features betw een their transfer systems.
The subject of this thesis is the 93-kb enterobacterial plasm id ColIb-P9
(Fig. 1.1), which along w ith closely related plasm id R64 represent the In c ll
group of enterobacterial plasm ids. ColIb-P9 was originally isolated in Shigella
s o n n e i P9 and like F w as one of the first conjugative plasm ids discovered
(Fredericq, 1965).
C onsequently, ColIb-P9 has featured extensively in the
literature regarding the fundam entals of conjugation. H ow ever, the complex
details regarding the conjugation system of this plasm id and F are beyond the
scope of this thesis. Therefore, the reader is directed to a num ber of extensive
review s that exist for further details (Willetts and W ilkins, 1984; W illetts and
Skurray, 1987; W ilkins and Lanka, 1993; Lanka and W ilkins, 1995; Firth et al.,
1996; Pansegrau and Lanka, 1996 and Zechner et al., 1999). To this end, only a
general overview of the details regarding Il-like conjugation will be described
in the follow ing sections.
W here appropriate, analogies w ith F- and P-like
conjugation will be m ade.
3
Fig. 1.1 M ap of In c ll plasm id Collb.
Regions T ral and Tra2 contain the plasm ids transfer genes. Loci w ithin T ra l
in clu d e the sh u fflo n (s h f ), shufflon recom binase (rci), th e flexible p ilu s
stru c tu ra l gene (pilV ) and genes encoding an EDTA -resistant nuclease (n u c ).
Tra2 includes DN A prim ase (sog), entry exclusion (eex ) and genes involved in
rigid p ilu s assem bly. A djacent to the leading region is the origin of tran sfer
(oriT) an d genes encoding relaxosom e p roteins (n i k A , nikB).
re g io n
c o n ta in s
th e o rig in
of v e g e ta tiv e
re p lic a tio n
The C ollb Rep
(o r i V ),
I l - ty p e
incom patibility locus (me) and replication controlling factor (repZ).
L eading
region genes show n are those that encode the single-stranded D N A b in d in g
p ro tein (s sb ), plasm id SO S-inhibition (psiB) and alleviation of restric tio n of
DNA (ardA).
O ther loci include the colicin lb gene (cib) a n d colicin lb
im m u n ity gene (im m ), fertility inhibition of F (FinQ) and genes d e te rm in in g
abortive phage infection (ibfA, ibfB). Indicated on the m ap by internal lines are
EcoRI cleavage sites. Triangles (A) indicate Sail cleavage sites. M ap rep re se n ts
data from studies w ith bo th Collb and closely related Incll plasm id R64 (Rees et
al., 1987; H ow land et al., 1989; K om ano et al., 1990; F uruya et al., 1991 an d
Chilley and W ilkins, 1995). M ap is reproduced from Read (1993).
Fig-1-1
cib u m n w *
Rep
,oriV
repZ
inc .
imp
ssb
Tral
90
psiB
flexible
pilus
j
r ardA
60
pilV
shf
rci
oriT
nikA.B
nuc
finQ
ee x
sog
rigid
pilus?
Tra2
Fig. 1.1
repZ
inc .
oriV
flexible
pilus
imp
ssb
90
80
Collb
93 kb
psiB
20
ard A
60
40
o riT
nikA.B
nuc
finQ
sog
eex
rigid
pilus?
Tra2
1.2.1
In c ll plasm ids
Plasm ids belonging to the I complex are typified by those w hich specify
ho m o lo g o u s thin conjugative pili an d include plasm ids from the six Inc
g ro u p s II (la ), 12, 15, B, K and Z.
Some of these plasm ids can be fu rth er
classified into one of tw o groups based on replicon-typing and serological
relationships that exist betw een the conjugative apparatus they specify. These
in clu d e the plasm ids from the Inc g ro u p s Il-B-K and the IncI2 plasm ids.
D espite the relationships betw een these pili, plasm ids from the I com plex
display different patterns of sensitivity to I-pilus specific bacteriophages Ifl and
PR64FS (Walia and D uckworth, 1986; Bradley, 1984).
All I-type plasm ids determ ine two types of conjugative pilus. The thick
rig id p ili are one type, w hich are all m orphologically sim ilar an d b e ar
com parisons to those specified by plasm ids of IncP and IncN g ro u p s as they
su p p o rt efficient conjugation betw een cells on semi-solid surfaces. H ow ever,
these thick rigid pili are also required in liquid m atings and are th o u g h t to be
essen tial for DN A transfer (Bradley, 1980; Bradley, 1984; Rees et ah, 1987;
H oriuchi and Kom ano, 1998). The second type is the thin flexible pilus, w hich
is req u ired to su p p o rt efficient conjugation betw een cells in liq u id m edia.
T h rough DNA sequence analysis of the R64 genes responsible for th in pili
biosynthesis, these pili w ere inferred to belong to the type IV pilus fam ily (Kim
and Komano, 1997). R64 thin pili consist of the major subunit PilS and one of
seven PilV products (Horiuchi and Komano, 1998).
The Il-B-K plasm ids have a narrow replication-m aintenance range and
can be only m aintained in strains of E s c h e r i c h i a , S a l m o n e l l a , S h i g e l l a and
Kle bsi ell a (Walia and D uckw orth, 1986; W ilkins, 1995).
T hrough replicon
typing tests, the replication region of the Incll plasm ids along w ith those of the
g ro u p s IncFII, IncFI and IncFIV, have been show n to belong to the RepFIC
fam ily of replicons.
A pparently, the n arro w m aintenance ran g e of this
replicon-type is due to the requirem ent for host encoded enzym es (Jones, 1991;
C outurier et al., 1988; Saadi et ah, 1987). Despite the narrow transm ission range
4
of the Incll plasm ids they are still able to prom ote low-level transfer to a broad
range of bacteria (Wilkins, 1995).
A large proportion of the backbone of the Incll plasm id is assigned to
the transfer system of the plasm id (-50 kb). The transfer genes of Collb are
organised into two separate m odules, T ral and Tra2, as determ ined by genetic
m apping studies of the plasm id [Fig. 1.1] (Uemura and M izobuchi, 1982; Rees et
ah , 1987).
T ral is located betw een Tra2 an d the rep region an d w as show n by
transposon m utagenesis to carry genes that are required for the assem bly of the
thin flexible conjugative pilus (Rees et ah, 1987). The com position of the thin
pilus can be changed by rearrangem ents in a DNA sequence know n as the
shufflon (Komano et ah, 1990). This highly mobile DNA sequence consists of
three 300 bp segments separated by six 19 bp repeat sequences and is located at
the 5' term inus of the thin-pilus gene, p i l V .
Site-specific reco m b in atio n
m ediated by the product of the associated rci gene selects a different C-term inal
se g m en t of p i l V .
C o n seq u en tly , th e conjugation efficiency in liq u id
en v iro n m en ts is changed, possibly by affecting the recognition of surface
co m p o n en ts of d iffe re n t recipients (K om ano et ah, 1994; H o riu ch i and
Kom ano, 1998).
The Tra2 segm ent contains genes involved in the assem bly of the thick
rigid conjugative p ilus, en try exclusion (eex) and a gene encoding a DNA
prim ase known as sog (H artskeerl and H oekstra, 1984; Rees et ah, 1987).
Expression of these transfer genes, w ith the exception of eex, are subject
to the p lasm id 's negative t r a n s -acting fertility inhibition system w hich is
analogous to that of F-like plasm ids (Meynell and Datta, 1967).
Finally, the oriT and o r iT operon, w hich are both hom ologous to IncP
co u n terp arts can be found located adjacent to the p lasm id 's leading region
(Rees et ah, 1987; Furuya and Kom ano, 1991).
This and the corresponding
regions of other II, B and K plasm ids are found to carry highly conserved
zygotically inducible genes w hich are n o t essential for conjugation b u t are
5
believed to be involved in establishm ent of the plasm id in the new ly infected
recipient cell. These genes are discussed in more detail in section 1.6.
1.3
Enterobacterial Conjugation
The m odel of enterobacterial conjugation is divided into three crucial
stages. The first stage involves the form ation of stable contacts betw een donor
and recipient bacteria and is com m only referred to as m ating-pair form ation.
The second stage involves a series of reactions that result in the transfer of a
unique strand of the plasm id to the recipient cell. The final stage involves the
estab lish m en t of the im m igrant plasm id in the recipient, w h ich m ay be
facilitated by plasm id proteins transferred from the donor to recipient or those
synthesised early in the infected cell (Wilkins and Lanka, 1993).
1.3.1
C onjugative cell-cell interactions
Interactions betw een donor and recipient cells at surface levels are an
essential first stage to conjugation.
The pilus specified by all conjugative
p lasm id s isolated from Escherichia coli is an essential feature in in itiatin g
contact betw een m ating bacteria.
These donor-specific surface ap pendages,
w hich are also know n as sex pili, tend to fall into one of three m orphological
g ro u p s in cluding th in flexible, thick flexible and rigid filam ents or ro d s
(Bradley, 1980).
The biological significance of the conjugative pilus as an organelle for
m ediating contact betw een donor and recipient bacteria is established and its
im portance is em phasised by the num ber of transfer genes that are assigned to
its assembly. H ow ever, certain aspects of this initial stage of conjugation have
yet to be resolved, the m ost interesting of which is the exact route for ssDNA
transfer from the donor to the recipient bacterium after contact is initiated.
From studies w ith F-mediated conjugations in liquid m edia, the process
of conjugative cell-cell interactions is proposed to proceed in several stages
(A nthony et al., 1994). First, the donor cells interact w ith recipients via the tip
6
of the pilus and a receptor on the surface of the recipient cell. The exact n ature
and identity of these cell surface receptors are not yet known. H ow ever, early
ex p erim en ts w ith ConF
and ConI m u tan ts (defective in receiving F or I
plasm ids by conjugation, respectively) of E. coli K-12 suggested that the surface
lipopolysaccharide (LPS) and outer m em brane protein O m pA are the m ost
likely candidates (Havekes et al ., 1977; A chtm an et al., 1978b; A nthony et al.,
1994). However, w hether LPS or O m pA are the actual receptors recognised by
conjugative pili or are involved in the biosynthesis or stru ctu ral integrity of
the authentic receptor is not yet understood (Havekes et al., 1977; A nthony et
al., 1994).
A fter contact is initiated, the second stage of conjugative cell-cell
interactions involves the retraction of the pilus w hich brings the donor and
recipient cells into w all-w all contact (A chtm an et al., 1978a). A ssem bly of the
extended F-pilus is a complicated process that is poorly understood. H ow ever,
w hat is know n is that the process involves the products of 15 transfer genes,
w h ich form a m em b ran e-sp an n in g com plex trav ersin g the bacterial cell
envelope from the w hich the pilus is extended and retracted (M anning et al.,
1981;
S c h a n d el
et al.,
1992).
R e tra ctio n
of th e
F -p ilu s
in v o lv e s
depolym erisation of its subunits into the cell m em brane (D iirrenberger et al.,
1991; Frost et al., 1994).
M ating aggregates in F-m ediated conjugations are at first sensitive to
shear forces.
H ow ever, once the m ating cells are in w all-w all contact the
aggregate is rapidly stabilised by a process requiring the products of traG a n d
traN (M anning et al., 1981; Panicker and M inkley, 1985).
TraN can be found
w ithin the outer m em brane of the cell envelope of the donor and contains an
exposed surface dom ain, which may interact w ith the lipopolysaccharide of the
recipient (Diirrenberger et al., 1991).
The exact route supporting transfer of single-stranded DNA from the
donor to the cytoplasm of the recipient is unknow n.
Early studies w ith F-
m ediated conjugations suggested that DNA transfer m ight occur through the
7
extended pilus (Ou and A nderson, 1970). Such a view was supported by the
findings of H arrin g to n and Rogerson (1990) w ho found th at Hfr-C do n o rs
separated from F recipients by a filter 6 pm thick w ith a pore size of 0.01-0.1
pm w ere still able to produce transconjugants. H ow ever, the favoured m odel
to date is that the donor and recipient cell envelopes, once w ithin intim ate
contact, fuse form ing a transm em brane pore which allows the transfer of DNA
an d any proteins involved in DNA m etabolism to the recipient.
In m atings
m ed iate d by p lasm id F, TraD is fo u n d trav ersin g the in n er and o u ter
m em brane of the donor (Panicker and M inkley, 1985) and appears to interact
w ith O m pA form ing a p u tativ e pore betw een the d o n o r and the o u te r
m em brane of the recipient for DNA transfer (D iirrenberger et al., 1991).
No
evidence of a plasm a bridge form ed betw een the two cells has yet been found,
w h ich is a notion su p p o rted by D iirrenberger et al. (1991) w ho exam ined
m atin g cells w ith in w all-w all contact by electron m icroscopy (W illetts an d
W ilkins, 1984; D iirrenberger et al., 1991). The m odel is lacking in that there is
n o ev id en ce for h o w the plasm id D N A translocates across the in n e r
m em brane of the recipient. However, it has been proposed that this m ay be a
passiv e process sim ilar to th at of infecting bacteriophage X, w hich u p o n
injection into the periplasm ic space, X DNA is transported across the in n er
m em brane by the sugar uptake m echanism for m annose (D iirrenberger et al.,
1991).
The putative signal for initiation of DNA transfer after contact betw een
the donor and recipient has been established is proposed to be the product of
the F gene traM. TraM which is found at the base of the F pilus is required to
be in close contact w ith transfer replication proteins and binds extensive
regions of the origin of transfer [oriT] (D iirrenberger et al., 1991; Zechner et al.,
1999). TraM also provides the physical link betw een the TraD protein form ing
p a rt of the m ating bridge and the relaxase protein Tral that is covalently bound
to the transferring DNA. Finally, once DNA transfer has occurred conjugation
is term inated and m ating aggregates separate (Achtman et al., 1978a).
8
From studies w ith IncP plasm ids, the assem bly of RP4 surface-specific
pili is reasonably well understood (for review see Z echner et al., 1999). In
addition, the transfer genes required for RP4-m ediated m atings betw een E. coli
and from £. coli to strains of yeast are know n (Lessl et al., 1993; Haase et al.,
1995; W ilkins and Bates, 1997; Bates et al., 1998). H ow ever, interactions at the
cellular level betw een donor and recipient bacteria on surfaces have been
neglected and to date no Con m utants have been isolated. This is unfortunate
considering that m ost natural com m unities of bacteria are attached to surfaces
or grow as m icro-colonies (Simonsen, 1990).
P revious stu d ies w ith ConF”
m u ta n ts isolated from liquid m atings w ere show n to d isp lay w ild ty p e
behaviour w hen m ated w ith appropriate donors on surfaces, w hich suggests
that the interactions that occur during surface m atings are different from those
that occur in liquid (Achtman et al., 1978b)
1.3.2
DNA processing reactions
The reactions required for tran sfer of a unique DNA stran d of the
plasm id to the recipient cell during enterobacterial conjugation have been best
studied for plasm id F, IncP plasm id RP4 and some m obilisable plasm ids from
the IncQ group.
Transfer of the plasm id strand to the recipient cell d u rin g
conjugation is pro p o sed to occur in num ber of stages (Lanka and W ilkins,
1995).
The first stage of plasm id transfer is initiated at the nic site w ithin the
origin of transfer (oriT) by specific endonucleolytic cleavage of a single strand
of the plasm id DNA (Lanka and W ilkins, 1995). C leavage is m ediated by a
plasm id-encoded transfer gene product called relaxase. The relaxase enzym e
b in d s to the o r i T in the presence of accessory pro tein s to form a com plex
k n o w n as the relaxosom e.
This com plex can be iso lated and u p o n
d en atu ratio n w ith SDS releases an o p en circular plasm id th at is an ideal
su b strate for determ ining the nic site of the o r i T by nucleotide sequencing
(Fiirste et a l , 1989; Furuya and Komano, 1991; Lanka and W ilkins, 1995).
9
Cleavage of o r iT breaks a specific phosphodiester bond betw een tw o
chem ically d ifferent nucleotides p resent at the nic site. From studies w ith
p lasm id F, RP4, R64, RSF1010 and C olE l, the 3' term inus of nic has been
sh o w n to carry an unm odified hydroxyl group th at is susceptible to p rim er
extension by DNA polym erase I of E. coli and a 5' term inus that rem ains
covalently attached to the relaxase enzym e via the hydroxyl side of either a
seryl, threonyl or tyrosyl residue of the enzym e. The location of these active
centre am ino acids in the relaxase v ary and can be found w ithin different
d om ains of the enzym e depending on w hich plasm id encodes them (Lanka
an d W ilkins, 1995).
The biochem istry of these reactions at the o r iT is best
understood for RP4 relaxosomes (Pansegrau et al ., 1990b).
W hether cleavage of the oriT is influenced by an unidentified signal
synthesised d uring cellular interactions betw een the donor and recipient cell is
still w idely debated.
From studies w ith plasm id F, the p ro d u ct of the t r a M
gene has been im plicated in this signalling process. TraM is able to interact
w ith TraD of the m ating bridge and the orzT-protein com plex (section 1.3.1)
suggesting th a t the p rotein is involved in initiating the transfer process (Di
Laurenzio et al., 1991).
An alternative view to that described above is that cleavage of the o r i T
is a reversible process th a t occurs in the absence of recipient cells.
It is
envisaged th at the relaxase enzym e covalently bound to the 5' term inus of the
p lasm id stran d is also able to m ediate a cleaving-joining reaction involving
th e hydroxyl free en d of the 3' term inus.
Such a p roperty of the relaxase
suggests that the enzym e is also involved in recircularisation of the transferred
p la sm id stra n d in the recipient cell and consequently in term in atio n of
conjugation (Wilkins and Lanka, 1993; Pansegrau et al., 1994b). Exam ination of
RP4 relaxosom es in non-conjugating cells rev ealed th a t T ral p o ssesses
cleaving-joining activity, w hich resem bles th at of a type I topoisom erase
(Pansegrau et al., 1990; Pansegrau et al., 1994b). The m odel proposes that the
energy p roduced from the cleaved phosphodiester bond and the form ation of
10
the covalent Tral-orzT interm ediate is conserved and utilised in the re-joining
reaction. The superhelical covalently closed circle (CCC) state of the plasm id,
w hich is believed to be required in the nicking reaction, is retained by the
relaxase form ing a non-covalent clamp to the 3' end at the nic site (Pansegrau
et al. , 1990a; M atson and Morton, 1991). In addition, this CCC state m ay also be
required so that w hen the plasmid is unw o u n d the energy is provided to drive
transfer of the plasm id strand to the recipient cell.
The o r i T is the only czs-acting site required for D N A transfer.
The
location of the oriT is usually at one end of the transfer com plex of the plasm id
and can take up to 500 bp in length. The oriT can generally be divided into
four dom ains including, i) the nicking dom ain, which is also know n as the nic
sequence, ii) an AT-rich region, w hich m ay facilitate stra n d sep aratio n in
n egatively supercoiled DNA, iii) one pro m o ter, resp o n sib le for o u tw a rd
read in g tran scrip tio n of either the tra or mob genes and iv) a region w ith
p a tte rn s of direct and indirect repeats that m ay facilitate recognition and
bin din g of specific proteins associated w ith the oriT (Di Laurenzio et al., 1991).
O ne interesting feature of the oriT of plasm id F and RP4 is the requirem ent for
the form ation of secondary structures th at alter the topology of the associated
region and ap p ear to enhance protein-orzT complex form ation (W ilkins and
Lanka, 1993; Pansegrau et al., 1994b).
Extensive nucleotide sequence sim ilarities are only found betw een the
o r i T of closely related plasm ids, although significant sim ilarities are found
betw een the nic regions (-10 bp) of a m ore diverse set of conjugative plasm ids
(Furuya and Komano, 1991; Fig. 1.2). There are four fam ilies of a particular
type of nic region that are identifiable, one of w hich includes the nic sequences
from m obilisable plasm ids (Pansegrau and Lanka, 1991; Lanka and W ilkins,
1995; Zechner et al., 1999).
The sequence of the Collb o r i T w as unavailable at the start of this
research. How ever, nucleotide sequences of Incll plasm id R64 suggests that the
Il-orzT bears m ore sim ilarity to those of IncP plasm ids RP4 and R751 than that
11
of plasm id F. Both the II and P oriT have a 19-bp and 17-bp inverted repeat
sequence dow nstream of the nic site. In addition, the 12-bp nic region of R64
shares six conserved nucleotides w ith the nic region of RP4 and R751 (Komano
et ah, 1988; Furuya and Komano, 1991; Fig. 1.2).
The relaxase of R64 is the product of the nikB gene, w hich together w ith
n i k A is found directly adjacent to the o r i T as the or iT operon (Furuya et ah,
1991). NikB is responsible for cleavage possibly via the N -term inal dom ain of
th e p ro tein , alth o u g h the entire p ro te in is req u ired for relax atio n and
m obilisation of R64.
NikA (15 kDa) is involved in recognition of oriT a n d
directing relaxosome assem bly (Furuya et al., 1991; Furuya and Komano, 1991).
In agreem ent w ith the finding that the am ino acid sequences of certain DNA
relaxases share striking similarities, both NikA and NikB have been show n to
resem ble transfer counterparts of IncP plasm ids RP4 and R751. NikA shares
30% sim ilarity to TraJ and the N -term inal region of NikB shares 26% identity
in a 276 amino acid overlap with Tral, w hich is required for relaxation (Furuya
and Komano, 1991; Pansegrau and Lanka, 1991).
The form ation of relaxosom es at the In cll oriT is a poorly understood
process.
H o w ever, th ro u g h in vitro stu d ies involving IncP p lasm id s the
relaxation of RP4 is proposed to occur in a sequential order, w hich is enhanced
by the form ation of a bend upstream of the nic site involving TraK (Pansegrau
et at., 1990b; W ilkins and Lanka, 1993). RP4 TraJ binds to the cognate or iT by
recognising the right arm of the 19-bp inverted repeat sequence.
RP4 Tral,
w hich is the relaxase, binds only to the TraJ-orzT complex and not to the or iT
alone (Pansegrau et ah, 1990b). The w hole structure is subsequently stabilised
by p ro tein -p ro te in interactio n s betw een RP4 TraH and the p ro te in -o n T
com plex. M utations in the tral gene suggest that binding of Tral to the o r iT
has an additional effect of reducing relaxase gene expression (Balzer et ah,
1994). For a m ore detailed review of RP4 and R751 relaxosom e assem bly see
Z echner et al. (1999).
The sim ilarities betw een NikA and NikB to their RP4
and R751 counterparts and betw een the In cll or iT and IncP o r i T suggests a
12
Fig. 1.2. S im ilarities b e tw ee n the n ic regions of conjugative p lasm id s.
Figure show s the align m ent of several n ic regions from the o r i T s of various
conjugative plasm ids. The nucleotide sequences of these nic regions generally
fall into one of three groups. The nic cleavage site is indicated (▼). Identical
nucleotides are indicated by a black box, conserved nucleotides by a grey box.
The consensus sequence generated for each group is also sh o w n .
rep ro d u ced from Lanka and W ilkins, 1995)
(Figure is
Fig. 1.2
Plasm id
RP4
R751
pTF-FC2
R64
pTiC58 RB
pTiC58 LB
N ucleotide sequence of nic region
C T T
C T T
c A A
A A T
C A C
G C C
C
C
C
T
A
A
A
A
G
G
A
A
C
C
G
C
T
T
C
A
T
A
A
A
|
T
C
C
C
T
T
SI
fl
T
T
T
T
G
G
T
T
T u
T
RSF1010
R1162
p T Fl
pTiC58 oriT
pSC lO l
pIP501
pG O l
A
A
T
C
A
T
T
A C c G G
A C c G G
T A c T C
G A G T A
A A G T C
G C G T A
T c G C A
T
T
T
A
T
c
T
G
T G C G W
G
A
A
C
T
A
N
G
G
G
G
A
T
D
G
▼G G T G
G
GG T G
G
G G T G
G
G G G A
A T A G
G
A
T
C A G
C
R K D R C
S T
T
T
T
T
A
C
j
II
G
G
T
G
G
T
K G T
B
Y
G T
A
G
T
G
G
G
T A A D
T
T
T
T
T
m
A
W G
T
C
A
A
G
G
C
A
Y A T C C T G
F
P307
R100
pED208
R46
R388
c G G C
c G C C
T
C
C
A
II
9
1
T C C
T C c
T A
T T C
T C c
▼ T c
c G C C C T
C C
C C
T G
T G
G A
T A
T A
C
T
A
C
sim ilar m echanism of relaxosome form ation and cleavage reaction operating
for this group of plasm ids.
Recent studies w ith R64 NikA have show n th at in
a sim ilar w ay to RP4 TraJ, NikA recognises and binds to a repeat sequence 17bp in length found 8-bp from the nic site.
Such binding of NikA w as also
sh o w n to in d uce DNA bending w ith in the o r i T seq u en ce (F uruya and
Kom ano, 1995; Furuya and Komano, 1997).
The next stage of DNA transfer involves the u n w in d in g of the cleaved
p lasm id DNA strand and transfer to the recipient cell in a unidirectional
m anner (H ow land and Wilkins, 1988; Lanka and W ilkins, 1995). U nw inding
is m ediated by one or m ore DNA helicases, some of w hich m ay be encoded by
the plasm id. Studies w ith plasmid F have show n that the Tral protein has the
ad d itio n al p roperties of a helicase, how ever, the function of F T ral as the
helicase responsible for unw inding the strand destined for transfer has y et to
be show n genetically (Wilkins and Bates, 1997). F Tral unw inds the DNA in a
5'-3' direction relative to the strand that is bound to the enzym e (M atson and
M orton, 1991; W ilkins and Lanka, 1993).
From com parisons betw een the in
vitro rate of unw inding by DNA helicase I (1 kb per sec at 37°C) and the rate of
chrom osom al DN A transfer from Hfr donor cells (0.75 kb per sec at 37°C), it is
p roposed th at unw in d in g m ay provide the m otive force for DNA transfer as
long as the tran sfer com plex is anchored to the cell e n v elo p e allow ing
displacem ent of the u n w o u n d strand.
Possible candidates for anchoring of
p lasm id F T ral-D N A com plex to the cell envelope are TraD and TraM
(Silverm an, 1987).
It is generally believed that nicking at the o r i T relaxes the plasm id
com pletely.
H ow ever, exam ination of plasm id F after ran d o m nicking by
irradiation show ed that dom ains of the plasm id retain negative supercoiling
(Wilkins and Lanka, 1993). If the DNA strand that is nicked by the relaxase is
restrain ed from free rotation, DNA helicase activity w o u ld o v erw in d the
d u p lex ahead of the enzym e and th u s p rev en t fu rth e r u n w in d in g . This
problem could be overcome by a topoisom erase that prevents accum ulation of
13
positive torsional stress.
One possible candidate is DNA gyrase, w hich is
re q u ire d d u rin g bacterial conjugation as show n th ro u g h a n u m b er of
experim ents involving naladixic acid, an inhibitor of the A subunit of the
enzym e, and the use of tem p eratu re sensitive g y r m u ta n ts (M atson and
M orton, 1991; W ilkins and Lanka, 1993).
D uring transfer of plasm id F only one stran d is tran sferred to the
recipient cell (Cohen et ah, 1968; V apnek and Rupp, 1971). U pon exam ination
of w hich X p rophage strand is transferred d uring H fr m atings, it w as found
th at the plasm id F DNA strand is transm itted in the 5'-3' orientation (Willetts
and W ilkins, 1984). The orientation of transfer for other plasm ids has n o t yet
been dem onstrated.
H ow ever, the sim ilarities betw een plasm id protein-onT
interactions to those of plasm id F and the orientation of oriT and gene entry to
recipient cells suggests that m ost enterobacterial plasm ids transfer in the sam e
orientation (H ow land and Wilkins, 1988; Lanka and W ilkins, 1995).
The th ird stage in DNA transfer involves the recircularisation of the
p lasm id strand and the regeneration of a replacem ent strand in the donor by a
rolling circle m ode of replication and synthesis of a com plem entary strand in
the recipient (Traxler and M inkley, 1987; W aters and G uiney, 1993; W ilkins
and
L anka,
1993).
In fo rm a tiv e e x p erim e n ts in v o lv in g
m a n ip u la te d
m obilisable plasm ids w ere able to show that the 3' term inus created at the nic
site can be elongated continuously by a DNA polym erase p resent in the donor
cell (see Wilkins and Bates, 1997). The m odel further suggests that the plasm id
strand destined to be transferred is an interm ediate of greater than unit length,
w hich u p o n exposure of the regenerated nic site to the relaxase m olecule
linked covalently to the 5' term inus of the concatom er is cleaved (Wilkins and
Bates, 1997). Experim ents involving Collb and plasm id F provide no evidence
th at the p lasm id is tran sfe rred to the recipient as a concatom er; since
sed im en tatio n -rate stu d ies indicate tran sfe rred DNA accum ulates in the
recipient cell as u n it length m olecules (Falkow et al., 1971; Boulnois and
W ilkins, 1978).
14
G eneration of the com plem entary strand in the recipient is believed to
involve the product of the E. coli dnaE gene, DNA polym erase III holoenzym e
(Boulnois and W ilkins, 1978). H ow ever, due to the orientation of transfer of
the plasm id strand (5'-3'), replication proceeds discontinuously and requires a
series of prim ers synthesised de novo (Willetts and W ilkins, 1984). A feature
found for Incll and IncP plasm ids is that the transferred strand is escorted to
the recipient w ith m ultiple copies of plasm id-specific DNA prim ase m olecules
generated by the plasm id-encoded prim ase genes sog and tra C, respectively
(Boulnois and Wilkins, 1978; Lanka and Barth, 1981; Chatfield et al., 1982; Rees
and W ilkins, 1990). Both the Sog and TraC proteins can be transferred along
w ith the plasm id DNA from the donor to the recipient cell (Rees and W ilkins,
1989; Rees and W ilkins, 1990). Plasm id F relies on host-encoded replication
m achinery for the generation of these prim ers (M erryw eather et al., 1986;
W ilkins and Lanka, 1993).
1.3.3
Plasmid-encoded exclusion
Transm issible plasm ids usually carry entry- or surface-exclusion genes,
the products of w hich reduce the ability of the host cell to receive plasm ids of
the sam e or related type by conjugation.
Exclusion should not be confused
w ith incom patibility, w hich is m ediated from an entirely separate locus on the
plasm id and p rev en ts the co-existence of tw o sim ilar p lasm id s w ith in the
sam e cell (Finlay and Paranchych, 1986). Stages of a p lasm id 's conjugation
cycle that can be influenced by exclusion are m ating-pair form ation a n d /o r
DNA transfer (Rashtchian et al., 1983).
One possible ecological role of exclusion m ay be sim ilar to th at of
p lasm id fertility inhibition, as a m eans of reducing w astefu l and energy
consum ing conjugations.
In addition, exclusion m ay also serve to reduce
entry of plasm ids that are likely to displace the resident elem ent by the process
of incom patibility (Zechner et al., 1999).
15
The effects of exclusion w ere first noticed w hen the viability of F
recipient cells was greatly reduced in com parison to F+ recipients w hen m ated
w ith an excess of Hfr donors (Alfoldi et al., 1957; Skurray and Reeves, 1973).
The phenom enon requires the p ro d u c tio n of pili by the donor and close
physical contact betw een the donor and recipient cells (Skurray and Reeves,
1973). This recipient killing event w as nam ed lethal zygosis w hich is believed
to be the result of intense m ating conditions and m ultiple conjugation events.
Lethal zygosis is associated w ith m em brane dam age and leakage of m em brane
constituents and cytoplasm ic com ponents, w hich p resu m ab ly kill the cell
(Zechner et al., 1999).
The role of exclusion in p reventing lethal zygosis is
highlighted by the fact that F recipient cells are not killed w hen m ated w ith an
excess of F+ donor cells. This is due to a functional exclusion system encoded
by the F plasm id (Zechner et al., 1999).
The m ost extensively studied exclusion system s (sfx) belong to the F-like
plasm ids. Two genes, traS and traT, have been show n to provide exclusion by
tw o in d ep e n d en t m echanism s.
Both traS and t r a T are located w ithin the
m ajor F transfer operon betw een traG and tr a D . TraS (TraSp) is a 16.9 kDa
protein associated w ith the inner m em brane of the donor cell and functions by
blocking DNA entry either by affecting the entry system of the donor or by
interfering w ith the initiation signal generated follow ing successful m atingp air form ation (M anning et al., 1981; Finlay and Paranchych, 1986; Frost et al.,
1994; Firth et al., 1996).
TraT (TraTp) is a 26 kDa lip o p ro tein found in
abundance in the ou ter m em brane of the donor cell, w hich serves to im pair
the form ation of stable m ating aggregates, possibly by blocking access of the Fp ilu s tip to its p utative receptor or by interfering w ith the F products TraG
a n d /o r TraN which are required to stabilise the m ating-aggregates (M anning et
al., 1981; M inkley and W illetts, 1984; D reiseikelm ann, 1994; Frost et al., 1994;
Firth et al., 1996).
TraT alone is not sufficient for full expression of the
exclusion system (Rashtchian et al., 1983).
16
Extensive sequence hom ologies exist betw een the exclusion genes of
plasm id F and the functionally related genes of other F-like plasm ids (Finlay
and Paranchych, 1986). The exclusion genes of R100 have been show n to have
th eir ow n strong prom oters w hich are n o t subject to regulation by the
tran scrip tio n al activator TraJ (Rashtchian et al., 1983). Also, dow nstream of
t r a T a term ination signal can be found.
H ow ever, it is believed that these
genes are only transcribed from such prom oters under certain conditions that
have yet to be characterised. Otherwise, they are transcribed from the m ain F
Tra operon prom oter (Py) and are therefore subject to control by TraJ (Ham et
al., 1989; Frost et al., 1994; Firth et al., 1996).
The first exclusion determ inant studied for an I-type plasm id w as that of
p lasm id R144.
The exclusion (e x c ) locus w as show n to consist of tw o
overlapping open reading frames that encode two polypeptides, 13 kDa and 19
kDa in size (H artskeerl et al., 1986).
H ow ever, it w as later found th at the
sm aller p o ly p ep tid e w as the result of translation being reinitiated in the
reading fram e of the larger polypeptide. M utagenesis of the larger polypeptide
revealed th at this p ro tein is essential for exclusion (H artskeerl et al., 1985).
These polypeptides are now referred to as ExcA (19 kDa) and ExcB (13 kDa) and
the exclusion locus as eex.
C om parisons betw een the physical and genetic m aps of In cll plasm ids
R144, R64 and Collb indicate that the exclusion locus of each is located at a
sim ilar corresponding position on the plasm id (Furuya and K om ano, 1994;
Rees et al., 1987). The nucleotide sequences of the eex genes of R144 and R64
h av e b een d e te rm in e d
and extensive hom ology ex ists b e tw e e n th em
(H artsk eerl et al., 1986; Furuya and Komano, 1994). The nucleotide sequence
for th e exclusion genes of Collb only recently becam e available w hen the
com plete sequence of the plasm id w as determ ined.
These genes are 100%
identical co those of plasm id R144 (EMBL: AB021078).
From cell fractionation experim ents the larger p o ly p ep tid e (ExcA)
encoded by R144 w as found bound to the inner m em brane of the donor on the
17
periplasm ic side bu t can also be found in a soluble form in the cytoplasm
(H a rtsk e e rl et al., 1985a; H a rtsk eerl an d H o ek stra, 1985).
p o ly p ep tid e ExcB can be found in the in n er m em brane.
The second
The stage of
conjugation that is inhibited by I-type exclusion is unknow n, although m atinga g g re g a te
fo rm atio n
is u n affe cte d
(H a rtsk e e rl a n d
H o e k stra ,
1984).
M easurem ents of the am ount of radio-labelled DNA transferred from a donor
carrying an I-type plasm id to an R144 excluding recipient suggest that I-type
exclusion operates by inhibiting D N A tran sfe r ra th e r th a n m atin g -p a ir
form ation (Hartskeerl and Hoekstra, 1985).
1.4
Barriers to Horizontal DNA Transfer of Plasmids
Productive plasm id exchange not only requires a m ode of transfer b u t
also establishm ent of the DNA in the recipient cell. Such exchange is achieved
p rim a rily by the process of co n ju g atio n and su b se q u e n t a u to n o m o u s
replication in the new host.
This section focuses on barriers th at m ay be
encountered by plasm ids transferring by the process of conjugation. A barrier
can be described as any biological process, active or passive, w hich can lim it the
level of gene exchange betw een organism s (Matic et al., 1996).
One b a rrie r is the physical b o u n d a ry th at exists b etw een bacteria
sep arated in n a tu re into different m icrohabitats.
A nother b arrier, w hich
operates betw een different species of bacteria, is referred to as m aintenance- or
host-range (Matic et al., 1996). The replication-m aintenance range of a plasm id
is subject to a num ber of factors, which will affect the process of establishm ent
of the plasm id and as a consequence influence w hether the plasm id persists
w ithin a given population of bacteria (Summers, 1996).
Some of these factors include, first, the ability of the au to n o m o u s
plasm id to replicate at a rate that m atches the grow th and division rate of its
host cell. If the plasm id replicates too slowly then plasm id free cells will begin
to appear in the population. If the plasm id replicates too fast its copy num ber
18
w ill rise and the m etabolic load im posed on its host will have detrim ental
affects. The plasm id generally overcom es this difficulty by encoding a copy
nu m b er control m echanism (Summers, 1996).
Second, if the plasm id has a low copy num ber the requirem ent for an
active partitioning system is essential to ensure even distribution of plasm ids
to d a u g h te r cells u p o n cell division.
T hird, the range of host replication
enzym es th at can be utilised by the p lasm id will influence w hether the
p lasm id is m aintained.
It sho u ld be n o ted th at m ost n a tu ra l p lasm id s
com m only em ploy ad d itio n al m echanism s th at serve to m ain tain th e ir
presence w ithin the bacterial population.
One such m echanism involves a
plasm id-encoded toxin, which is neutralised by a short lived plasm id-encoded
antidote. Typically, these toxins have a long half-life. If the cell continues to
divide following the loss of the plasm id the antidote becom es insufficient to
n e u tra lise the lethal effects of the toxin and the cell becom es exposed
(Sum m ers, 1996).
C om m on exam ples include colicin pro d u ctio n by colicin
p ro d u cin g plasm ids (reviewed in Luria and Suit, 1987).
The transfer range of a plasm id is generally m uch broader than its host
ran g e, as show n by either the recovery of plasm id-borne transposons in
recipient cells after a ro u n d of conjugation or the use of shuttle vectors as
reporters for the transfer range of a plasm id (Wilkins, 1995). Evidently, the
potential for exchange of genetic m aterial am ong a different variety of bacterial
species is enorm ous.
Finally, another barrier to plasm id transfer is that im posed by bacterial
restriction-m odification system s.
These are ubiq u ito u s in n a tu re and are
therefore likely to be encountered frequently by tran sferrin g DNA.
R-M
system s are centrally im portant to this thesis and will be discussed in m ore
detail below.
19
1.5
Bacterial Restriction-Modification Systems
R-M system s are com m only d etected in b acteria fo u n d in every
ecological niche and taxonom ic g roup (W ilson and M urray, 1991).
These
sy stem s generally consist of tw o en zy m es w ith o p p o sin g in tra ce llu lar
activities, able to recognise and react w ith short specific sequences of DNA.
The targ e t sequences of these en zy m es v ary in len g th , co n tin u ity , and
sy m m etry and w hether they are u n iq u e or d eg en erate.
The restriction
endonuclease recognises its target sequence and catalyses cleavage of DNA
either w ithin the sequence or away from it. The cognate m odification enzym e
recognises the sam e targ et sequence to its endonuclease c o u n te rp a rt and
catalyses the addition of a methyl group to either an adenosyl or cytosyl residue
in each strand of the sequence.
M ethylation renders D N A refractory to
cleavage by the restriction endonuclease (Wilson and M urray, 1991).
Both stra n d s of the target sequence are m eth y la te d .
H ow ever,
hem im ethylation, w here only one stran d of the sequence is m ethylated, is
usually adequate to prevent cleavage. Such a property is especially im portant
d u rin g replication of the bacterial chrom osom e where the d aughter strand of
the duplex will be unm ethylated (Wilson and M urray, 1991).
The phenom enon of restriction and m odification w as first described 50
years ago when it was observed that certain strains of bacteria could restrict the
grow th of infecting bacterial viruses. However, an explanation of events at the
m olecular level w as not available for another 10 years (A rber and Dussoix,
1962; Bickle and K ruger, 1993). It w as these early findings w hich led to the
view that the biological function and ecological role of R-M system s was to
protect the host cell from invasion by foreign DNA, nam ely viruses.
O ver
recent years, the ecological role of R-M system s has come u n d er debate. The
discovery that m any bacteriophages often escape the effects of restriction,
particularly if they posses few target sites or encode antirestriction systems, has
led to a num ber of conflicting views as to w hat the biological role of these
system s are (Matic et al, 1996; See section 1.5.6).
20
The classic R-M system s can be classified into one of three distinct
g ro u p s based on co-factor requirem ent, su b u n it com position of enzym es,
structure of recognition sequence and the position of cleavage by the restriction
endonuclease enzym e (Yuan and H am ilton, 1984).
H ow ever, it should be
n o ted th at several R-M system s identified do not m eet these criteria for
classification.
One such exam ple includes restriction enzym es th at only
recognise and cleave m odified DNA (Redaschi and Bickle, 1996). It is beyond
the scope of this thesis to discuss all types of R-M system s that exist, therefore,
the reader is directed to review s by W ilson and M urray (1991), Bickle and
K ruger (1993) and Redaschi and Bickle (1996) for further details. The classic
type I and type II R-M system s are of relevance to this thesis and therefore the
follow ing sections will focus on these two types only.
1.5.1
Type I R-M systems
Type I R-M system s are the m ost complex system s discovered so far
(Redaschi and Bickle, 1996). Three subunits, R (restriction), M (m odification)
a n d S (specificity) encoded by the genes hsdR, h s d M and h s d S , form a
m ultifunctional enzym e th at can catalyse both cleavage and m ethylation.
In
ad d itio n , these enzym es have also been show n to have DNA topoisom erase
activity (Yuan and H am ilton, 1984; Redaschi and Bickle, 1996).
Co-factors
req u ire d by type I enzym es for activity include S - a d e n o s y lm e th io n in e
(A doM et), M g2+ and ATP.
A lthough the S subunit dictates the sequence
recognised in both the m ethylation and restriction reactions, an enzym e can be
isolated containing only S and M subunits. This p ro d u ct has been found to
fun ctio n as a m odification m ethylase.
The R subunit, on the other hand,
cannot function independently of either of the other tw o subunits (Hadi et al.,
1975; Redaschi and Bickle, 1996).
Type I enzym es recognise asym m etric bipartite sequences that include
an internal non-specific spacer of six to eight bp (Yuan and Ham ilton, 1984). In
addition, parts of the recognition sequence outside the internal spacer m ay also
21
be degenerate. The nature of the ends of the restriction fragm ents created by
type I enzym es are elusive, although they are resistant to 5' end phosphate
labelling by polynucleotide kinase (Endlich and Linn, 1985b). Cleavage by type
I restriction enzymes usually occurs at variable distances of 400 to 7000 bp aw ay
from the recognition sequence (Redaschi and Bickle, 1996). D ue to the nature
of cleavage reactions, detection of type I R-M system s by in vitro digestion of
DNA using bacterial cell extract is difficult. Such system s are generally detected
in vivo by a series of m olecular tech n iq u es often in c lu d in g restrictio n
sensitive bacteriophages (Wilson and M urray, 1991).
O ther criteria used to
characterise type I R-M system s include chrom osom al location of hsd genes,
enzym e subunit structure, genetic organisation, co-factor requirem ent, reaction
m echanism and recognition sequence (Bickle and Kruger, 1993).
T ype
I
R-M
sy ste m s
w e re
c la ssic ally
a s s o c ia te d
w ith
th e
E nterobacteriaceae fam ily of bacteria as m ost system s d isco v ered w ere
id en tified in strains of E. coli and species of C i t r o b a c t e r , Salmonella a n d
K le bs ie ll a (Redaschi and Bickle, 1996).
The discovery of type I system s in
M y c o p l a s m a p ulm on is (Dybvig and Yu, 1994) and Haemophilus influenzae R d
(Fleischm ann et al ., 1995) suggests that these systems m ight be m ore prevalent
in n atu re than original findings im ply (Barcus and M urray, 1995; Chilley and
W ilkins, 1995).
U nfortunately, the complex characteristics of these system s
h in d er their identification. Type I system s can be organised into one of four
genetically related fam ilies based on a series of m o le cu la r ap p ro ach es
involving com plem entation tests, DNA hybridisations, im m unological tests
and DNA sequence com parisons (Daniel et al., 1988; C ow an et al., 1989). These
families include IA (K); EcoBI, EcoKI, EcoDI, S t y SBI, S t y SPI, S t y S Q l and S t y SJIfa;
IB (A), EcoAI, EcoEl and C/f Al; the plasm id-encoded IC (R124) fam ily including
EcoR124 and EcoDXXI and finally ID; StySBLI (Bickle and K ruger, 1993;
T itheradge et al., 1996).
The h s d genes of each fam ily have been c h arac terise d by D N A
sequencing and DNA hybridisation studies.
22
H om ologies only exist w ith in
families betw een either the h s d M or hsdR gene. No hom ology exists betw een
the genes of different families apart from short sequence m otifs comm on to
DNA adenine m ethylases and ATP-binding proteins (Bickle and Kruger, 1993;
Redaschi and Bickle, 1996). A shared feature of all these hsd genes is that they
are arranged into tw o continuous transcriptional units.
The h s d M and h s dS
genes form an operon, w hich is transcribed from the P m o d prom o ter and
h sdR is transcribed from its own prom oter, Rres.
Systems belonging to the IA
and IB families have the sam e gene organisation w ith h s d R gene proceeding
h s d M and hsdS.
These genes also have the same location w ithin the bacterial
chromosome. M ost of the type IC system s are encoded by plasm ids w here the
gene o rg an isatio n is sim ilar to th at of the ID fam ily, h s d M and h s d S
proceeding hsdR (Redaschi and Bickle, 1996; Titheradge et al., 1996).
The S subunit of the type I enzym e can be divided into three functional
dom ains; the am ino term inus, w hich recognises the trinucleotide half of the
b ip a rtite recognition sequence; the central dom ain, w hich recognises and
determ ines the num ber of nucleotides w ithin the non-specific spacer; and the
carboxy term inus, w hich recognises the other half of the recognition sequence.
A certain degree of hom ology exists betw een the hsdS genes from different
fam ilies, p articu larly the region thought to be responsible for S-m ediated
protein-protein interactions w ith M and R subunits. The hsdS gene contains
tw o regions of non-hom ology, which are believed to be responsible for specific
sequence recognition. Hom ology is only ever detected in these regions if the
recognition sequences of the enzym es are the sam e (C ow an et al., 1989;
Redaschi and Bickle, 1996)
Rearrangem ent of p arts of the hsdS genes by recom bination has been
d e m o n stra te d
in th e lab o ra to ry and is b eliev ed to occur in n a tu re .
Recom binations alter the three dom ains of the S subunit involved in sequence
recognition, w hich in tu rn results in new sequence specificities being form ed.
Such a phenom enon is believed to pu t type I enzym es at an advantage over
23
other R-M system s as they can random ly change their sequence specificity
(Bickle and Kruger, 1993).
1.5.2
Type I enzyme activity
M ost of the following inform ation about type I enzym e activity comes
from stu d ies w ith EcoKI and EcoBI.
The type I three-co m p o n en t enzym e
com plex can function as either an endonuclease, a DNA m ethylase, an ATP
hydrolase coupled to restriction or a DNA helicase (B urckhardt et al., 1981a).
The type I enzym e devoid of any co-factors has little affinity for DNA.
H ow ever in the presence of Ado-Met the enzym e becom es activated and will
bind DNA regardless of its sequence or if it is m ethylated. If the recognition
sequence is present, then the enzyme form s a m ore stable recognition com plex
th at can react to three different m ethylation states including fully m odified,
fully u n m o d ified or hem im ethylated (heteroduplex).
If the reco g n itio n
sequence is fully m odified, the presence of ATP leads to the dissociation of the
enzym e from the DNA (Burckhardt et ah, 1981b).
In contrast, if the sequence
is u n m eth y lated th en the enzym e b in d s to the DNA as a tig h tly b o u n d
com plex, a process th at requires the presence of ATP (W ilson and M urray,
1991). This tightly bound complex is different from that enzym e state w hich
binds any sequence of DNA suggesting that a further conform ational change in
the enzym e has occurred (Bickle et ah, 1978).
In fact, this conform ational
change is due to the enzym e losing bound Ado-Met in the presence of ATP.
One hypothesis to explain why these enzym es cleave aw ay from their
reco g n itio n sequences is th at once the enzym e is b o u n d tig h tly to its
u n m eth y lated recognition sequence it translocates DNA in both directions
sim ultaneously.
The EcoBI enzyme has only ever been show n to translocate
DNA in one direction (Endlich and Linn, 1985a).
D uring translocation, the
enzym e rem ains attached to its recognition sequence and DNA is looped past
in a process requiring ATP hydrolysis. In fact, ATP hydrolysis continues after
cleavage has gone to completion, which in circular m olecules is believed to be
24
associated w ith stalled translocating enzym es, due to the topological barriers
these enzym es face if tw o sites are far apart and the DNA m olecule has not
been cleaved by other enzym es (Bickle et al., 1978).
C leavage occurs som e
distance from the recognition sequence w hen two sim ilar com plexes collide
(S tu d ier and B andyopadhyay, 1988; W ilson and M urray, 1991).
F u rth er
ev id en ce to su p p o rt this hypothesis is th at w hen cleavage reactions are
sy n ch ro n ised , the sizes of resu ltin g restriction frag m en ts co rresp o n d to
cleavage occurring m idw ay betw een tw o adjacent reco g n itio n sequences
(B urckhardt et al., 1981a; B urckhardt et al., 1981b; W ilson and M urray, 1991;
Redaschi and Bickle, 1996).
Finally, if the sequence is hem im eth y lated then ATP induces the
form ation of the m ethylase complex using free Ado-Met as a m ethyl donor to
m ethylate the other strand. In the case of type I enzymes, the base m ethylated
is alw ays an adenosyl residue. N ot only does Ado-Met function as an allosteric
effector b ut is also the m ethyl donor and only co-factor req u ire d in the
m ethylation reaction. Once m ethylation is completed, the enzym e dissociates
from DNA in a process that does not require ATP hydrolysis. Interestingly, the
m ethyltransferases of the EcoKI enzym e are the only prokaryotic enzym es to
show a strong preference for hem im ethylated DNA. Such enzym es are often
referred to as m aintenance m ethylases as their presence ensures m ethylation
follow ing DNA replication.
In contrast, the E c o A l
m e th y ltra n s fe ra s e
m ethylates DNA de novo (Kelleher et al., 1991).
1.5.3
Regulation of expression of type I R-M genes
T here
are
c irc u m sta n c e s
w hen
re g u la tio n
of
re s tric tio n
m odification activities w ithin the bacterial cell is essential.
and
These include
eith er during establishm ent of an R-M system in a new stra in or d u rin g
changes in the physiology of the cell, w hich m ight lead to underm odification
of the host genom e.
The latter situ atio n is know n to arise d u rin g cell
starvation (Bickle and Kruger, 1993; Redaschi and Bickle, 1996).
25
As already m entioned, the genetic organisation of the type I hsd genes is
such th at h s d M and h s d S form an operon and h s d R is expressed from a
separate prom oter. However, exam ination of specific hsdk-lacZ operon fusions
u n d e r co nditions sim ilar to those d escrib ed above sh o w ed no a ltered
e x p re ssio n p a tte rn s at the tra n sc rip tio n a l level for th ese genes w h en
transferred to a naive cell (Prakash-Cheng et al., 1993).
D espite there being no obvious control of these h s d genes at the
transcriptional level, transm ission of novel type I R-M genes is surprisingly
efficient (Suri and Bickle, 1985; Redaschi and Bickle, 1996).
s u g g e s t th a t d u rin g
tra n sfe r of th e
hsd
g e n es,
th e
Such findings
m o d ific a tio n
m eth y ltra n sfe ra se is functional in the recip ien t b efore th e re stric tio n
endonuclease.
As early as 1965, Glover and Coulson described experim ents
w hich show ed th at the restriction phenotype of the EcoKI R-M system is
d elay ed follow ing conjugative transfer.
These experim ents invo lv ed the
conjugative transfer of the EcoKI R-M genes from an E. coli K-12 H fr donor to
an E. coli B F" recipient. In other experiments, the appearance of the restriction
phenotype w as delayed in the recipient for 15 generations w hilst m odification
w as observed im m ediately (Prakash-Cheng and Ryu, 1993). Since there is no
evidence for transcriptional control of expression of hsdk genes, these findings
su g g est th at control m u st be at the translational or p o st-tran slatio n al level
(Prakash-Cheng et al., 1993).
A spontaneous m u tan t of E. coli C has been isolated, w hich is sensitive
to the receipt of h s d k genes.
The m u tan t gene resp o n sib le, h s d C , m u st
som ehow m ediate control of type I R-M systems in E. coli K-12 (Prakash-C heng
et al., 1993).
It was postulated that the HsdC peptide m ight be required to
influence assembly of the EcoKI enzyme (Dryden et al., 1997). Analyses of the
pathw ay responsible for the assembly of EcoKI suggests that at a particular stage
the HsdR subunit m ay become susceptible to proteases (D ryden et al., 1997). In
a screening of strains of E. coli K-12 that are deficient in proteases, M akovets et
al. (1998) identified two possible candidates ClpX and ClpP that m ake up the E.
26
coli ClpXP protease. At least one of these products, ClpX or ClpP is required in
the recipient for the efficient transm ission of EcoKI. These results im ply that
the ClpXP protease is involved in m o d u latin g restriction activity and that
delayed restriction during conjugative transfer occurs at the post-translational
level (Makovets et al ., 1998).
Over recent years m uch em phasis has been placed on understan d in g the
com plexities of transcriptional and translational control in the regulation of
p ro tein availability w ithin the cell.
The roles of certain p ro teases in the
regulation of gene expression in both prokaryotic and eukaryotic organism s is
becom ing increasingly m ore evident. It has long been know n th at proteases,
p resen t w ithin all cells, degrade p ro tein s th at are u n sta b le or abnorm al.
H ow ever, during regulatory proteolysis, specific proteases have the ability to
adjust and regulate the am ounts of available protein w ith in the cell by
targeting specific proteins for degradation, in particular, reg u lato ry proteins
and key m etabolites.
Therefore, in ad d itio n to control at the level of
transcription and translation, regulatory proteolysis plays an essential role in
allow ing the cell to respond to external stresses and developm ental signals.
Cleavage by the protease renders the protein biologically inactive and m ay also
resu lt in exposing the p ro tein to fu rth er d eg rad atio n by o th er cellular
proteases.
Cells th at are m utants in such initiating p ro te a se s te n d to
accum ulate an abundance of the target protein (Gottesman and M aurizi, 1992;
Gottesm an, 1996).
Proteins susceptible to degradation by proteases generally fall into three
classes.
The first class includes those pro tein s th at are eith er unstable,
dam ag ed or abnorm al d u e to m utations w ith in the co rre sp o n d in g gene.
External stresses that lead to the induction of a p articu lar stress response
w ith in the cell often resu lt in the accum ulation of abnorm al or dam aged
proteins.
Therefore, it is not surprising th at a large p ro p o rtio n of genes
in d u ced d u rin g such stress responses encode proteases.
particularly true for the heat shock response (Gottesman, 1996).
27
This finding is
The second class includes proteins that are required w ithin the cell for
lim ited tim es and are quite often involved in complex regulatory pathw ays.
These proteins have often been referred to in the literature as 'tim ing proteins'
(Gottesm an, 1996).
The final class includes proteins th at form p a rt of a m ulti-com plex
s tru c tu re , w h ere u n d e r certain
c o n d itio n s ra p id
d e g ra d a tio n of the
uncom plexed protein m ay occur (Gottesm an, 1996). This is believed to be the
case during assembly of the type I restriction enzym e, EcoKI (M akovets et al.,
1998). It is envisaged that under norm al conditions the H sdM subunit of the
type I restriction enzym e protects the H sdR subunit from attack by proteases.
H ow ever, one idea is that during transm ission of type I R-M genes, the ClpXP
protease com petes w ith the HsdM subunit for interaction w ith H sdR, w hich
delays the production of the active endonuclease complex (M akovets et al.,
1998).
The effect of a c l p X m utation on the transm ission of the EcoKI h s d
genes by conjugation is more extreme than the effect of a clpP m utation. Such
resu lts im ply th at ClpX m ay be involved in initially targeting the H sdR
com ponent, which in tu rn m akes it a substrate for further degradation by the
ClpXP protease.
ClpP can associate w ith two com ponents to form a protease.
These
com ponents include either ClpA or ClpX as molecular chaperones. Both ClpA
and ClpX form the ATPase subunit of the complex, which is essential, as m ost
proteolytic reactions req u ire ATP hydrolysis.
W hen com plexed w ith the
protease, these ATPase com ponents regulate protein degradation by binding,
unfolding and translocating substrates into the proteolytic cham ber of ClpP.
Follow ing proteolysis, the products of the degradation reaction diffuse out of
the ClpXP or ClpAP com plex (W ickner and M aurizi, 1999).
The genes
responsible for ClpX and ClpP lie w ithin the same operon, w hich is regulated
by a heat shock prom oter.
In addition to recent findings that the ClpXP
protease is involved in degrading the H sdR com ponent of EcoKI and EcoAI
restric tio n en d o n u clease enzym es, the p ro tease is also resp o n sib le for
28
d eg rad atio n of
protein, PI addiction protein, Mu repressors, and RpoS,
w hich is a sigma factor required for gene expression du rin g stationary phase
(Gottesman, 1996).
1.5.4
Type II R-M systems
The type II R-M systems are the least complex and have been discovered
in virtually every class of bacteria over 150 of w hich w ere isolated in E. coli and
Salmonella strains (Roberts and Macelis, 1994; Redaschi and Bickle, 1996).
Type II system s typically com prise separate restriction and m odification
enzym es that act independently of each other. The only co-factors required are
M g2+ ions by the endonucleases and A do-M et by the m ethyltransferases. The
ability of these enzym es either to cleave or to m ethylate DNA at fixed positions
w ith in their recognition sequences has led to their exploitation in m any
branches of m olecular biology and to the w ide screening of bacteria for new
system s. Several thousand type II R-M systems have been discovered, bu t only
a few have been fully characterised.
It should be n o ted th at m ost new
specificities discovered are duplicates of other systems and are referred to as
isoschizom ers.
The recognition sequences of type II enzym es generally consist of
betw een four to eight specific nucleotides, quite often th e sequences are
sym m etric and m ay be continuous or interrupted (Wilson and M urray, 1991).
M ost endonucleases act as hom odim ers w here each subunit interacts w ith one
half of the recognition sequence and cleavage of both DN A stran d s is co­
o rd in ated .
In contrast, the m ethyltransferases norm ally act as m onom ers,
w hich transfer one m ethyl group to one stra n d per D N A b in d in g event
(N ew m an et al., 1981). The EcoRI endonuclease is com m only isolated as a
hom odim er.
Exam ination of the EcoRI-DNA com plex in d icated th a t the
active sites of the enzym e are placed directly against the phosphodiester bonds
th at are hydrolysed d u rin g the cleavage reaction (M cClarin et al., 1986).
M ethylation at these sites presum ably prevents such a complex form ing due to
29
steric hindrance. Cleavage of DNA by type II enzymes can produce either 5' or
3' overhangs or blunt ends.
Plasm ids transferring by the process of enterobacterial conjugation do so
in single-stranded DNA form. W hether type II restriction enzym es are able to
cleave single-stranded DNA is still debatable. Evidence has been reported to
su g g est th at some type II restriction enzym es cleave single-stranded DNA,
alth o u g h w hether such enzymes act on single-stranded DNA or tem porary
duplex structures that form in the DNA strand is unknow n (N ishigaki et al.,
1985). In addition, it has been found that EcoRI is capable of cleaving ssDNA
that is im m obilised on cellulose by ligation. How ever, the cleavage reaction is
less efficient than that which cleaves dsD N A (Bischofberger et al., 1987).
M any ty pe II R-M system s have been cloned and the n u cle o tid e
sequence of the structural genes determ ined.
Surprisingly, no hom ologies
exist betw een the amino acid sequences of cognate restriction and m odification
enzym es, which suggests that they m ust have evolved independently of each
o th er (C handrasegaran and Smith, 1988; W ilson, 1991; Redaschi and Bickle,
1996).
Furtherm ore, it is rare for any hom ology to exist betw een restriction
endonucleases and their isoschizomers, despite the two enzym es recognising
the sam e target sequences (Wilson and M urray, 1991; Bickle and Kruger, 1993).
It is envisaged th at the m ethyltransferase enzym e evolved first, m ethylating
the bacterial genom e, u p o n w hich the restriction endonuclease could then
invade (Bickle and K ruger, 1993).
The endonuclease and m ethyltransferase of a cognate type II system
possess separate target recognition dom ains (TRD) and as a consequence, each
enzym e em ploys a different strategy for recognition of their target sequences.
Base analogue substitution experim ents w ere able to show that each enzym e
recognises a different base in the target sequence that is com m on to bo th
enzym es (N ew m an et aL, 1981). Such a feature of type II R-M system s probably
lim its these enzym es from developing new specificities during their evolution
(Wilson and M urray, 1991).
30
A subclass, classified as type II system s due to co-factor requirem ent
consists of those restriction enzym es th at recognise and cleave at a precise
distance one-20 base pairs from their recognition sequence. These are referred
to as type IIS systems, w here the S stands for shifted cleavage (Szybalski et al.,
1991).
1.5.5
Regulation of type II R-M systems
For reasons described in section 1.5.3, expression of type II restriction and
m odification activities need to be regulated. Type II R-M system s vary in their
genetic organisation and their gene expression patterns.
C onsequently, it is
difficult to generalise; therefore, the m echanism s described can only be used as
examples, which m ay apply to some know n systems.
One way in w hich type II R-M reactions can be m odulated is by a passive
m echanism that relies on the restriction enzym e functioning in a m ultim eric
form .
Most type II restriction enzymes function as hom odim ers and cleavage
re q u ire s th e accu m u latio n of R su b u n its.
In c o n tra st, m o st of the
corresponding m ethyltransferases function as monomers. C onsequently, there
is a lag betw een the tw o opposing enzym e activities.
This m echanism of
control can be applied to the EcoRI system (Greene et al., 1981).
Evidence that the restriction genes of some type II R-M system s can be
cloned w ithout the corresponding m odification gene suggests th at E. coli is
able to repair a certain am ount of DNA dam age created by these enzymes. The
restriction genes that have been successfully cloned include those of P ae R 7 l,
T a q l , Av a il , Ha ell, H i n f l , P s t l and X ba l. H ow ever, colonies of strains differ
from others in th at they appear tran slu cen t an d are susceptible to high
frequency loss of the plasm id which carries the restriction gene.
In addition,
synthesis of the restriction enzyme is greatly reduced com pared to that in a
m odified strain (Lunnen et a l , 1988; Redaschi and Bickle, 1996).
Regulation of restriction and m odification activities by som e type II
system s involves the product of another tightly linked ORF (Tao et al., 1991).
31
The p red icted am ino acid sequences of these C (controller) proteins have
p o te n tia l DN A b in d in g p ro p e rtie s su ch
th a t th ey
m ay fu n ctio n
as
transcriptional repressors or activators. M utations in the C gene of the P v u l l
sy stem resu lts in a restriction-less p h e n o ty p e , w h ic h in tu rn can be
co m p lem en ted in trans by the w ild-type gene. D isruption of the C gene of
BamYLI results in decreased restriction and increased m ethylase activity (Bickle
and Kruger, 1993). Nine R-M systems that have been sequenced have one of
these ORFs; five share sequence hom ology and are able to com plem ent each
other in trans. Such findings suggest that these C genes m ay have evolved as a
fam ily in dependently of RM genes as no hom ology is found betw een them
(Redaschi and Bickle, 1996).
1.5.6
Ecological roles of bacterial R-M systems
Early studies w ith R-M systems and the finding that they are w idespread
led to the m odel that their m ain ecological role was to provide bacteria w ith
protection against infection by bacteriophages. Such a concept is now referred
to as the 'cellular defence' hypothesis. There are situations in n a tu re w here
the carriage of a novel R-M system is seen as advantageous to the host cell.
O ne of these situ atio n s is w hen bacteria specifying a R-M system in v ad e
m icrohabitats containing phages that can infect the strain (Korona and Levin,
1993; Bickle and Kruger, 1993; Korona et al ., 1993).
A problem w ith the 'cellular defence' hypothesis is that restriction is
n o t an absolute barrier to transferring DNA and that a fraction will escape
destruction and acquire m ethylation.
Hence the R-M barrier is only transient
and consequently, the 'cellular defence' is not the only role that can be assigned
to R-M system s (Korona and Levin, 1993).
A further short com ing in the
'cellular defence' hypothesis is that it does not explain restriction enzym es that
have long recognition sequences of 8 bp, w hich are not likely to be present in
the genom es of m any bacterial viruses (Naito et al., 1995). Also, the 'cellular
defence' hypothesis does not explain the extrem e diversity and specificity of
32
sequence recognition (O'Neill et al., 1997). Hence, restriction-m odification is
reg ard ed as being able to slow the rate at w hich DNA transm ission occurs
rather than stop it (Matic et al., 1996). Bacteria probably develop m ore long
term p ro tectio n from phage infection by sp o n tan eo u s m u ta tio n of genes
encoding phage receptor sites (Korona et al., 1993).
A n o th er p o ten tial role assigned to bacterial R-M system s is th at
restriction potentiates genetic recom bination in n atural populations of bacteria
by cleaving entrant DNA molecules into fragm ents th at have recom binogenic
properties (Wilson and M urray, 1991; K orona and Levin, 1993).
M ost DNA
fragm ents generated by restriction enzym e cleavage in vivo w ill be subject to
degradation by the RecBCD nuclease [exonuclease V] (Dixon and Kowalczyski,
1993). H ow ever, recom bination is possible if these fragm ents contain chi sites
(x), w hich are short specific 8-bp sequences able to stim ulate the recom bination
p ro p erties of the RecBCD enzym e.
F urtherm ore, ex p erim en ts have been
conducted to show that recom bination of fragm ents generated by restriction
can take place in the absence of RecBCD, rely in g c o m p letely on the
recom bination p ath w ay s of either Red of phage X or RecE of the cryptic
prophage rac. H ow ever, these results are not indicative of events in nature.
R ecom bination during interspecific DNA tran sm issio n is unlikely as
the extent and degree of sequence divergence that exists will not only delim it
the activity of enzym es that control the initial stage of recom bination, strand
separation, b u t recom bination will also be inhibited by the m ism atch-repair
system (Matic et al., 1996).
Nevertheless, 0.1-1% of n atu ral populations of E.
coli carry m utations in their m ism atch-repair system s.
E vidence to suggest
th at restriction-m odification m ay influence recom bination in E. coli is from
the mosaic patterns observed in the nucleotide sequences of trp operons of
n atu rally occurring strains of Escherichia coli (ECOR-collection) (M ilkm an,
1997; Matic et al., 1996).
A m ore recent role, originally assigned to type II R-M system s, is that
these paired R-M genes act as selfish sym bionts, w hich serve to force their
33
m aintenance on the host cell.
Plasm ids carrying type II R-M system s have
increased stability in E. coli and attem pts to displace the resident plasm id by
another th at does not carry the same R-M or M genes results in host cell death
(Naito et al., 1995; K ulakauskas et al., 1995). Such data are consistent with the
'toxin-antidote' hypothesis, Where the restriction enzym e acts as the toxin and
the m ethylase as the antidote. Any cells that continue to divide after losing
the p lasm id are unable to protect them selves from attack by rem aining
restriction enzym e (Kusano et al., 1995). It is envisaged th at the ability of these
plasm id-borne type II R-M system s to act as selfish sym bionts probably
contributed to their evolution as gene pairs (Naito et al., 1995).
M utations in both hsdR and h s d M genes of type I R-M system s are easily
isolated w ithout detrim ental effects on the host cell.
Such findings suggest
that the 'toxin-antidote' hypothesis applied to type II R-M system s cannot be
applied to type I system s. In addition, the ability of the host cell to m odulate
restriction activity by type I enzymes also suggests that this particular type of RM system is not selfish in nature (O'Neill et al., 1997; section 1.5.3).
1.6
Collb Leading Region Genes and their Functions
As described in section 1.3.2, conjugative transfer of a plasm id starts at
oriT by specific cleavage of the nic site by the relaxase enzym e. A unique DNA
strand is released called the T-strand, which is transferred to the recipient cell
w ith a 5'-3' polarity (W ilkins and Lanka, 1993).
The o r iT is orientated such
that the transfer genes of the plasm id enter the recipient cell last (Howland and
W ilkins, 1988). W hether delayed transfer of the Tra genes to the recipient cell
reflects the need for th eir continued expression in the donor cell or their
delayed expression in the recipient is unknow n.
H ow ever, one possible
explanation is that their delayed transfer gives priority to entry of genes that
are expressed early in the recipient and prom ote establishm ent of the plasm id
in the new ly infected cell. Such genes are located w ithin the leading region of
34
the plasm id, which can be defined as the first segm ent of the plasm id to enter
the recipient cell during conjugation.
L eading region genes th at have been
identified on Collb include ssb, psiB and a r d A , the functions of w hich are
described in the following sections.
The leading regions of plasmid F and Collb are believed to be inessential
for conjugation as disruption of know n genes w ithin this sector result in only
a slight decrease in conjugation efficiency u n der laboratory conditions (Loh et
al., 1989; Jones et al.f 1992).
The length of the C ollb lead in g region is
unknow n. H ow ever, it is estim ated to extend 15 kb from the nic site of the
plasm id, although these num bers are purely arbitrary (Rees et al., 1987).
1.6.1
Single-stranded DNA-binding protein (SSB)
Single-stranded DNA-binding protein (SSB) found in E. coli is know n to
play an im portant role in DNA replication, recom bination an d repair, in
p a rticu la r m ism atch repair (Chase et al., 1983; Golub and Low, 1986).
SSB
proteins have a high affinity for single-stranded DNA and bind predom inantly
in a tetram eric form w ith no sequence specificity (H ow land et al., 1989). In
v i t r o studies w ith SSB have show n th at som e of the roles of the p ro tein
include i) p rev enting reassociation of unw ound DNA, ii) protecting ssD N A
from nucleases, iii) enhancing the processivity of D N A p olym erases, iv)
stabilisation and organisation of replication origins, and v) prom oting binding
of DNA polym erase to tem plate DNA (reviewed in M eyer and Laine, 1990).
Furtherm ore, in the presence of SSB, the helix-coil transition tem perature of
dsD N A is lowered enabling the DNA m olecule to m elt m ore easily (Williams
et al., 1983).
Collb and a n u m b er of other enterobacterial p lasm id s including F,
encode SSB p ro tein s w hich are very closely related in th eir am ino acid
composition to the E. coli counterpart (Chase et al., 1983; Golub and Low, 1985;
H ow land et al., 1989). 19 plasm ids from 12 incom patibility groups are know n
to carry ssb genes that can complement defects caused by an ssb-1 m utation in
35
the corresponding E. coli gene (Golub and Low, 1985; Golub and Low, 1986). In
ad d itio n , the ssb genes of these p lasm id s w ere found to share extensive
sequence hom ology w ith the ssb gene of plasm id F. These ssb genes w ere
found to be co-ordinately regulated w ith the plasm ids fertility genes (Golub
and Low, 1986). Such findings suggest th at the role of SSB d uring conjugation
is possibly to prevent drainage of the cellular counterpart d uring replication of
the com plem entary plasm id strand. H ow ever, m utations in plasm id ssb genes
have very little effect on the ability of the plasm id to form transconjugants
(Golub and Low, 1986; H ow land et al., 1989).
The Collb ssb gene m aps in the leading region of the plasm id 11 kb from
the oriT (see Fig. 1.1). The gene was originally isolated by its ability to rescue
the tem perature and UV sensitivity of E. coli chrom osom al ssb-1 m utant. In
addition, the gene has been show n to be hom ologous to the F ssb gene by cross­
hybridisation studies and sequence com parisons.
Both share 84% sequence
sim ilarity at the nucleotide sequence level and 83% at the predicted amino acid
level.
The am ino acid sequence of Collb SSB contains two signature m otifs
characteristic of sin g le-stra n d ed DNA b in d in g proteins.
O ne of these
signatures is the DN A binding motif that has been characterised for the E. coli
SSB protein, which is perfectly conserved in Collb SSB (H ow land et al., 1989).
1.6.2
Plasmid SOS inhibition (PsiB)
The product of the Collb psiB gene acts during conjugation to prevent
induction of the bacterial E. coli SOS response in recipient cells as a function of
its intracellular concentration (Jones et al., 1992). The SOS response is triggered
by certain conditions th at either cause dam age to DNA or interfere w ith the
process of DNA replication. Long-lived regions of single-stranded DNA that
are created during such dam age or those that exist near a stalled replication
fork result in activation of RecA. Activated RecA in the presence of co-factors
such as ATP cleaves the LexA transcriptional repressor and a num ber of phage
36
repressors, which leads to the induction of a diverse set of specialised genes
know n collectively as the SOS regulon (Walker, 1987).
O ne p o ssibility is th a t the SOS response is in d u ce d by ssD N A
transferring in conjugation or short tracts of ssDNA that are exposed w hen the
seco n d
stra n d
of the p lasm id
is g e n e ra te d
in the re c ip ie n t d u rin g
discontinuous lagging strand DNA synthesis (see section 1.3.2). Plasm id psiB
genes, therefore, m ay have evolved to perm it conjugative transfer in single­
stra n d e d form w ith o u t the additional com plication of in d u c in g the SOS
response and host physiology (Jones et ah, 1992). The PsiB p ro tein of IncFII
plasm id R6-5 has been show n to prevent induction of the SOS response by
in h ib itin g activ atio n of the RecA co-p ro tease ra th e r th a n p re v e n tin g
expression of genes associated with the SOS regulon (Bailone et al., 1988).
The Collb psiB gene w as identified through its cross-hybridisation to the
psiB gene detected on R6-5 (Bagdasarian et al., 1986; Jones et ah, 1992).
Collb
PsiB shares 85.4% and 84.6% identity to the corresponding p roteins of F and
R6-5, respectively (Jones et al., 1992).
T hrough cross-hybridisation stu d ies
conducted by Chilley and Wilkins (1995) it was found that plasm ids carrying
ssb genes more often than not also carry a psiB gene. Transposon m utagenesis
of plasm id ssb genes leads to the generation of a strong Psi+ phenotype, w hich
is presum ably the resu lt of the polar effects on transcription caused by the
antibiotic resistance gene prom oter present in the Tn insertion (Dutreix et al.,
1988; Jones et al., 1992). Such findings suggest that expression and location of
bo th ssb and p s iB are linked and that no transcriptional term in ato r exists
betw een the two (Jones et al., 1992).
1.6.3
Alleviation of restriction of DNA (ArdA)
The product of the Collb ardA gene acts as an anti-restriction protein,
w hich is active in alleviating restriction by three families of type I restriction
enzym es (Kotova et a l , 1988; Delver et al., 1991; Read et al., 1992). The A rdA
protein alleviates restriction mediated by type I restriction enzym es, possibly by
37
interfering w ith the functional integrity of the R-M enzym e complex.
The
ArdA protein of Collb is unable to alleviate the effects of restriction m ediated
by type II and type III enzymes (Read et al., 1992; Belogurov and Delver, 1995).
The ard A gene like ssb and psiB is also know n to have a counterpart in
the leading regions of plasm ids belonging to other Inc groups. H om ologues
h av e been identified in the lead in g reg io n of e n tero b acterial p lasm id s
belonging to the IncFV group, the B-Il-K set of the I com plex and the IncN
group. All ardA + plasm ids identified so far are enterobacterial plasm ids, w hich
m ay be significant as type I restriction enzym es are classically associated w ith
m em bers of the Enterobacteriaceae (Chilley and W ilkins, 1995). Furtherm ore,
these a r d A genes also have the same transcriptional orientation w ithin their
respective leading regions (Delver et al., 1991; Read et al., 1992; Belogurov et
al., 1993; Chilley and W ilkins, 1995), although Collb does n o t contain the
equivalent ardB antirestriction gene or the a r d K and ardR regulators th at are
found in the leading region of IncN plasm id pKM lOl (Belogurov et al., 1993).
The ArdA protein operates specifically during conjugation to protect the
im m igrant plasm id from destruction by type I restriction enzym es that m ight
be present in the recipient cell. The function of ArdA and its interaction w ith
type I restriction enzym es will be discussed further in section 1.7.
1.6.4
Zygotic induction of leading region genes
Detectable levels of expression of both ssb and psiB is only observed
w hen such genes are carried by plasm ids that are derepressed for transfer
functions or if the cell is exposed to SOS-inducing treatm ent (Golub and Low,
1986; Jones et al., 1992). Such findings suggest that these genes are un d er the
control of the plasm id's fertility inhibition system (H ow land et al., 1989).
W hen Collb is derepressed for transfer functions th ro u g h m utation of
the Fin system, ssb and psiB are expressed at low levels in an established strain.
Transcriptional activity of the leading region of naturally derepressed plasm id
F was also only detected at low levels, w hich suggests that genes contained
38
w ithin this region are only fully expressed under unique conditions (Cram et
al., 1984). During the process of conjugation, the products of these Collb genes
accum ulate in a transient b u rst in the conjugatively infected cell.
Such
enhanced expression was originally dem onstrated by a technique involving
the in sertio n of a prom oterless lacZ, operon fusion into p s i B and ss b on
ColVodrd.
Conjugation experim ents w ere perform ed u sin g the specially
constructed Collb::lacZ plasm ids and ssb or psiB gene product w as quantified by
m easuring the level of P-galactosidase specific activity. Shortly after initiation
of conjugation a 10-20 fold burst of expression of bo th s s b and p s i B w as
observed. Rapid expression starts w ithin 10 m inutes and begins to plateau out
at 20-30 m inutes (Jones et al., 1992).
To determ ine w hether enhanced expression of ssb and psiB occurs in
the recipient or donor cell a selective phage lysis technique w as used. D uring a
series of conjugation experim ents using either T6 bacteriophage sensitive or
resista n t donor or recipient cells, it w as found that accum ulation of (3galactosidase could be found only in recipient cells. Such results clearly show
that both psiB and ssb genes are induced upon entry to the recipient cell during
conjugation.
It w as these findings w hich led to the application of the term
zygotic induction (Jones et al., 1992). However, it should be noted th at the
term zygotic induction w as originally used to describe the in d u ctio n of X
p ro p h ag e d u rin g H fr m atin g experim ents, w hich resu lte d in lysis of F’
recipient cells (Hayes, 1968).
The ardA gene has not yet been show n to be zygotically induced during
conjugation.
H ow ever, indications th at a r d A expression is also enhanced
d u rin g conjugation comes from the findings that optim al alleviation of type I
restriction occurs during the process of conjugative transfer of C o U b d r d A rdA +
as opposed to transfer by transform ation (Read et al., 1992).
39
1.6.5
Hypotheses for zygotic induction
The potential roles of ssb, psiB and a r d A in the establishm ent of Collb
shortly after conjugative transfer are understood.
H ow ever, one intriguing
question that rem ains to be answ ered is how are these leading region genes
regulated so that they are expressed early and transiently in the recipient cell.
Several hypotheses have been generated, som e of w hich have been exam ined
ex p erim en tally (Jones et al., 1992; Roscoe, 1996).
The follow ing tw o lists
(1.6.5.1, 1.6.5.2) sum m arise these hypotheses.
1.6.5.1 Possible modes of positive regulation
i) Activation is by transfer-associated plasm id topology changes.
Expression of genes from certain types of p rom oter can be initiated
du rin g changes in localised topology of DNA, such that the angle of the -35
and -10 sites of the prom oter form an optim al alignm ent that is recognised by
RNA polym erase (W ang and Syvanen, 1992;
Roongta, 1990).
D uring the
process of conjugation, transfer of DNA to the recipient cell is associated w ith
significant changes in the topology of the plasm id.
H ow ever, treatm ent of
Collb containing cells w ith an inhibitor of DNA gyrase, coum erm ycin-A l,
w hich reduces the negative supercoiling density of the plasm id does not result
in any significant enhancem ent of ssbv.lacZ or psiB::lacZ expression (Roscoe,
1996).
ii) Activation occurs w hen genes are transferred in single-stranded form.
There is evidence th at during enterobacterial conjugation the plasm id
D N A is transferred to the recipient cell in single-stranded form (see section
1.3.2).
The usual action of RNA polym erase on single-stranded DNA is the
p ro d u ctio n of prim ers for DNA replication.
H ow ever, it is envisaged that
transcription of leading region genes m ight be initiated on the transferring
single plasm id-strand during conjugation.
iii) Activation is by a plasm id- or chrom osom al-encoded positive regulator.
40
Leading region gene expression m ay be controlled by a regulator that is
induced only during the process of conjugation.
Subjection of E. coli to any
stim uli that alter the physiological state of the cell often result in the induction
of a co-ordinated set of genes, know n collectively as a stress-response.
If
conjugation induces any such responses, the regulators or gene products could
act to control leading region gene expression. In E. coli the heat shock stress
response can be induced by stimuli other than heat.
H ow ever, conjugative
tran sfer of Collb does not stim ulate this stress response as show n by its
inability to induce a heat shock reporter construct in recipient cells during a 60
m inute conjugation (Roscoe, 1996).
1.6.5.2 Possible modes of negative regulation
i)
Transcription is regulated by a tran s -acting repressor th at accum ulates in
the new ly infected recipient cell.
It is proposed that such a repressor inhibits transcription of leading
reg io n genes in the new ly infected cell.
This hypothesis w as tested by
transferring a Collb plasm id that carries a prom oterless lacZ operon fusion in
psiB to a recipient cell harbouring a Collb plasm id that is defective in encoding
a functional exclusion system. However, the hypothesis w as ruled out because
u n d e r such conditions zygotic induction of psiB was still observed (Roscoe,
1996).
1.7
Restriction-Avoidance Strategies Employed by Plasmids
It is known that bacteriophages have evolved a num ber of strategies for
avoiding the effects of restriction during their life cycles. Exam ples of phage
anti-restriction m echanism s include i) inhibition of restriction enzym es, ii)
virus-coded DNA m odifying enzym es, iii) stim ulation of host m odification
functions, iv) in co rp o ratio n of u n u su al nucleotides into p hage DNA, V)
coinjection of p hage restriction inhibitory head pro tein s w ith DNA, vi)
d estru ctio n of restriction endonuclease co-factors and vii) counterselection
41
against restriction sites in phage (review ed in K ruger and Bickle, 1983 and
Bickle and Kruger, 1993).
P lasm id s that have been fo u n d to encode re stric tio n -av o id a n ce
m echanism s include m em bers of the Incl and IncF group of enterobacterial
plasm ids.
Restriction-avoidance is n o t a feature com m on to all transferring
p lasm id s.
For exam ple, the IncP p la sm id s are ex trem ely sensitive to
restriction. The lack of a restriction-evasion m echanism m ay explain w hy IncP
replicons are deficient in restriction enzym e recognition sites. In a sim ilar w ay
to som e phages, these plasm ids have presum ably been exposed d u rin g their
evolution to strong selection for the elim ination of restriction enzym e target
sequences by m utation and selection (Wilkins et al., 1996).
Plasmid Collb is rem arkably resistant to destruction by type I and type II
restrictio n enzym es d u rin g its tran sfer by conjugation, even th o u g h the
plasm id carries m ultiple enzyme target sites (Read et al., 1992). The resistance
of Collb to type I restriction enzyme involves a specialised plasm id-encoded
an tirestrictio n m echanism know n as A rdA (see section 1.6.3).
H ow A rdA
specifically acts to alleviate restriction by type I enzymes is not clear. H ow ever,
it seem s unlikely that the protein interacts w ith the recognition sites of the
enzym es as the protein is highly acidic and therefore unlikely to bind to DNA
(Delver et al., 1991). It seem s more likely that ArdA interferes w ith the type I
en zy m e com plex in a w ay th at p re v e n ts restric tio n a ctiv ity an d n o t
m ethylation (Belogurov and Delver, 1995). The A rdA protein of Collb and a
n u m b er of other plasm ids share a com m on am ino acid sequence m otif also
found in the T7 0.3 anti-restriction protein. The m otif is only nine am ino acid
residues in length and is believed to be the interaction site for anti-restriction
proteins and restriction endonucleases (Belogurov et al., 1993). The m otif also
shares similarity with a conserved sequence know n as the Argos repeat, w hich
is found in the DNA sequence specificity (S) polypeptide of type I enzym es.
These motifs in anti-restriction proteins m ight allow the protein to com pete
42
w ith the S subunit, w hich plays a role in the assem bly of the type I enzym e
com plex (Belogurov and Delver, 1995).
C ollb encodes another restric tio n -av o id a n ce m echanism th a t acts
indepen d en tly of ardA. The process becom es m anifest after several m inutes of
conjugation and alleviates restriction by both type I and type II enzym es during
second or subsequent rounds of transfer (Read et al., 1992).
The m olecular
basis of this second evasion process has yet to be elucidated.
1.8
Aims and Direction of this Study
The initial aim of my studies w as to further the u n d e rstan d in g of the
restriction-avoidance m echanism s encoded by Collb w hich are active against
type I and type II restriction enzymes and operates independently of ardA. The
first hypothesis tested is that transfer of m ultiple copies of C ollb d u rin g
co n ju g atio n overw helm s the restriction system in the rec ip ie n t cell by
su b strate saturation (Read et al., 1992). A second hypothesis is that m ultiple
transfers induce a change in the physiology of the recipient cell, w hich in turn
leads to a transient breakdow n of the restriction barrier. A third possibility is
th at Collb possesses a gene that encodes an anti-restriction function active
against both classes of restriction enzyme.
An experim ental priority in the testing of these h y p o th eses w as to
establish w hether Collb could confer cross-protection on a restriction-sensitive
p lasm id w hen co-transferred together.
The first tw o h y p o th eses p red ict
a llev iatio n of restriction by Collb in trans.
C onsequently, a restriction-
sen sitiv e plasm id th a t is co-transferred w ith Collb sh o u ld acquire som e
protection from destruction by restriction. For this purpose a genetic system
w as developed, w hich relied on m easuring Collb-m ediated rescue of plasm id
R751 (IncP(3) from destruction by EcoKI and EcoRI.
e x p erim e n ts w as th e discovery of a czs-acting
phenom enon.
43
One outcom e of these
re s tric tio n
p ro te c tio n
A n im p o rtan t experim ental tool w as the construction of a specific
m u tan t of Collb that was deleted of 14 bp from the nic region. The resulting
plasm id w as completely defective in self-transfer by conjugation, yet proficient
in form ing m ating-pairs and in expressing a full com plem ent of plasm id
p ro te in s .
This
m u ta n t h as
p ro v e d
in v a lu a b le
in
v a rio u s
g enetic
investigations.
Also examined was the classic A rdA system . The u n d erly in g question
w as w hether ar dA is transiently overexpressed (zygotically induced) in the
recipient cell during conjugation like other leading region genes such as psiB
and ssb. This question was addressed using the R751 system and the Collb nic
m u tan t to m easure A rdA -m ediated alleviation of restriction d u rin g different
stages of conjugation. Data obtained suggested that ardA is subject to zygotic
in d u ctio n .
To in vestigate p o ten tial reg u la to ry m ech an ism s g o v e rn in g
en h an c ed expression of leading reg ion genes d u rin g co n ju g atio n , the
n u cleo tid e sequence of 11.7 kb of the leading region w as determ in ed in a
co llab o ratio n w ith Dr. Steven Bates w orking in our laboratory.
Such an
approach was invaluable in the generation of a m odel of zygotic induction and
the developm ent of the concept that plasm ids carry 'early genes' expressed by
transcription of the incom ing single-stranded DNA.
44
Chapter Two
Materials and Methods
2.1
Plasmids and Bacterial Strains
The
g e n o ty p e s,
so u rces
an d
re le v a n t
re s tric tio n -m o d ific a tio n
phenotypes of bacterial strains and plasm ids used in this w ork are described in
Tables 2.1.1 and 2.1.2.
Bacterial strains used w ere all Escherichia coli K-12
derivatives. Plasm ids constructed during this w ork are described in Table 2.1.3.
For the p u rp o se of publication, some recom binant plasm ids w ere assigned
alternate nam es to those used in this thesis.
W here this has occurred, the
alternative nam e has been indicated in Table 2.1.3. Plasm id pHP45Q contains
an
o m eg a
(Q )
in te rs p o s o n ;
th is
2.0
kb
fra g m e n t
c o n ta in s
a
streptom ycin/spectom ycin resistance gene flanked by inverted repeats carrying
transcription and translation term ination signals and polylinkers (Prentki and
Krisch, 1984).
S pontaneous naladixic acid and rifam picin variants of strains GI65,
NM654 and NM816 are designated w ith the suffix N or R. All w ere used in
conjugation experim ents and are not show n in Table 2.1.1.
These resistant
strains w ere isolated by plating 1.0 ml of overnight culture, concentrated to 0.1
ml, onto n utrient agar plates containing either naladixic acid or rifam picin at
25 jag ml’1.
Plasmids R751 and pHP45Q and bacterial strain DL307 w ere gifts courtesy
of Peter Thorsted, C hris Thom as and D avid Leach, respectively.
Bacterial
strains NM654, NM816 and NM840 were kindly provided by N oreen M urray.
45
Table. 2.1.1 Escherichia coli Strains
S train
Description or genotype
Source or reference
D H 5a
F" f80A L a c Z A M I 5 r e c A l e n d A l
H anahan (1983)
g y r A 9 6 thi-1 h s d R 1 7
(rKi" m Ki+) s u p E 44 r e l A l
deoR A il a c Z Y A - a r g F )
U169
DL307
(FS1585)
GI65 (C600)
C600 recD1009 TetR
Stahl et al. (1986)
thr-1 leu-6 thi-1 l a c Y l f h u A 2 1
A rber and
Dussoix (1962)
M erryw eather
et a l (1986)
M akovets et al.
(1998)
N. M urray
(rKi+ m Ki+)
J0 8 (BW103)
d n a + leu deoB r p sL cir re cA l
NM654
C 6 0 0 A h s d R M (r^i u ik i)
NM 816
NM 840
C600AhsdR (rKf itiki+)
C600 g y r A 9 6 A h s d R M (rKf mKf)
W3110
Prototrophic (rKi+mKi+)
M akovets et al.
(1998)
Backman, (1972)
Table. 2.1.2 Plasmids
Plasm id
D escription
Source or reference
pLG221
Incll derepressed for transfer
C o l l b d r d l cib::Tn5 Km R
Laboratory stock
H ow land et al.
(1989)
pLG272
Collb cib::Tn5 KmR
H ow land et al.
(1989)
pLG292
C o l l b d r d l a r dA :: a ph A -l KmR
Read et al. (1992)
O ther plasm ids
pBR328
4.9 kb ApR CmR TcR
Soberon et al.
(1980)
Rees et al. (1987)
Incll plasm ids
Collbdrdl
pCRS3
pCRS4
pHP45Q
pBR328Q(ColIb oriT+ Sail 15.9 kb)
ApR CmR
pBR328Q(ColIb Sail 10.1 kb)
ApR CmR
4.3 kb ApRSmRSpR
pIC19H
pJH16
PACYC184n(£coRI m RI+) CmR
pLG290
pUCl9Q(ColIb ar dA + Sall-Pstl 2.7 kb)
NTP14
ApR
17 kb cea+ rR]+mRi+ A pR
pR R 2-l
pRR4
R751
pSBCPl
2.7 kb ApR
pRRlQ[ColIbdrdl E l (20.4 kb) + E16
(2kb)]A p+
pBR328Q(ColIb eex+EcoRl 3.4 kb)
ApR CmR
56 kb IncPP, Tn402/5090, T n 43 21Q
(RK2 terR, ter A , Bglll -3.8 kb)
Tcr TpR
pICl9HQ(ColIb ssb Pstl-Clal 1.1 kb)
A R
Ap
Rees (1986)
Prentkl and
Krisch (1984)
M arsh et al. (1984)
H eitm an et al.
(1989)
Read et al. (1992)
Sm ith et al.
(1976)
Roscoe (1996)
Roscoe (1996)
T horsted et al.
(1998)
Laboratory stock
pSBCP2
pSBSP2
pIC19HI2(ColIb Clal-Pstl 1.6 kb) A pR
pIC19Hn(ColIb psiB Pstl-Sall 1.6 kb)
R
AP
2 .7 k b A p R
Laboratory stock
Laboratory stock
a
pUC19
Y anisch-Perron
et a l (1985)
Table. 2.1.3 Plasmids constructed during this work
N am e
D escription
Published as
p N A l/p N A la
pN A 2
pUC19C2(ColIb or iT + nic+ Psfl 1.6 kb) ApR
pIC19HD(ColIb o r iT + nic+ Pstl-Clal l.lk b )
A R
Ap
pNA3
pIC19H£2(ColIb o r i T + rtic+ Sall-EcoRl 8.0 kb)
A R
Ap
pNA4
p N A 2 A n i c : : S p h l - K p n l A pR
pNA5
pNA2Anic::Kpnl-Sphl A pR
pNA6
pN A 7
pIC19HD(ColIb a r d A + Bglll-Sall 6.1 kb) A pR
pNA2Amc::EcoRI A pR
pNA8
pNA7Q(Anzc::omega intersposon EcoRI
2.0 kb) A pRSmRSpR
pIC19HQ(ColIb B g in - P s tl 0.62 kb) A pR
pIC19Hn(ColIb Pstl 2.0 kb) A pR
pLG2061
pLG221Anic::£J KmR SmRSpR
pLG2062
pLG292A nic::Q KmR SmRSpR
pIC19H£2(ColIb Ps tl 0.76 kb) A pR
pLG2063
pNA9
pNAlO
p N A ll
pNA 12
pNA13
pNA14
pNA15
pLG2059
pLG2060
N T P14fl(n intersposon Clal 2.0 kb) (rR]+mRj+)
A pR SmRSpR
pIC19H O (n intersposon Clal 2.0 kb)
A pR SmRSpR
pNA16
pBR328D(NTP14 Sall-Clal 9.7 kb) (r^'mRi")
A pR CmR
pNA17
pBR328D(NTP14 Sall-Clal 7 3 kb) (rRI+m Ki+)
A pR Cm R
P lasm id s pLG2059, pLG2060, pLG 2061, pLG2062, pL G 2063 are also described in A lthorpe et al. (1999).
Table 2.1.4 Oligonucleotide primers used during this work
Primer
Sequence (5’-3’)
Template
Reference
CCCAGTCACG ACGTT GTAAAACG
M13/pUC
GIBCOBRL
(1994)
M13/pUC Universal
Forward
M13/pUC Universal
Reverse
Primer B
CTGC ATA AG ACTATG AT GC
Primer C
Primer 5
Primer 6
Lead 1
Lead 2
Lead 3
Lead 33
Lead 331
Lead 332
Lead 333
Lead 334
Lead 335
Lead 4
Lead 44
Lead 43
Lead 432
Lead 443
Lead 433
Lead 431
Lead 434
Lead 5
Lead 55
Lead 6
Lead 66
Lead 7
Lead 77
Lead 771
Lead 772
Lead 8
Lead 88
Lead 881
Lead 882
GCGTATTCCTTGTCACCG
CGGAATTCCGTTTTCAGGCCATTATAGCC "
CGGAATTCCGGC A ATT GT AAT ACCGTCCC "
CAGCCAGGAAAGATGGCATCG
pNA9
//
CATCA ATT GTTGTTCAT ATCG ATGC
GGTACATCACCTTCCAGTAGCCG
pLG290
//
CCTTCTGCCGTCCACTTCTTCG
//
GACATCGGACCGTAGCGGCAGC
//
GACCGTGCAATAAAGGTGAAGG
//
GGCAGGCGGCG AAAA AGTCG
//
GAGGGACCGGGTGACCGC AGC
//
GATATCGCGGTCGTGCTCTGC
it
GCGTAAATCCGTCGCACAGACG
CTCCGCTTTTACCCGGCCATGC
a
CCACTGAAAGCACTGAAGAGGTGC
//
CGCTCTATTTTGACT ATG AGG
//
CATCGCCGAAGCCT GGTTTGACC
//
GGACAGCTGCCCCGTGACGTGG
CGACAGGCAGCTGCTGGCGCACC
//
GTCTCTACCCTCCAACTCCC
GGAACT GCATCTTCCTGCGG
pNA13
//
CCGCTGGTTGAT AT CACT GTCG
//
CGTATAAACATAACCATCTTCACCC
//
CTTCTGCTCACTGC AGGTCGACG
GCACAAATCTGTCAAGCTGACC
pNAlO
//
CGTGCCATGTTCTCTGTGTCACG
//
GTAAGGCCACTGCGCCTGATGG
//
CAAT GTGAT GA ATCAG ACTTTACC
//
CGTATCCGTCATCAGGCGGACC
//
GTTTTGTGGCTGGTACATCTCTCC
//
CTTTTTCA.AAGGTGTTTTA.TGA.CC
//
GCATTTTGCCGGGCCTTTTGG
AGCGGATAACAATTTCACACAGG
//
pNA2
//
Althorpe et al.,
(1999)
//
//
//
Chapter 7
//
//
//
//
//
//
//
//
//
//
tt
//
//
//
//
//
//
//
//
//
//
//
//
//
//
//
//
//
2.2
Media and Chemicals
2 .2.1
Media
U nless otherw ise stated, bacterial strain s w ere ro u tin ely grow n in
nutrient broth (NB) and on nutrient agar (NA) plates. Suspensions of bacterial
strains w ere m ade in phosphate buffer (PB).
B acteriophage X w as alw ays
resuspended and diluted in X buffer (^.B). For long term storage of strains,
overnight cultures of bacteria were streaked onto NA p lates supplem ented
w ith the appropriate antibacterial agent and incubated at 37°C for 12 hours.
Frozen stocks w ere m ade by resuspending the bacteria in NB + 20% glycerol,
w hich were then stored in vials at -20°C. Frozen cultures m ade in this w ay
have a shelf-life of -10 years. All m edia and chem icals w ere resu spended in
distilled water unless indicated otherwise.
Nutrient agar (NA)
Oxoid No.2 nutrient broth
25 g I"1
Bio-gene agar
16 g I’1
Luria agar (LA)
Oxoid tryptone
10 g I_1
Oxoid yeast extract
5 g 1"
NaCl
Bio-gene agar
Phosphate buffer (PB)
k h 2p o 4
N aH P04
N aCl
M gS 04.7FI20
46
X buffer (XB)
Tris-HCl
0.06 M
M gS 04.7H20
2.5 g I”1
G elatin
0.05 g I'1
p H 7.2
Soft nutrient agar (SNA)
BBL trypticase
10 g F1
N aC l
5 g I'1
Bio-gene agar
6.5 g I"1
Bottom layer agar (BLA)
BBL trypticase
10 g F1
N aC l
5 g I'1
Bio-gene agar
10 g F
-I
M inimal media (MM)
M inim al salts*
100 ml F1
20% glucose
50 ml F1
0.1% Thiamine HC1
1 ml F1
Ca-Mg salts**
10 ml F1
Bio-gene agar
16.2 g F1
*Minimal salts:
N a 2H P 0 4 (anhydrous) 79 g F1, KH2P 0 4 (anhydrous) 30 g F1, NaCl 5 g F1, N H 4C1
10 g F1.
** Ca-Mg salts:
CaCl2, 1.47 g F1 (0.01M), M gS04.7H20 4.6 g F1 (0.1M).
Thiamine HC1 w as prepared in distilled w ater, filter sterilised and stored at 4°C.
47
2.2.2
A ntibacterial agents
Unless otherwise stated, antibacterial agents were ad d ed to media at the
follow ing concentrations: ampicillin (Ap), 100 pg ml" ; chloram phenicol (Cm),
25
1
jllg
1
1
ml" ; kanam ycin (Km), 25 p g m l' ; naladixic acid (Nal), 25 pg ml" ;
rifam picin (Rif), 25 pg m l'1; streptom ycin (Sm), 50 pg ml"1; spectom ycin (Sp), 50
1
_1
pg m l’ and tetracycline (Tc), 7.5 pg ml" .
Chemicals used for a-com plem entation tests (blue an d w hite colony
selection) were added to LA Ap plates at the following concentrations; X-gal, 40
pg ml"1 and IPTG, 0.1 mM ml"1 (Sambrook et al., 1989). Stock solutions of X-gal
w ere always m ade up in dim ethylform am ide.
2.2.3
11.1 xPCR buffer
Tris-HCl pH 8.8
476 mM m l'1
(NH4)2S04
121.9 mM ml'
MgCl2
49 mM ml"1
2-m ercaptoethanol (100%)
5 pi ml"1
EDTA pH 8.0
50 pM ml"1
dATP
11.1 mM ml"1
dCTP
11.1 mM ml"1
dGTP
11.1 mM ml"1
dTTP
11.1 mM ml"1
BSA (DNAse free)
1.25 pg ml"1
2.3
Phenotypic Characterisation of Bacterial Strains
2.3.1
Colicin production
Strains to be tested for colicin production w ere grow n overnight in NB.
O ne pi of culture w as spotted onto a NA plate w hich w as incubated for a
fu rth er 12 hours at 37°C.
The bacteria w ere then killed by exposure to
ch lo ro fo rm v a p o u r for 10 m inutes, allo w in g a n o th e r 15 m in u tes for
ev ap o ratio n of the vapour.
The p late w as overlaid w ith 3.5 m l of SNA
48
containing 0.1 m l of a 1:20 dilution of an overnight culture of colicin sensitive
cells. After 5 hours incubation at 37°C, colicin-producing strains w ere indicated
by a clear zone of killing of the indicator strain around the test strain.
2.3.2
recA mutants
To test strains for the carriage of a r e c A m u tatio n , the bacteria w ere
streak ed onto N A plates and treated w ith a series of tim ed exposures to
•I
“2
shortw ave UV light (0.5 J sec’ m’ ). The grow th of the test strain that had been
irradiated for 0, 10, 15, 30 and 60 seconds was com pared to th at of a wild type
strain, GI65 and a recA strain, J08. RecA m utants have increased sensitivity to
UV irradiation.
2.3.3
recD mutants
The RecD p henotype of DL307 w as tested usin g the bacteriophage
U\4M5885(%0 Red' G am ’) and XMM5659(%+ R ed’ Gam’) supplied as gifts from
D avid Leach. The screen relies on the ability of both the %° and %+ phage to
form indistinguishable large plaques on recD strains w hilst on rec+ strains, the
%° phage form sm all plaques and the %+ phage large plaques (Russel et al., 1989)
2.3.4
Sensitivity to bacteriophage
Bacterial strains w ere routinely tested for their ability to restrict a
virulent strain of bacteriophage X. Overnight cultures of strains to be tested
w ere diluted in NB and 10 mM M gS04 to an A60o absorbance value of 0.05. The
bacteria were then grow n at 37°C w ith vigorous shaking to an A600 of 0.5 (m id­
exponential phase). The bacteria were resuspended in 3 m l of SNA (~2 x 10s
cells) and used to overlay a BLA plate. Xvir.0, propagated on NM654, Xvir.K on
GI65 and Xvir.Rl on GI65(NTP14) w ere used, d ep en d in g on the restriction
phenotype of the strain being tested. The phage w ere diluted in XB and 10 pi
spotted onto the top layer of the BLA plate. The phage suspension was allowed
to adsorb into the agar for 20 m inutes and the plate then incubated at 37°C,
49
overnight. Com parison of the efficiency of plating (e.o.p) of the phage on the
test strain to that of a control strain allow ed the restriction phenotype to be
d eterm in ed .
2.4
Strain Manipulations
2.4.1
Bacterial conjugation
Overnight cultures were diluted in NB to an
A 60o
of 0.05 using a Bausch
and Lomb 501 spectrophotom eter and grow n w ith vigorous shaking at 37°C to
8
1
an A60o of 0.5 (2 x 10 cells ml" ).
C onjugation m ix tu res co n tain ed equal
volum es of donor and recipient bacteria.
All in te rru p te d filter m atings
involved filtering 0.5 m l of m ating m ixture onto a 25 m m cellulose acetate
filter (W hatm an® , pore size 0.45 Jim) for each tim e point, w hich w as then
placed on the surface of a prew arm ed n u trient agar plate for the conjugation
period. Bacteria w ere released from each filter by vigorous blending in 5 ml
phosphate buffer. The titre of the transconjugants w ere determ ined by serial
d ilution and 100 jil sam ples spread onto n u trien t agar p lates containing the
appropriate antibacterial agent for selection. For liquid m atings equal am ounts
of donor and recipients were added to a 200 ml conical flask and incubated at
37°C in a w ater bath w ith gentle rotation (49 rpm ).
A 0.3 ml sam ple w as
recovered and added to 2.7 ml of PB in a glass tube. The tube w as agitated
violently in a blender for 10 seconds to term inate conjugation.
A gain, the
titres of transconjugants w ere determ ined in the sam e w ay as for filter
m atings.
2.4.2
Transformation of bacterial strains
The m ethod u sed to transform b acterial cells w ith DNA w as by a
chemical m ethod based on that of Cohen et al. (1972).
Com petent cells w ere m ade by diluting overnight cultures of bacteria in
NB to an
o
A 60o
of 0.05 and grown with vigorous shaking at 37 C to an
of 0.5 (m id-exponential phase).
A 60o
value
The cells w ere pelleted at 4°C in an MSE
50
M icrocentaur and then w ashed twice by centrifugation in 5 ml of ice cold 0.1 M
C a C l2. The pellet was finally resuspended in 1 ml of 0.1 M CaCl2 giving a
concentration of approxim ately 2 x 109 cells m l'1. C om petent cells m ade this
w ay can be stored for up to 24 hours at 4°C.
1-5 p g of DNA was added to 250 p i of com petent cells in a sterile
E ppendorf tube. Incubation of the cells for 1 h o u r on ice w as followed by a 4
m inute heat-shock at 42°C. The cells w ere then returned to ice for a further 2
m inutes before being transferred to 5 m l of p rew arm ed NB.
After 1 ho u r
incubation at 37°C w ith vigorous shaking the cells w ere pelleted, resuspended
in PB, and diluted to give single colonies w hen sam ples w ere spread onto
selective NA plates.
2.4.3
Bacteriophage propagation
The bacteriophage to be p ropagated w as plated on the a p p ro p riate
bacterial strain at a titre that form ed a num ber of p laq u es after overnight
grow th. The SNA overlay was scraped from the BLA plate and transferred to a
Sorvall centrifuge tube. A ddition of 1.5 ml ^.B and 0.5 m l of chloroform to the
tube w as followed by the mix being thoroughly m ashed w ith a sterile spatula.
The tube was allow ed to stand for 30 m inutes at 37°C before being centrifuged
at 8000 g in a Sorvall SS-34 fixed angle rotor for 5 m inutes. The supernatant
w as rem oved to a sterile test-tube containing 0.1 ml of chloroform , vortexed,
then incubated for a fu rth er 15-20 m inutes at 37°C. The aqueous layer was
rem oved to a screw cap tube and the phage suspension stored at 4°C.
2.4.4
Transposon insertion mutagenesis
Tn5 m utants w ere obtained in Escherichia coli strain W3110 (W inans
and Walker, 1983).
51
2.5
DNA Manipulations
2.5.1
Small scale plasmid DNA isolation
For isolation of high q u ality D N A sam ples for use in sensitive
applications such as DNA sequencing, cloning or PCR, a Q IA prep spin m inikit
(Qiagen) w as used according to the m anufacturers instructions.
For standard small scale preparations of plasm id D N A an alkaline lysis
m ethod based on that of Birmboim and Doly (1979) w as used.
1.5 ml of an overnight culture of plasm id containing cells, grow n w ith
appropriate antibiotic selection, were centrifuged at 13,000 g for 3 m inutes in a
MSE M icrocentaur. The pellet was resuspended in 100 jll1 of lysis buffer (25
mM Tris-HCl, pH 8.0; 10 mM EDTA, 50 mM sucrose) and incubated on ice for 5
m inutes.
A ddition of 200 pi of alkaline SDS (0.2 M N aO H ; 1 % Sodium
dodecyl sulphate) to the cells was followed by gentle m ixing and 5 m inutes
incubation on ice. 150 pi of 5 M potassium acetate (pH 4.8) w as then added to
the tube, the contents mixed carefully before a final 5 m in u te incubation
period on ice.
The lysate was centrifuged for 10 m inutes to rem ove the cell debris and
the su p ern atan t transferred to a clean E ppendorf tube containing 400 pi of a
p h e n o l/c h lo ro fo rm m ix tu re [50% phenol, 48% ch lo ro fo rm , 2% isoam yl
alcohol] (Sambrook et al., 1989). After mixing, the tube w as centrifuged for 3
m inutes, the upper phase was removed and transferred to an equal volum e of
iso-propanol.
The m ixture was incubated on ice for 15 m in u tes and then
centrifuged for 30 m inutes to pellet the DNA. The su p ern atan t w as discarded
an d 500 pi of 70 % ethanol was added to w ash the pellet.
The tube w as
centrifuged for 5 m inutes and the pellet air dried before being resuspended in
20 pi distilled water. The concentrations of DNA isolated by this m ethod were
estim ated by electrophoresis on an agarose gel along side a control DNA
sam ple of know n concentration. RNA w as rem oved from DNA sam ples by
o
incubating at 37 C for 1 hour in the presence of RNAseA (0.25 pg).
52
2.5.2
Large scale plasmid DNA isolation
All large scale p rep aratio n s of plasm id DNA w ere carried out using
Q iagen mini kits according to the instructions.
2.5.3
Analysis of the concentration and purity of DNA sam ples
DNA yields and p u rity w ere d eterm in ed from the A260/ A 280 values
m easured in a Hitachi U-2000 spectrophotom eter.
DNA concentrations were
calculated where: -50 pg m l’1 of double-stranded DNA, - 40 jig m l'1 of single­
stran d ed DNA or RNA and -20 jig ml"1 of sin g le-stran d ed oligonucleotide
have an A260 value of 1. The purity of DNA sam ples w as confirm ed by the
A 260/ A 2so values of the sam ple having a ratio of 1.8 to 2.0 (Sam brook et al.,
1989).
2.5.4
Restriction enzyme analysis of DNA
R estriction en donuclease enzym es, su p p lied by GIBCOBRL, w ere
ro u tin ely used to analyse DNA.
C onditions and reaction buffers used in
digests w ere as recom m ended by the m anufacturers. Reactions w ere generally
carried out in a total reaction volume of 20 pi consisting of restriction enzym e,
1 x reaction buffer, -1 pg of DNA and if necessary 0.25 pg of RNAseA.
Samples, to be analysed by gel electrophoresis, w ere m ixed w ith 2/10
loading dye (5 mM Tris-H Cl (pH 7.5), 100 m g ml"1 glycerol, 0.01 m g ml"1
brom ophenol blue). Restriction fragm ents w ere separated on 0.6-1.0% (w /v )
Seakem HGT agarose (FMC Corp.) horizontal gels in TAE buffer (40 mM Trisacetate (pH 7.4), 1 m M EDTA) containing ethidium brom ide (10 pg m l’1), at 20100 volts for 2-8 h o u rs.
DNA fragm ents w ere v isu a lise d on a short
w avelength UV transillum inator and p h o to g rap h ed using either a Polaroid
MP4 land camera w ith 15 seconds exposure or a UV visual analyser (Sony
im agestore 5000, v e rsio n 7.2).
The sizes of the D N A frag m en ts w ere
53
determ ined by com parisons w ith X H i n d Ill m olecular w eight m arkers (23.13,
9.4, 6.56, 4.36, 2.32,2.03, 0.56 kb).
2.5.5
Isolation of DNA restriction fragments
All DNA bands w ere cut w ith a scalpel from a 0.8% Seakem HGT
agarose gel (FMC Corp.) and transferred to an Eppendorf tube. Purification of
the DNA fragm ents from the agarose w as achieved u sin g a QIAEX II Gel
extraction kit (Qiagen) according to the m anufacturers instructions. The yield
and purity of DNA isolated was calculated as described in section 2.5.3.
2.5.6
Dephosphorylation of DNA fragments
To prevent re-ligation of single-stranded 5' p ro tru d in g ends created by
som e restriction enzym es, the 5' p h o sp h ate resid u es of the D N A w ere
rem o v ed by treatm en t w ith calf intestinal alkaline p h o sp h a ta s e (CIAPP h arm acia B iotech Ltd.) according to the m a n u fa c tu re rs in stru c tio n s.
Rem oval of the CIAP enzym e w as by phenol : chloroform extraction and
isolation of the DNA was by ethanol precipitation.
2.5.7
Ligation of DNA fragments
Vector and p lasm id DNA to be ligated w ere d ig e ste d w ith the
appropriate restriction enzymes. The corresponding DNA fragm ents from the
d ig estio n w ere iso lated from an agarose gel after se p a ra tio n by gel
electrophoresis (section 2.5.5). Ligations w ere carried out in a total reaction
volum e of 20 pi including 5 units of T4 DNA ligase an d T4 ligation buffer
(GIBCOBRL). The concentration of vector: insert DNA w as adjusted so th at a
ratio of 1 to 3 was achieved. The ligation reaction was incubated overnight at
room tem perature.
For blunt-end ligations the same conditions w ere used
except the units of T4 DNA ligase enzym e w as increased to 25 per reaction and
the vector: insert DNA ratio was changed to 1 to 8.
54
2.5.8
Primers
Oligonucleotide primers w ere m ade by the PNACL facility, University of
Leicester, using an A pplied Biosystems 394-8 synthesiser. Prim ers arrived in a
35%
am m onia solution and w ere precipitated on ice for
of
M N H 4 C 2H 3O 2 (pH 7.0) and 3 volum es of ethanol.
3
2
h o u rs in
1
volum e
The prim ers w ere
pelleted by centrifugation in a MSE M icrocentaur for 30 m inutes and w ashed
in 70 % ethanol, dried and dissolved in distilled H 2O. The concentrations of
single-stranded oligonucleotide w ere calculated as described in section 2.5.3.
The num ber of pico moles of prim er w ere calculated and in general 20 pm ol
m l ' 1 of prim er used in PCR reactions and 3.2 pm ol m l ’1 u se d in DNA
sequencing reactions.
2.5.9
DNA sequencing reactions
All DNA sequencing reactions were carried out using the ABI PRISM™
D ye T erm inator cycle sequencing read y reaction kit acco rd in g to th e
m anufacturers instructions.
Samples w ere analysed by the PNACL facility,
Leicester University, on a PE-ABI 377 autom ated DNA sequencer. Sequence
data obtained was th en analysed using the abi (A pplied B iosystem s Inc.)
sequence analysis program "FACTURA", version
1 .2 .
Further analysis of the sequence data w as carried out using the Genetics
C om puter Group (GCG) W isconsin Package Suite of program s (version 9.1).
FASTA (Pearson and Lipm an, 1988) and BLAST (Altschul et al., 1990) searches
w ere carried out th ro u g h the European Bioinform atics In stitu te site on the
W orld Wide Web (h t tp : / /w w w .ebi.ac.uk).
2.6
Standard and inverse PCR
Primers used for PCR reactions are as described in section 2.5.8. All PCR-
amplifications were carried out in a total reaction volum e of 50 pi containing,
5 jil of 11.1 x PCR buffer; 50 ng of tem plate DNA; 20 pm ol ml"1 of each prim er
and 5 units of Taq DNA polym erase (Advanced Biotechnologies Ltd.) or w hen
the PCR p roduct was to be used in further applications, 5 units of the proof­
reading polym erase BIO X-Act™ (Bioline (UK) Ltd) w as used.
w ere carried out in a hybaid om nigene PCR machine.
All reactions
Exam ple program s
include: 95°C-30 sec (Hot start), 1 cycle; 95 C-45 sec, 49-60 C-30 secs, 72 C - 1 m in
/ kb amplified, 20-35 cycles; 72 C - 1 m in / 1 kb, 1 cycle.
2.6.1
Optimisation of the inverse-PCR protocol for am plification of template
pNA2 using primer 5 and primer 6
The first step involved establishing the optim al tem p eratu re at w hich
prim er 5 and prim er 6 anneal to tem plate pNA2. Two sets of 25 cycle PCRam plifications w ere set up involving reactions w ith prim er 5 an d universal
forw ard (UF) and w ith prim er 6 and universal reverse (UR). The annealing
sites for each of these prim ers are indicated on the genetic m ap of pN A 2
presented in Fig. 4.3 (A). A range of annealing tem peratures (49-56°C) w ere
tested and the resulting DNA fragm ents produced in each reaction exam ined
by agarose gel electrophoresis.
H igh annealing tem p eratu res red u ce the
am ount of non-specific binding of prim ers to their tem plate w hich in tu rn
increases the am ount of specific DNA product yielded (Saiki, 1989). Prim er 5
and prim er 6 w ere inferred to have an optim al annealing tem perature of 53°C
as only the desired DNA p ro d u ct w as detected in each reaction at this
tem perature (Fig. 4.3, B lane num bers 3 and 4).
Further optim isation of the PCR protocol involved exam ining the tim e
req u ired for both p rim er 5 and prim er 6 to be fully extended by the T a q
polym erase enzym e and result in the am plification of the 3.8 kb pN A 2
tem plate.
It is generally accepted that one m inute is the m axim um tim e
required for Taq polym erase to extend 1 kb of DNA (Saiki, 1989). Based on this
principle, a 35 cycle PCR-amplification of pNA2 was set up w ith prim er 5 and
prim er 6, allowing 4 m inutes extension time. The extension p roduct produced
56
by this reaction was analysed by agarose gel electrophoresis, the result of w hich
is presented in Fig. 4.3 (B), lane n um ber 5.
These findings indicate th a t 4
m in u te s is ad eq u a te tim e for th e am p lific atio n of 3.8 kb of D N A .
57
Chapter Three
Genetic Analysis of a Plasmid-Mediated Restriction Evasion
Mechanism
3.1
Introduction
This chapter describes a series of genetic experim ents aim ed at analysing
the m echanism em ployed by ColJbdrd d u rin g conjugation, w hich enables the
plasm id to avoid destruction by two different classes of restriction enzym e.
C o llb drd is rem arkably resistant to destruction by type I and type II
restrictio n enzym es du rin g its transfer by conjugation, even th o u g h th e
plasm id carries m ultiple restriction enzym e target sites [~7 EcoKI sites; 20 EcoRI
sites] (Read et ah, 1992; Wilkins et ah, 1996). Such resistance is no t a feature
com m on to all transferring plasm ids.
For exam ple, IncP p lasm id s are
extrem ely sensitive to these enzymes during their transfer, despite a distinct
lack of restriction enzym e recognition sites in the IncP replicon [R751: 12 EcoKI
sites; 5 EcoRI sites] (R751 EMBL accession num ber U67194). C ollb's resistance to
ty p e I enzym es involves a specialised plasm id encoded a n ti-restrictio n
m echanism know n as ArdA. This system is incapable of alleviating restriction
by type II enzymes (Delver et ah, 1991; Read et ah, 1992). Interestingly, after the
a r d A gene has been insertionally inactivated, ColJbdrd still displays m arked
resistance to type I and type II restriction enzym es during its transfer (Read et
ah, 1992). Evidence suggesting a second flnE4-independent restriction evasion
process encoded by Collb has been provided by Read et al. (1992). This process
becom es m anifest after several m in u te s of conjugation an d allev iates
restric tio n of C ollb d r d by type I and type II enzym es d u rin g second or
subsequent rounds of transfer.
The m olecular basis of this second evasion
process has yet to be elucidated.
58
O ne hypothesis proposed by Read et al. (1992) to explain this second
restriction-avoidance system of ColJb dr d is that transfer of m ultiple copies of
the p lasm id m ay overwhelm the restriction enzym es in the recipient cell by
substrate saturation. A second hypothesis is that m ultiple transfers of ColJbdrd
induce a change in the physiology of the recipient cell, w hich in tu rn leads to a
tran sie n t breakdow n of the restriction barrier.
A nother possibility is th at
C ollb d r d possesses a gene(s) that encodes an anti-restriction function active
against both classes of restriction enzyme. In all cases, the expected phenotype
w ould be alleviation of restriction allow ing the next round of plasm id transfer
to be successful.
Four independent yet related conjugation experim ents are described in
this chapter, which are all based on exam ining w hether plasm id ColJbdrd can
confer cross-protection on IncPp plasm id R751 from destruction by type I and
type II restriction enzymes.
To dem onstrate the relative resistance of ColJbdrd
to th ese enzym es d u rin g conjugation the first experim ent involved a re ­
exam ination of the effects of type I and type II restriction on the transm ission
of plasm ids R751 and ColJbdrd. The second experim ent analysed the effect of
co-transferring R751 w ith ColJbdrd from the same donor strain to a restricting
recipient.
T hird, the effect of tran sferrin g unm odified R751 DNA to a
restricting recipient harbouring ColJbdrd w as explored. Finally, Collb w ild type
and the cloned Collb exclusion genes (eex ) w ere utilised to investigate w hether
expression of the plasm ids restriction-evasion m echanism is triggered by the
act of Collb transfer.
3.2
Results and Discussion
3.2.1
Effects of restriction on the conjugative transmission of plasm ids R751
and Collb drd
To dem onstrate that ColJbdrd encodes an ardA -independent restriction
evasion m echanism , the effects of restriction on the conjugative transm ission
of unm odified R751 and ColJbdrd w ere exam ined. The stan d ard experim ent
59
involved an interrupted m ating of a donor strain harbouring R751 or Collb drd
and a restricting recipient strain.
All conjugations w ere done on filters as
plasm id R751 specifies only a surface obligatory m ating system. The effects of
restriction on the transm ission of each plasm id w as m onitored by com paring
the n u m b er of R751 or ColJbdrd transconjugants produced in the restricting
recipients to those produced in the non-restricting counterpart.
To sim plify
the genetic selections, a rifam picin-resistant (RifR) donor strain and a naladixic
acid-resistant (NalR) recipient strain w ere used. One advantage of using a N alR
recipient strain is th at naladixic acid inhibits conjugative DNA transfer by
sensitive donor cells. Therefore, any additional conjugations that m ight occur
on the surface of the NA plates are prevented by the addition of Nal.
The donors and recipients used in each m ating experim ent are described
w ith in the figure legends.
The R751 plasm id used carries tw o selectable
antibiotic resistance genes one of which confers resistance to tetracycline (Tc ),
the o th er trim eth o p rin (TpR). Col Jb dr d plasm ids used w ere pLG221 and
pLG292 b o th of w hich confer resistance to kanam ycin (KmR) th ro u g h the
carriage of a Tn5 insertion in the cib (colicin lb) locus of pLG221 and a nontran sp o sab le Tn903 a p h A - 1 insertion in the a rd A gene of pLG292 (Rees et al.,
1987; Read et a l , 1992).
The tw o R-M system s chosen for stu d y w ere EcoKI and EcoRI as
exam ples of type I and type II systems, respectively.
The type I system is
encoded by the E. coli K-12 chromosome and the type II system is encoded by
the n atu ral ColEl-like plasm id NTP14 (Arber and Dussoix, 1962; Sm ith et a l ,
1976). Both these R-M system s were originally isolated in strains of Escherichia
coli and are therefore presum ed to be native to the Enterobacteriaceae family.
Therefore, any plasm id w hose transfer range overlaps this family of bacteria is
likely to encounter these R-M systems frequently.
The results of the m ating experim ents are presented in Fig. 3.1 and Fig.
3.2. It is noted that data in Fig. 3.2 (A and B) were obtained by repeating p art of
the w o rk d escrib ed by Read et a l (1992), w ith the exception th at the
60
Fig.
3.1.
K inetics o f transm ission of u n m od ified R751 to recipient cells
specifying EcoRI or EcoKI.
(A) R751 tran sco n ju g an ts from conjugations of GI65R(R751) d o n o r cells and
e ith e r
re c ip ie n ts
G I65N
G I 6 5 N ( N T P 1 4 ) ( • ) . (B )
(O, c o n tro l) o r E coR I
r e s t r i c ti n g
R751
fro m
tra n s c o n ju g a n ts
re c ip ie n ts
c o n ju g a tio n s
of
NM654R(R751) d o n o r cells and either recipient cells N M 816N (□ , control) or
EcoKI restricting recipients GI65N (■).
p la te s co n ta in in g N a l a n d Tc.
ex p erim en ts.
T ransconjugants w e re selected on NA
D ata are th e m e a n v a lu e s fro m th ree
Fig. 3.1
Log^g transconjugants per ml
EcoRI
6-
4-
0
10
20
30
40
Time (min)
Log^o transconjugants per ml
EcoKI
0
10
20
Time (min)
30
40
Fig. 3.2. K inetics of transm ission of unm odified pLG221 (Ard+) and pLG292
(Ard") to recipient cells specifying EcoRI or EcoKI.
(A) pLG221 transco n ju g an ts from conjugations of GI65R(pLG221) d onor cells
an d either recipient cells GI65N ( O , control) or EcoRI re s tric tin g recip ien t
G I65N (N TP14) ( • ) . (B) pLG221 transconjugants from NM 654R(pLG221) donor
cells an d e ith er rec ip ie n t cells N M 816N ( O , control) o r EcoKI re stric tin g
recip ien t GI65N ( • ) . pLG292 tran sco n ju g an ts from NM 654R(pLG292) d o n o r
cells an d e ith e r re c ip ie n t cells N M 8 1 6 N (D , control) or EcoKI re s tric tin g
recip ien t GI65N (■). T ransconjugants w ere selected o n N A p lates containing
N al and Km. D ata are the m ean values of three experm ients
Fig. 3.2
k ° 8 l 0 transconjugants per ml
EcoRI
4-
0
10
20
30
40
30
40
Time (min)
Logio transconjugants per ml
EcoKI
6
-
4-
10
20
Time (min)
conjugations w ere perform ed on the surface of filters rather than in liquid. In
a d d itio n , W ilkins et al. (1996) has described the effects of type II restriction
(EcoRI) on the transm ission of R751. H ow ever, the data presented in Fig. 3.1
(A) are m ore com prehensive as they describe the effects of type II restriction on
R751 transm ission at intervals over a 40 m inute period.
T ransm ission of R751 w as considerably m ore sensitive to restriction
th an ColJbdrd. After 40 m inutes, transm ission of R751 w as reduced 10,000-fold
by EcoRI restricting recipients and 100-fold by EcoKI restricting recipients (Fig.
3.1 A and B). In contrast, productive transfer of pLG221 to the EcoRI restricting
recipient su rg ed after an initial delay w ith only a 10-fold red u ctio n in the
n u m b er of pLG221 transconjugants form ed by 40 m in u tes (Fig. 3.2 A ).
In terestin g ly , a sim ilar result w as achieved for the tran sm issio n of th e
C o llb drd a r d A m utant (pLG292) to the EcoKI restricting recipient (Fig. 3.2 B).
This phenom enon w as originally reported by Read et al. (1992).
EcoKI restriction had very little effect on the transm ission of pLG221
(Fig. 3.2 B), w ith transconjugant yields reaching the sam e value as those
p ro d u c e d in the n on-restricting recipients after 40 m inutes.
This EcoK I
resistance of pLG221 can largely be attributed to the a rd A gene present on the
plasm id (Read et al., 1992).
Results in Fig. 3.1 and Fig. 3.2 confirm the findings of W ilkins et al.
(1996) and R ead et al. (1992), respectively.
Taking into co n sid eratio n the
n um ber of restriction enzym e target sites that ColJbdrd and R751 carry (section
3.1) and the effect that restriction has on each plasm ids' transm ission, it is clear
th at ColJbdrd encodes an ardA -independent restriction evasion m echanism .
3.2.2
Effects of co-transferring R751 with Collb drd to a restricting recipient
The events th at lead to the alleviation of type I and type II restriction
a fter m u ltip le tran sfers of Collbdrd are unknow n.
The three h y potheses
described in section 3.1 predict that restriction in the recipient will be alleviated
in trans.
This notion w as investigated by testing w h eth er C ollbdrd could
61
Fig. 3.3. Co-transfer of plasm ids R751 and pLG221 to recipient cells specifying
EcoRI.
(A) Yield of N alR, TcR R751 transconjugants from conjugations of GI65R(R751)
d o n o rs an d either recipients GI65N (O , control) or EcoRI restric tin g recipients
GI65N(NTP14) ( • ) , GI65R(R751, pLG221) donors an d recipients GI65N(NTP14)
(■ ). (B) Yield of N a lR, Km R (pLG221) tra n sc o n ju g a n ts fro m GI65R(R751,
pLG221) donors and either recipients GI65N (A, control) or GI65N(NTP14) (A).
(C) Yield of N alR, TcR, KmR (R751, pLG221) transconjugants form GI65R(R751,
pLG221) donors an d either recipients GI65N (V, control) or GI65N(NTP14) (▼).
T ransconjugants w ere selected on N A plates containing N al, Tc, Km. D ata are
th e m ean values of three experim ents.
Fig. 3.3
pLG221
Logio transconjugants per m l
R751
R751 and pLG221
4-
!---------- [—
20
30
Time (min)
—
0
10
20
30
40
40
Fig. 3.4. Co-transfer of R751 and pLG292 (Ard") to a recipient specifying EcoKI.
(A )
Yield of N a lR, TcR (R751) tra n s c o n ju g a n ts
fro m
c o n ju g a tio n s o f
NM654R(R751) d o n o rs and eith er recip ien ts N M 816N ( O , control) or EcoKI
restricting recipients GI65N (# ), NM654R(R751, pLG292) d o n o rs an d recipients
G I65N (■ ). (B) Y ield of N a lR, K m R
(pLG 292)
tr a n s c o n ju g a n ts
fro m
NM654R(R751, pLG292) donors and eith er recipients N M 816N (A, control) o r
GI65N (A). (C) Yield of N alR, TcR, Km R (R751, pLG292) tran sco n ju g an ts from
NM654R(R751, pLG292) donors and eith er recipients N M 816N (V, control) o r
G I65N (Y). T ransconjugants w ere selected on N A p la te s c o n tain in g N al, Tc,
Km. Data are the m ean value of three experim ents.
Log^o transconjugants per m l
<3>
NJ
4*
oo
•n
CTQ
U>
4l
*1
*<l
O
l
K3
NJ
►
£»
Os
oo
O
H
O
N3
N»
>
n
CL
N3
4^
On
00
on
N>
ftj
3
CL
^3
r<
O
N>
KJ
>
i-t
CL
4*
O
Fig. 3.5. Co-transfer of R751 and pLG221 (Ard+) to a recipient specifying EcoKI.
(A )
Yield of N a lR, TcR (R751) tra n s c o n ju g a n ts
fro m
c o n ju g a tio n s of
NM654R(R751) d o n o rs and eith er recip ien ts N M 816N ( O , control) or EcoKI
restricting recipients GI65N ( • ) , NM654R(R751, pLG221) d o n o rs an d recipients
G I65N
(■ ).
(B) Y ield of N a lR, K m R
(pLG 221)
tr a n s c o n ju g a n ts
fro m
NM654R(R751, pLG221) donors and either recipients N M 816N (A, control) or
G I65N (A). (C) Yield of N alR, TcR, KmR (R751, pLG221) tran sco n ju g an ts from
NM654R(R751, pLG221) donors and either recipients N M 816N (V, control) or
G I65N (▼). T ransconjugants w ere selected on N A p la te s co n ta in in g N al, Tc,
Km. D ata are the m ean values of three experim ents.
Fig. 3.5
pLG221(Ard+)
R751 and pLG221(Ard+)
per ml
R751
6
o
to
S
4-
-
4-
or-H
W)
O
hJ
10
20
30
40
10
20
30
Time (min)
40
2Y0
10
20
30
40
confer p rotection on restriction-sensitive plasm id R751 w hen the two plasm ids
are co-transferred together to a restricting recipient.
The sta n d a rd experim ent involved m ating a donor strain h arb o u rin g
b o th R751 a n d Collb drd (pLG221 or pLG292) w ith either an EcoRI or EcoKI
re stric tin g recip ien t.
R estriction in the recipient strains w as m o n ito red
th ro u g h o u t each m ating by exam ining the num ber of R751 transconjugants
form ed.
A n y alleviation of restriction by transferring Collb drd w o u ld be
in d icated b y a n increase in the n u m b er of R751 transconjugants p ro d u ce d
c o m p a red to th o se form ed w h en R751 is tran sferred in d e p e n d e n tly of
C o llb drd.
The n u m b ers of C ollbdrd transconjugants an d R 7 5 1 /C o lIb d rd
tran sco n ju g an ts form ed th ro u g h o u t the experim ents w ere also m ea su re d .
Such results w ere indicative of the efficiency of the m ating and the activity of
the C ollbdrd-m ediated restriction evasion mechanism.
The resu lts of these experim ents are presented in Figures 3.3, 3.4 and
3.5. Figure 3.3 (A) show s that w hen R751 is co-transferred w ith pLG221 to an
EcoRI re s tric tin g rec ip ie n t the n u m b e r of R751 transconjugants fo rm ed
increases only m arginally. This finding provides no com pelling evidence of a
tr a n s -acting system operating to alleviate EcoRI restriction. H ow ever, Fig. 3.3
(A) does show a delay in the num ber of R751 transconjugants form ed d u rin g
the first 6-10 m inutes of m ating, which is characteristic of that seen in Collbdrd
transconjugant pro d u ctio n (Fig 3.3 B), suggesting that the protection conferred
on R751, a lth o u g h lim ited, is a ttrib u te d to the C ollb-m ediated restrictio n
evasion process.
Figure 3.4 show s the data obtained w hen R751 is co-transferred w ith the
C o llb d rd a r d A m u tan t (pLG292) to an EcoKI restricting recipient. As w as the
case for EcoRI restriction (Fig. 3.3), transferring Collbdrd (A rdA ') was only able
to m arginally alleviate destruction of transferring R751 from EcoKI restriction.
This fin d in g is in d icated by the 10-fold increase in the num ber of R751
tran sco n ju g an ts form ed in EcoKI restricting recipients w hen co-transferred
w ith Collbdrd (Fig. 3.4 A).
62
In contrast, Fig. 3.5 (A) show s th at w hen R751 is co-transferred w ith the
a r d A + Collbdrd plasm id (pLG221) to an EcoKI restricting recipient, the yield of
R751 transconjugants form ed in the restricting recipient w as equal to those
form ed in the non-restricting recipient. Com parisons w ith Fig. 3.4 (A) indicate
th at such protection can be attributed to the functional a r d A gene present on
pLG221.
These results provide a good exam ple of the effects of alleviating
restriction in the recipient in trans.
Overall, the yield of all three types of transconjugant form ed (A, B and
C) in these m atings involving donors carrying R751 and a Collbdrd p la s m id
w as reduced b y ~5-fold, w hich m ay be a consequence of using a donor strain
su p p o rtin g th e tran sfer of tw o conjugative plasm ids.
The reduced yields
cannot be ex p lain ed by killing of recipients, since the n u m b er of cells w as
m onitored d u rin g each m ating experim ent and found to increase slightly, as
expected for a grow ing culture (data not shown).
The d ata raise the im portant question of w hether the relative tim e of
e n try of R751 an d C ollbdrd into the restricting recipient cells is im portant.
C ollb-m ediated alleviation of restriction is delayed by 6-10 m inutes and it m ay
be possible th at R751 transfer is already completed by this time. This question
is addressed in the follow ing sections.
3.2.3
Rescue of R751 from restriction by C ollbdrd resid en t in the restricting
recip ien t
The p rev io u s section show ed no significant protection of R751 from
EcoRI or EcoKI restriction w hen the donor also transm itted the a rd A m u ta n t
of Collbdrd.
This section further explores the a r d A -in d e p e n d e n t restrictio n
ev asio n m echanism by asking w h e th er C ollbdrd plasm id resident in the
recipient can protect transferring R751.
The experim ents involved m ating a donor strain harbouring R751 w ith
either a EcoKI or EcoRI restricting recipient strain that also harboured Collbdrd
plasm ids pLG221 (A rdA +) or pLG292 (ArdA') (Fig. 3.6). Samples of the m ating
63
Fig. 3.6. Transfer of plasm id R751 to a restricting recipient that harbours C ollb.
(A) R751 transconjugants from conjugations of GI65R(R751) d o n o rs and either
recipients GI65N (O, control), G I65N (N TP14) (# , control) o r G I65N pLG221,
N T P 14) (■). (B) R751 tran sco n ju g an ts from N M 654R (R751) d o n o rs a n d
recipients N M 816N (O, control), GI65N (# , control) a n d G I65N (pLG292) (■).
(C )
R751 tra n sc o n ju g a n ts from
N M 816N
(O,
c o n tr o l ) ,
NM 654R(R751) d o n o rs a n d re c ip ie n ts
G I6 5 N (# , c o n tro l)
and
G I6 5 N (p L G 2 2 1 ) (■).
T ransconjugants w ere selected on N A plates containing N al a n d Tc.
the m ean value of three experim ent.
D ata are
Log^o transconjugants per ml
O
N>
GO
►n
CTQ
CO
ON
tn
Ci
O
*3
HH
►
•-t
CL
+
KJ
On
O
00
M
o
otn
o
*>—I
N3
O
>
Cl
O
oJ
o
K>
O
M
O
4L
ON
00
cells w ere rem o v e d at intervals a n d exam ined for the num ber of R751
tran sco n ju g an ts.
F igure 3.6 (A) show s the resu lts of tran sferrin g R751 to an EcoR I
restricting recipient harbouring pLG221. In such a m ating, the possibility of
tran sferrin g R751 entering a restricting recipient w ith o u t Collb present w as
elim inated. Therefore, the issue of tim ing of plasm id transfer is not a factor.
At 40 m inutes, the yield of R751 transconjugants is 1,000-fold higher than the
n u m b er p ro d u c e d w h en the m ating system lacked pLG221.
Such results
suggest that C o l l b d r d resident in the recipient does alleviate restriction by type
II restrictio n en zy m es in trans.
The results are very different from those
obtained w h en R751 co-transfers w ith pLG221, w here no significant levels of
EcoRI protection w ere observed (Fig. 3.3 A). In addition, these results rule out
the h y p o th esis th a t the evasion m echanism operates by overw helm ing the
EcoRI restriction enzym es by substrate saturation, since such a phenom enon
w o u ld req u ire m u ltip le ro u n d s of transfers of C o l l b d r d to the restricting
recipient.
Figure 3.6 (B and C) also show s that both pLG292 and pLG221 conferred
lim ited p ro tectio n on incom ing R751 from EcoKI.
It is noted that pLG221
conferred m ore protection than pLG292, particularly during early stages. This
p resum ably reflects the constitutive level of A rdA activity in an established
C ollbdrd containing strain.
Figure 3.6 (B) show s that a resident pLG292 plasm id in the recipient
conferred only m odest protection on a transferring R751 plasm id. The 10-fold
level of protection is sim ilar to that observed w hen the tw o plasm ids are co­
tran sferred from the sam e donor strain.
Therefore, expression of the a r d A -
in d e p e n d e n t re stric tio n evasion m echanism ap p ea rs to be unaffected by
tra n sfe r of the p lasm id .
Such a finding suggests th at the m echanism is
expressed co nstitutively by Collbdrd and is not d ependent on transfer of the
p lasm id.
64
The m o d est protection conferred on R751 by pLG221 w hen resident in
the EcoKI restricting recipient (Fig. 3.6 C) com pared to the complete protection
conferred w hen R751 and pLG221 are co-transferred (Fig. 3.5 A), suggests that
the A rdA system operates optim ally w hen specified by a transferring plasm id.
Such findings are indicative that the a r d A gene of Collb is subject to zygotic
induction (C hapter One, section 1.6.4).
3.2.4
Is conjugative transfer of C ollb d r d a prerequisite for alleviation of
restriction?
A potential problem in the R751 protection experim ents (section 3.2.3) is
that Collbdrd transfers from the EcoRI restricting recipients to the R751 donor.
E xperim ents su m m arised in this section aim ed to establish w h eth er su ch
transfers are a prerequisite for alleviation of type II restriction. Two strategies
w ere adopted.
The first involved a m ating experim ent w here u nm odified
R751 w as tran sferred to a restricting recipient harb o u rin g w ild type C ollb
(pLG272). W ild type Collb is naturally repressed for transfer functions an d
therefore tran sfer of the plasm id is a rare event.
The transfer efficiency of
pLG272 is 40,000-fold low er than that of pLG221. The second strategy involved
the exploitation of the phenom enon of plasm id-encoded entry exclusion.
The m atings described in section 3.2.3 were repeated substituting pLG221
for pLG272.
Like pLG221, pLG272 also carries a Tn5 insertion that confers
resistance to kanam ycin although the plasm id does not carry a drd m u tatio n
(H o w lan d et al., 1989).
A ppropriate recipients w ere m ade by transferring
pLG272 DNA into each strain by transform ation.
th eir resistance to kanam ycin.
Strains w ere identified by
Filter m ating experim ents w ere then set u p
b etw een a donor strain harbouring R751 and the restricting recipient strain
h arb o u rin g pLG272.
The num bers of R751 transconjugants w ere m onitored
th ro u g h o u t the experim ent (Fig. 3.7).
Figure 3.7 (A) show s that w hen R751 is transferred to an EcoRI restricting
rec ip ie n t h a rb o u rin g pLG272, tran sco n ju g an t p ro d u c tio n w as negligible,
65
Fig. 3.7. Transfer of R751 to a restricting recipient harbouring w ild type Collb.
(A) R751 transconjugants from conjugations of GI65R(R751) d o n o rs and eith er
recipients GI65N (o , control), GI65N(NTP14) (#, control) o r GI65N (N TP14,
pLG272) (■). (B)
R751 tra n sc o n ju g a n ts from N M 654R(R751) d o n o rs a n d
recipients N M 816N (O, control), GI65N ( • , control) a n d GI65N(pLG272) (■).
T ransconjugants w ere selected on N A plates containing N al a n d Tc.
the m ean values of three experm ients.
D ata are
Fig. 3.7
EcoRI
6-
4o
0
10
20
30
Time (min)
EcoKI
<D
Oh
6
-
c
bC
.B,
'o'
ou
</>
c
rj
j- i
bC
o
hJ
10
Time (min)
40
a m o u n tin g to 10’5 per cell at 40 m inutes.
Clearly, pLG272 does not confer
p ro tectio n on R751, d em onstrating th at the restriction-evasion m echanism
active against type II enzymes is determ ined only by a ColTbdrd plasm id.
Figure 3.7 (B) shows the result of transferring R751 to an EcoKI restricting
recipient harbouring pLG272. A sm all am ount of protection was conferred on
R751 by pLG272, since at 40 m inutes the num ber of R751 transconjugants w as
8-fold h ig h er th a n those form ed in restrictin g stra in s lacking pLG272.
Interestingly, protection is initiated early, as found w hen pLG221 (ArdA+) w as
resident in the recipient cell (Fig. 3.6 C). These findings suggest that ardA is
not u n d er the com plete control of the Collb Fin system an d is expressed at a
low level. Read et ah (1992), also described sim ilar findings w here unm odified
X.O plated w ith a greater efficiency on an EcoKI restricting strain h arbouring
pLG272 (e.o.p of 3.7 x 10' ) com pared to a restricting strain lacking a Collb
plasm id (e.o.p of 1.4 x 10’4).
A lthough use of pLG272 confirm ed that conjugative transfer of C o U b d r d
is a prerequisite for alleviation by type II restriction, the data does not reveal
the stage of C ollb's conjugation cycle w hen alleviation occurs. Possibilities are
m ating pair form ation; DNA transfer and expression of the plasm id's transfer
genes. To explore this question further, the phenom enon of plasm id-encoded
entry exclusion w as exploited. The strategy here involved using the cloned
Collb exclusion genes (eex) in the donor to prevent transfer of pLG221 from the
restricting recipient to the R751 donor. The exclusion genes of Collb have been
cloned giving reco m b in an t p lasm id pRR4 (Roscoe, 1996).
The level of
exclusion conferred by pRR4 on pLG221 is show n in Table 3.2.1. This displays
the results of a 40-m inute m ating experim ent w here pLG221 was transferred to
a recipient strain harbouring pRR4. The yield of pLG221 transconjugants w as
red u ced 1,090-fold relative to the non-excluding control.
H ow ever, quite
surprisingly, w hen the recipient strain also harboured plasm id R751 as well as
pRR4, the level of exclusion conferred on pLG221 was only 12-fold.
66
Table 3.2.1. Exclusion of pLG221 by the cloned Collb exclusion (eex) genes in pRR4
Donor
Recipient
pLG221
transconjugants/
ml
*Level of
exclusion
GI65N(pLG221)
GI65R
1.2 xlO 7
GI65N(pLG221)
GI65R(pRR4)
1.1 x 104
1090-fold
GI65N(pLG221)
GI65R(pRR4, R751)
1.0 x 106
12-fold
0
Equal numbers of donor and recipient cells were mixed together to give a
concentration of 108 cells of each strain per ml. A 40 minute filter mating was
performed at 37°C. The numbers of pLG221 transconjugants were determined
by plating the mating mixture on NA plates containing Km (25 pg mb1) and Rif
(25 pg ml4 ). Plasmid pRR4 is a recombinant plasmid carrying the cloned Collb
exclusion (eex) genes. *The level of exclusion conferred on transferring plasmid
pLG221 by pRR4 was determined by comparing the number of pLG221
transconjugants produced in the recipient harbouring pRR4 to those produced in
non-excluding strain GI65R.
Fig. 3.8. Transfer of R751 from a donor harbouring the clon ed Collb exclusion
genes to a restricting recipient harbouring C ollb drd.
(A)
R751 tran sco n ju g an ts from co n jugations of GI65R(R751) d o n o rs an d
either recipients GI65N (O, control), GI65N(NTP14) ( • , control), GI65N(NTP14,
pLG221) (■), and GI65R(R751, pRR4) donors an d G I65N (N TP14, pLG221) (A)
recip ien ts.
(B)
R751 tra n sc o n ju g a n ts from N M 654R(R751) d o n o rs a n d
recipients NM 816N (O, control), GI65N ( • , control) an d GI65N(pLG292) (■) and
NM654R(R751, pRR4) donors and rec ip ie n t G I65N (pLG 292) (A). (C )
R751
tra n sc o n ju g a n ts from NM 654R(R751) d o n o rs a n d re c ip ie n ts N M 816N (O,
c o n tro l),
G I65N
(•,
c o n tro l)
and
G I65N (pL G 221)
(■ ),
and
d o n o rs
NM654R(R751, pRR4) an d recipient GI65N(pLG221) (A). T ransconjugants w ere
selected on N A plates containing N a l a n d Tc.
th ree experim ent.
D ata are th e m ean v alu e of
Logio transconjugants per m l
N>
Os
00
era
U>
00
O
nin
o
53
H H
NJ
>
ft
CL
+
ON
N3
00
tn
Ci
o
*I—H
H
>
ft
CL
►■
o
NJ
4L
as
oo
cn
r>
o
5*
fH
>
ft
CL
+
4L
O
This effect of pLG221 partially overcom ing its ow n exclusion barrier is
not due to plasm id R751 displacing pRR4 from the recipient cell. T hroughout
the m ating, the fraction of recipient cells harbouring both R751 and pRR4 w as
m easured by plating some of the m ating m ixture on NA plates containing Rif,
Tc and Ap. The num ber increased slightly by 3-fold as expected for a growing
culture. One possible explanation is th at ColJbdrd is able to gain entry to the
defined recip ien t via the m ating a p p a ra tu s of R751.
A nother is that the
presence of R751 in the pRR4 recip ien t interferes w ith the Collb exclusion
system.
Figure 3.8 (B and C) show s the effects of transferring R751 from a donor
strain expressing the Collb exclusion system to an EcoKI restricting recipient
harbouring pLG292 (D rd+, A rdA ') (B) or pLG221 (Drd+, A rdA +) (C). In both
cases, the ex clu sio n sy stem in th e donor had no strik in g effect on the
protection conferred on R751. Such findings indicate that conjugative transfer
of Collb is not required for the ardA -independent function that alleviates type I
restriction.
The sam e conclusion w as draw n by the data in Fig. 3.6 (B) as
discussed previously.
In co n tra st, w h e n R751 tran sfe rred from the d o n o r to an E coR I
restricting recipient harbouring pLG221, the level of R751 protection is reduced
by ~10-fold (Fig. 3.8 A ).
In the sam e experim ent, pLG221 transconjugant
p ro d u ctio n in the R751 d o n o r w as also reduced by 10-fold.
Such results
su p p o rt the findings th at alleviation of type II restriction requires conjugative
transfer of Collb.
W hether the C ollb exclusion system w orks by p reventing m ating-pair
fo rm atio n or D N A tra n sfe r is n o t know n (C hapter O ne, section 1.3.3).
C onsequently, experim ents involving the Collb exclusion genes could not be
u sed to identify the stage of the conjugation cycle at w hich the plasm idm e d ia te d re stric tio n e v asio n m echanism is ex p ressed .
H ow ever, the
experim ents w ere useful in indicating that the anti-type II m echanism is not
co-ordinately expressed w ith the transfer genes.
67
3.3
Summary
Four im portant conclusions can be draw n from the data in this chapter.
First, the data are consistent w ith Read et al. (1992) in th at transfer of m ultiple
copies of Collbdrd does alleviate restriction by type I and type II enzym es (Fig.
3.2).
H ow ever, alleviation is ap parently not due to the restriction enzym es
being overw helm ed by substrate saturation (Read et al., 1992), since, Collb drd
alleviated restriction by both type I and type II enzym es w hen resident in the
restricting recipient (Fig. 3.6).
Second, the a r d A - i n d e p e n d e n t anti-type I system is apparently different
from that w hich alleviates type II restriction. This conclusion w as draw n from
the o b servation th a t type II restriction alleviation by C o l l b d r d only occurs
d u rin g conjugative transfer of the plasm id. In contrast, alleviation of type I
restriction occurred independently of Collbdrd transfer (Fig. 3.7).
Third, the C ollb a r d A gene appears to be subject to zygotic induction.
A rd A -m ed iated re stric tio n alleviation was observed to be optim al w h en
encoded by a transferring Collbdrd plasm id rather than an equivalent plasm id
resident in the restricting recipient (Fig. 3.5; Fig. 3.6 C). Such data suggest that
a r d A expression is enhanced in conjugation but do not distinguish the cell in
w hich gene ex pression is am plified.
This dilem m a is ad d ressed in C hapter
Five.
Fourth, Collb partially overcomes its own exclusion barrier w hen IncPp
plasm id R751 is resident in the excluding recipient strain. One hypothesis that
m ay explain this phenom enon is that Collb utilises the m ating apparatus of
R751 to gain entry to the excluding recipient. Such a scenario w ould indicate
th a t the Collb exclusion m echanism operates by p re v e n tin g m atin g -p air
form ation betw een tw o cells harbouring the same plasm id. How ever, such a
hypothesis is inconsistent w ith the w ork of H artskeerl an d H oekstra (1985).
They found evidence to suggest that the Collb exclusion system w orks by
inhibiting DNA transfer betw een two donor cells (C hapter One, section 1.3.3).
68
D ue to tim e constraints, this concept of interactions betw een conjugation
system s w as not pursued further. One w ay of testing the hypothesis w ould be
to construct a specific m utant of R751 unable to express conjugative pili. Such
a m u tan t w o u ld be expected to no longer provide the route of entry for the
Collb plasm id to the excluding recipient cell.
These sum m ary points are follow ed up in su b seq u en t chapters and
general discussion.
69
Chapter Four
Construction of an oriT Mutant of Collb drd and its Conjugative
Properties
4.1
Introduction
Data presented in the previous chapter suggests that Collbdrd encodes a
restrictio n -allev iatio n function, w h ic h is active against type II restrictio n
enzym es and is expressed d uring conjugative transfer of the plasm id. There
are three m ain stages of C ollb's conjugation cycle w hen such a function could
be expressed: d u rin g m ating-pair form ation, DNA transfer or th ro u g h o u t the
cycle. To distinguish betw een these three stages, it was necessary to construct a
m u ta n t of Collb defective in self-transfer by conjugation, yet proficient in
form ing m atin g p a irs an d in expressing the full com plem ent of p lasm id
proteins. The p u rp o se of this chapter is to describe the strategy em ployed in
creating such a m utant.
As described in chapter one, the origin of transfer (oriT ) of a plasm id is a
c is -acting elem ent re q u ire d for DN A transfer by conjugation.
T ransfer is
initiated at the nic site w ithin the oriT by specific endonucleolytic cleavage of a
single strand of the plasm id (Lanka and Wilkins, 1995). The m ain strategy for
creating a m u tan t of C ollbdrd, defective in self-transfer, w as to delete the nic
region from the o r i T of the plasm id. Collbdrd is -93 kb in size and specific
alterations of sequences stretching only a few base pairs in length, internal of
such a sizeable DN A genom e, are not practical w ith o u t using interm ediate
sm all recom binant plasm ids. Therefore, before any alterations to the sequence
of th e Collbdrd oriT could be m ade, the locus had to be cloned and its n ic
sequence determ ined. The latter w as achieved by DNA sequencing.
The nic sequence w as deleted from the cloned o r i T by a p ro ced u re
involving PCR-am plification. A selectable m arker gene w as then inserted into
70
th e sequence and the disrupted o r i T transferred back to the Collbdrd plasm id
b y hom o lo g o us recom bination.
The m ethod used to replace the o r i T of
C ollbdrd w ith a selectable m utation w as based on a gene replacem ent strategy
described by Russell et al. (1989).
The recom binant plasm id, carrying the
d is ru p te d o r i T and selectable m ark e r, w as first lin earised by restriction
endonuclease digestion.
This D N A w as then in troduced by transform ation
into an E. coli recD strain harb o u rin g Collbdrd. U nder norm al circum stances,
linear DNA is subject to degradation by intracellular nucleases. H ow ever, the
advantage of using an E. coli rec D m u ta n t is that the exonuclease activities of
the RecBCD enzym e are abolished w ith o u t affecting the enzym es ability to act
as a DNA helicase in initiating R ecA -m ediated hom ologous recom bination.
The disrupted oriT, w ithin the recom binant plasm id is integrated by a double
crossover event sp a n n in g the selectable m arker.
recom binant p lasm id is eventually destroyed.
The rem a in d e r of th e
The m inim um am o u n t of
hom ology that is required for efficient recom bination is 44-90 nucleotides for
RecBC and RecF dependent pathw ays (Shen and H uang, 1986).
O th er experim ents described in this chapter include exam ining the
conjugative properties of the ColIbdrdAnzc plasm ids.
4.2
Results
4.2.1
Cloning and determination of the nucleotide sequence of the Collb o riT
locus
The Collb oriT is located adjacent to the leading region of the plasm id
on a 1.6 kb P s t l fragm ent [C hapter O ne, Fig 1.1] (Rees et al., 1987).
This
fragm ent has already been cloned in this laboratory and inserted into cloning
vector pUC19 (Roscoe, 1996). The resulting recom binant plasm id (pCL2) w as
u sed initially as a tem plate for determ ining the nucleotide sequence of Collb
oriT.
Sequence reactions w ere perform ed as described in Chapter Two using
M 1 3 /p U C u n iv ersal forw ard an d reverse prim ers.
H ow ever, the initial
sequence data obtained w ere very am biguous. Consequently, the integrity of
71
the pCL2 tem plate was re-exam ined, firstly by restriction enzym e analysis an d
secondly by PCR-amplification.
A series of 20-cycle PCR reactions w as set up using universal forw ard
and rev erse p rim e rs w ith tem p late pCL2.
The tem p eratu re at w hich the
p rim ers w ere annealed to the pCL2 tem plate was varied from 49-60°C. The
resulting extension products p ro d u ced in each reaction w ere exam ined by gel
electrophoresis and in all cases unpredictable DNA bands of varying sizes w ere
observed (data n o t show n). Such results are indicative of either non-specific
a n n ealin g of p rim e rs or of a m ixed p o p u latio n of tem plate.
H ow ever,
restriction data for pCL2 w ere not indicative of the latter possibility.
To overcom e the problem , the 1.6 kb Ps tl insert w as rem oved from pCL2
by restriction enzym e digestion an d the fragm ent isolated from a 0.8% agarose
gel after separation from pUC19 by electrophoresis. The fragm ent was purified
from the agarose using the QIAEX II gel extraction kit (Qiagen) and ligated back
into the P stl site of a separate batch of pUC19 molecules form ing recom binant
p N A l.
Isolation of p N A l w as achieved by transferring the ligated DNA by
tran sfo rm a tio n in to the E. coli L ac ' strain , D H 5a.
T ransform ant colonies
containing p N A l w ere d istinguished from those that had gained re-ligated
pUC19 vector by their w hite appearance on LA plates containing X-gal, IPTG
and Ap (Sam brook et al, 1989; see C hapter Two).
In order to establish the orientation of the 1.6 kb P stl insert of p N A l
w ith in th e pUC19 v ector, the recom binant plasm ids w ere exam ined by
restriction enzym e digestion.
All four of the recom binant plasm ids isolated
w ere digested w ith Clal and EcoRI, w here the Clal site is internal to the 1.6 kb
insert and the EcoRI site adjacent to one of the P stl sites. Three of the four
recom binants tested h a d the orientation show n in Fig. 4.1 A, and one the
opposite orientation. The latter plasm id was subsequently designated p N A la.
R ecom binant p lasm id s p N A l and p N A la w ere both tested for th eir
ability to be m obilised by C o ll b d r d plasm id pLG221 from a recA donor. A recA
d o n o r strain w as used in all m obilisation experim ents sum m arised in Table
72
Fig. 4.1. Schematic diagram of the construction of pN A 2
(A )
C leavage of p N A l w ith P s t l a n d C l a l to rem o v e th e 1.15 kb of D N A
containing C ollb oriT . The rem aining 3.1 kb P s t l - C l a l fra g m e n t is discarded.
(B) Cleavage of cloning vector pIC 19H at its Pstl and C l a l sites to obtain the 2.6
kb linearised vector. The sm all P s t l - C l a l fragm ent fro m the polylinker is lost
th ro u g h p u rification of the larger fragm ent. (C) In se rtio n of the 1.15 kb P s t l C l a l frag m en t from p N A l into 2.6 kb pIC 19H v e cto r to give pN A 2.
(—^ )
rep resen ts the o rien tatio n (5' - 3') an d annealing site for M 1 3 /p U C universal
forw ard (UF) an d reverse (UR) prim ers.
Fig. 4.1
EcoRI
Bam H l
H in d lll
Sphl
Pstl
pIC19H
2686 bp
P vu I
Clal
EcoRVXbal
Bglll
Xhol
Sacl
Nrul
Hindlll
H in d lll
pNA2
3786 bp
H indlll
Nru I
Sac I
Xho I
Bgl II
Xfcal
C la l
EcoRI
Sma I
BamHl
S a il
P stl
Hindlll
Table 4.2.1. Mobilisation of recombinant plasmids carrying the Collb oriT locus
Donor Stain
Transconjugants / ml
Recombinant
Helper Plasmid
Mobilisation
Frequency of
Recombinant
J08(pLG221, pN A l)
2.0 x 106
3.0 x 106
0.66
J08(pLG221, pN A la)
1.1 x 106
2.0 x 106
0.55
J08(pLG221, pNA2)
8.0 x 106
1.1 x 107
0.73
J08(pLG221, pNA3)
4.0 x 106
1.4 xlO 7
0.28
J08(pLG221, pNA7)
<10
7.0 x 107
< 1 0 '4
J08(pLG221, pNA8)
<10
1.3 x 107
<10‘4
J08(pN A ll, pNA2)
1.9 xlO 7
<10
1.0
J08(pNA12, pNA2)
1.1 x 107
<10
1.0
The frequency of transfer of each plasmid was determined after a 40 minute filter mating at 37°C, using
J08 as the donor host strain and GI65N as the recipient. Recombinant plasmids pN A l, pN A la, pNA2,
pNA3, pNA7 and pNA8 all confer resistance to ampicillin. Helper plasmids pLG221, p N A ll and pNA12 all
confer resistance to kanamycin. Plasmids p N A ll and pNA12 both carry a cis-acting lesion within the oriT
which prevents their self-transfer. However, both plasmids still specify all other transfer functions. Transfer
of recombinant plasmids were measured by plating the mating mixture on NA plates containing Ap (100 pg
ml-1) and Nal (25 pg ml4 ) and transfer of the helper plasmid measured by plating on NA plates containing
Km (25 pg ml4 ) and Nal (25 pg ml4 ). ^Mobilisation frequency is the number of mobilisable plasmids
transferred per conjugative plasmid.
4.2.1, to p re v e n t co-integrate fo rm a tio n b e tw ee n C ollb p lasm id s a n d
recom binants carrying the Collb o r i T sequence.
Test strains w ere m ade by
tra n sfe rrin g the recom binant p la sm id s by tran sfo rm atio n to J08(pLG221)
com petent cells. D onor strains J08(pLG221, p N A l) and J08(pLG221, p N A la)
w ere m ated w ith N alR recipient strain, GI65N for 40 m inutes on filters. The
results of these transfers are p resented in Table 4.2.1. Both p N A l and p N A la
w ere found to be m obilised w ith a n efficiency of 0.66 and 0.55, respectively,
relative to the transfer of pLG221. Such results confirm that both recom binant
plasm ids contain the Collb or iT an d th at its activity as a czs-acting site for the
initiation of DNA transfer is unaffected by orientation.
To reduce the num ber of reactions required to determ ine the com plete
nucleotide sequence of the 1.6 kb P stl insert w ithin p N A l, the Collb oriT w as
subcloned further.
The 1.15 kb P s t l - C l a l fragm ent found w ithin p N A l w as
isolated and lig ated into cloning vector pIC19H, form ing pN A 2 (Fig. 4.1).
Cloning vector pIC19H is identical to pUC19 except it has a different set of
cloning sites available w ithin the polylinker (Marsh et al., 1984).
M obilisation of pNA 2 from a recA host (J08) w ith a frequency of 0.73
relative to the transfer of pLG221 confirm ed that the plasm id w as oriT+ (Table
4.2.1). The suitability of pNA2 as a tem plate for DNA sequencing was further
confirm ed by PCR-am plification and restriction enzym e analysis.
Initial sequence reactions w ere set up using u n iv ersal forw ard an d
reverse prim ers. H ow ever, to obtain sequence data for both DNA strands, tw o
new prim ers w ere designed (prim er B and prim er C; see C hapter Two). The
sequence d ata o b tain ed from pN A 2 using u niversal forw ard and reverse
prim er and prim er B and prim er C, are presented in Fig. 4.2.
The location of the nic site in In cll plasm id R64 is know n, as is the
n ucleotide sequence of the su rro u n d in g region (Furuya and Komano, 1991).
A lignm ent of nucleotide sequences of a num ber of plasm ids show s that R64
nic region belongs to a family w ith a consensus sequence of 5'-YATCCTGTY-3',
w here ▼ indicates the specific cleavage site (Lanka and W ilkins, 1995). The
73
Fig. 4.2. 1,151-bp D N A sequence containing the Collb o r i T and part of the o r iT
operon
Features sh o w n include the nic region lnnnn
w here A rep resen ts the site of
cleavage by th e relaxase enzym e; the tw o
start co d o n s of n i k A an d nikB
|GTG|
an d their associated ribosom e binding sites (rbs ) w hich are u n d erlin ed ; an d the
TGA
stop co d on of n i k A .
A m ino acid sequences d e d u c e d from the D N A
sequence of th e nikA an d nikB reading fram es are p re se n te d , w here the sta rt
of each tra n sla te d am ino acid is in uppercase.
in d ic ate d .
R elevant restrictio n sites are
In v e rte d re p e a t sequences are sh o w n (■----------- *----------------- • ).
In v erted rep eats A an d B represent the site at w hich th e n i k A p o ly p e p tid e
b in d s to the DNA. P utative prom oter sequences (-35 an d -10 regions) are boxed
L.
i
N u cleo tid es 1-437, p resen ted in low er case, re p re se n t th e le a d in g
region stran d th at is transferred to the recipient cell first d u rin g conjugation.
A ll features sh o w n , except the n ic sequence, w ere id e n tifie d by se q u en ce
com parisons to the p u b lish ed oriT sequence of the In c ll p lasm id R64 (F uruya
a n d K om ano, 1991; EMBL d a tab ase accession n u m b e r D90273).
The n i c
sequence w as d eterm in ed by com paring the sequence d a ta to the consensus 5'YATCCTGt Y-3’ (Lanka and W ilkins, 1995; Fig. 1.2).
Fig. 4.2
1
61
121
c c g a c tta g a c a g a a a a a tc ta c g a c a a a a tc tc c ttc ttg c c g c c c ta c c g a a a a a g c t
60
a a g a c g a a g g g c tta tta c a g tg c ttc a c g g a a g a g a g g a tg a a g ta tg g g a c g ta a a a a
c tc g c a c a g tg c ttg ta g a c g g tc a c a ta ttg g g a a a c a g g a a tg g tc ttg tta tta c a g
12 0
180
Bglll
181
ta g tg c tta c c g ta g ttc tttta g tg c g tta c a a a a g g c a a c tc g c c a c |tc ta g ^ c c g tt
2 40
2 41
a a g g c ta tttc g tc g a a a a c g g tc g a c c ta c a g ta g ta g a c tc a tttta a a a a a tc ttc g
3 00
3 01
g ta a c c g tg a a a g a g a g g c a a a g ta c a a c ttc a g a c ta a a a ta g ta g tttttg a c tg a g g
3 60
3 61
a c c g tc c c g a c g c g g g a c g g a g a c g g c a g a c g ta ttc tg a ta c ta c g tg ttttta ttg tc
42 0
421
T G C A A lH g^T A C C G T C C C A C G C G A C G C
+----------------------i----------------------+ 4 8 0
c g a t a t t a c c g g a c t t t t '^GebCTGTG<lTAOACGTTAACATTATGGCAGGGTGCGCTGCG
-3 5
A
%'Mk.y
nic
-1 0
repeat A
rfos
IR
lnikA-
4 8 1 --------------------■+■----------h
-------------- h---------------------- f*
i-----------------------f 5 4 0
ATAATGTTAACGGTAGACCAGTCCCGAAGCGGGGCTGTGGGGCATTCCTCGGACTTCACT
---------------------------- 1
1
^ IR Z
1
V a lS e r
rep e a t B
GTGATAGTGCGGTAAGAAAGAAAAGTGAGGTACGGCAAAAGACAGTTGTCAGGACACTCA
5 4 1 -------------- +------------- +------------- +------------- +------------- +-------------- + 6oo
C A C T A T C A C G C C A TT C TT T C TT T T C A C TC C A T G C C G TT T TC T G T C A A C A G T C C T G T G A G T
A sp S e rA la V a lA rg L y sL y sS e rG lu V a lA rg G ln L y sT h rV a lV a lA rg T h rL e u A rg
GATTCTCTCCTGTTGAGGATGAAACCATCAGGAAAAAAGCTGAAGATTCCGGACTTACTG
601
+ ------------------- + ------------------ + ------------------ + ------------------ + ------------------- + 660
CTAAGAGAGGACAACTCCTACTTTGGTAGTCCTTTTTTCGACTTCTAAGGCCTGAATGAC
P h e S e rP ro V a lG lu A sp G lu T h rlle A rg L y sL y sA la G lu A sp S e rG ly L e u T h rV a l
TATCTGCTTACATCCGAAATGCAGCACTGAATAAGCGAATTAACTCCCGTACAGATGATG
66 1
------------------+ --------------------+ ------------------ + ------------------ + ------------------ + -------------------+ 72 0
A TAGACGAATGTAGGCTTTACGTCGTGACTTATTCGCTTAATTGAGGGCATGTCTACTAC
S e rA la T y rlle A rg A sn A la A la L e u A sn L y sA rg lle A sn S e rA rg T h rA sp A sp A la
CTTTTCTGAAGGAGTTAATGAGACTGGGAAGGATGCAGAAGCATCTGTTTGTTCAGGGAA
721
------------------+ --------------------+ ------------------ + ------------------ + ------------------ + -------------------+ 7 8 0
G AA AA GACTTCCTCAATTACTCTGACCCTTCCTACGTCTTCGTAGACAAACAAGTCCCTT
P h e L e u L y s G lu L e u M e tA rg L e u G ly A rg M e tG ln L y sH is L y s P h e V a lG ln G ly L y s
AAAGAACCGGTGACAAGGAATACGCAGAAGTGCTTGTTGCCATAACCGAACTTACAAATA
781
------------------ + ------------------ + ------------------ + ------------------ + ------------------ + ------------------ + 8 4 0
TTTCTTG G C C A C TG TTC CTTA TG CG TCTTC A C G A A C A A C G G TA TTG G C TTG A A TG TTTA T
A rg T h rG ly A s p L y s G lu T y rA la G lu V a lL e u V a lA la lle T h rG lu L e u T h rA s n T h r
rbs
nikB — ►
c a t t g c g t a a a c a g t t a a t g g a a g g t (t g ^ g g a t t c t c c t § tg ]a a t g c a g t c a t t c c g a a a
841
G TA ACG CA TTTG TCA ATTACCTTCCAA CTCCTA AG AG G ACACTTACGTCAG TAA GG CTTT
L e u A rg L y s G ln L e u M e tG lu G ly *
V a lA s n A la V a llle P ro L y s
AAGAGAAGGGACGGCAAGTCTTCGTTCGAAGACCTAGTATCCTACGTCTCTGTCCGGGAT
901
------------------ + ------------------ + ------------------ + ------------------+ -------------------+
+ 9 60
TTCTCTTCCCTGCCGTTCAGAAGCAAGCTTCTGGATCATAGGATGCAGAGACAGGCCCTA
L y s A rg A rg A s p G ly L y s S e r S e rP h e G lu A s p L e u V a lS e rT y rV a lS e rV a lA rg A s p
GACATGACCGATGAGGAACTGGATTTATCTTCTTCTTCGCAGGCTGAACAACCGCACCGA
961
1
f
1
+
1_
1 0 2 0
CTGTACTGGCTACTCCTTGACCTAAATAGAAGAAGAAGCGTCCGACTTGTTGGCGTGGCT
A s p M e tT h r A s p G lu G lu L e u A s p L e u S e rS e rS e r S e rG ln A la G lu G ln P ro H is A rg
AGCCGTTTCA GTCGCCTTG TTG ATTATGCG ACACG TCTTCG AA A TG AG TCA TTCG TG G CG
1021
------------------- (--------------------- h------------------ + ------------------h------------------ h-------------------- + 1 0 8 0
TCGGCAAAGTCAGCGGAACAACTAATACGCTGTGCAGAAGCTTTACTCAGTAAGCACCGC
S e rA rg P h e S e rA rg L e u V a lA s p T y rA la T h rA rg L e u A rg A s n G lu S e rP h e V a lA la
CCGGTTGATGTCATGAAGGACGGCTGCGCATGGGTCAACTTTTATGGTGTCACCTGCCCT
1081
------------------ + -------------------- + ------------------ + ----------------- + ------------------+ ------------------- + 1 1 4 0
GGCCAACTACAGTACTTCCTGCCGACGCGTACCCAGTTGAAAATACCACAGTGGACGGGA
P ro V a lA s p V a lM e tL y s A s p G ly C y s A la T rp V a lA s n P h e T y rG ly V a lT h rC y s P ro
C A TA A C TG TA T
1141 ------------------+ G TA TTG A C A TA
H is A s n C y s
1151
nucleotide sequence determ ined for the 1.15 kb Ps tl-Clal fragm ent of pNA2 was
found to h av e 97% identity over about 924 bp w ith the corresponding region
su rro u n d in g oriT of R64 (EMBL database accession num ber D90273). The nic
region of Collb w as identified by alignm ent of the sequence w ith the consensus
sequence described by Lanka and W ilkins (1995). In fact, the 12-bp nic region
identified for Collb is identical to the nic region of plasm id R64. Other features
identified w ith in the sequence of the 1.15 kb Pstl -C lal fragm ent of pNA2 were
also identified w ith in the published sequence of R64 (Fig. 4.2).
4.2.2
Strategy em ployed to delete the nic sequence from the cloned Collb o riT
Once the sequence of the Collb nic site had been determ ined, a strategy
involving PC R -am plification w as em ployed to delete it from the cloned or iT
(pNA2) as su m m arised in Fig. 4.3.
First, tw o inverse oligonucleotide prim ers w ere designed w hich w ere
h om ologous to th e regions of DNA flanking the nic region (prim er 5 and
prim er 6, Fig. 4.3, A). A unique EcoRI restriction enzym e target sequence w as
added onto the 5' term inus of each prim er.
Hence, during amplification of the
tem plate by an inverse PCR reaction, 14 bp overlapping the nic region are lost
and the targ et sequence for the EcoEl restriction enzym e is incorporated.
In
ad d itio n , these p rim e rs w ere also designed to avoid d isru p tio n of the o r i T
operon prom oter found 12-bp upstream of the nic site (Fig. 4.3, A).
Before any am plification of the pNA2 tem plate w as carried out the PCR
protocol w as optim ised as described in Chapter Two, section 2.6.1. The results
of this optim isation process are presented in Fig. 4.3 (B). Specific com m ents
w ere p rim er 5 and p rim er 6 have an optim al annealing tem perature of 53°C
(lane 3 and 4) a n d th at 4 m inutes is required for the w hole of the pN A 2
tem plate to be am plified by Taq polymerase (lane 5).
The final PC R -am plification of pN A 2 and the subsequent rem oval of
the Collb nic reg io n from the plasm id w as achieved using 50 ng of pN A 2
74
Fig. 4.3. Schematic diagram of the key stages in the construction of a Collb o r iT
sequence deleted o f the nic region
(A)
R elatio n sh ip b etw een p rim e rs u sed for inverse P C R -am plification of
pN A 2 and the nic region. ▼ indicates the nic site; the boxed sequence is the
-35 region of the p u tativ e prom oter of the relaxase operon.
into the lead in g region.
P rim er 5 extends
Prim er n ucleotides show n in lo w er case are non-
ho m o lo g o u s to the Collb region and contain the EcoRI ta rg e t h ex an u cleo tid e
(5'-gaattc-3'). (—a )
represents the direction (5' - 3') a n d a n n ealin g sites of
p rim e rs 5 and 6 a n d the M 13/pU C universal forw ard (UF) and reverse (UR)
p rim e rs.
(B) Gel electrophoresis of PC R -products of pNA2. M olecular w eig h t m ark ers
(X x H i n d III) are in lanes 1 and 6. Prim ers used (2) UF and UR; (3) 6 and UR; (4)
5 and UF; (5) 5 and 6. The size of each extension product is indicated in kb.
(C) Cleavage of th e linear PCR p ro d u c t w ith EcoRI an d ligation gave pN A 7
d eleted of the nic region.
The om ega (Q) in tersp o so n w as lig ated into the
u n iq u e EcoRI site, form ing pNA8.
Fig 4.3
pNA2
P stl
Primer 5
-35
5 ' cggaacCacgTTTTCAGGCCATTATAGCC
5 ’ GGGACj GTATTACAATTGCACATCCTGTCCCGTTTTTCAGGCCATTATAGCC
3 ■CCCTC-GCA’JA.-.TGTHAACGTGTAGGACAGGGCAA.AAAGTCCGGTAATATCGG
3 • CCCTGCCATAATGTTAACGgccc-aaggc 5 '
P r im e r 6
- 3 .8
B
1.1 —
-0 .7
0.4 —
Ap]
pN A 7
3772 bp
P stl
C lal
EcoRI
Sm R/S p R
Q
2 kb
EcoRI
EcoRI
tem p late; 20 p m o l of b o th p rim e r 5 and 6; 1 u n it of proof-reading T a q
polym erase (BIO-X-ACT, Bioline UK Ltd); 5 jxl of 11.1 x PCR buffer; 40 pi of H 20
and the follow ing PCR program : 95°C - 3 m inutes (1 cycle); 95°C - 45 seconds,
53°C - 30 seconds, 72°C - 4 m inutes (35 cycles) and 72°C - 4 m inutes (1 cycle).
The resu ltin g 3.8 kb extension p roduct was isolated and purified from a
0.8% agarose gel u sing the QIAEX II gel extraction kit (Qiagen). The next stage
in isolating a recom binant plasm id containing the oriT deletion m utant was to
re-ligate the linear PCR product. O ne option w as to digest and re-ligate the
EcoRI restriction targ et sites th at w ere incorporated on to the ends of the PCRp ro d u ct.
H o w ever, restriction targ et sites at the ends of PC R -products are
difficult to digest. To avoid this com plication another approach was used. One
key feature of u sing a polym erase enzym e w ith 5'-3' proofreading exonuclease
activity is th at a large p o p u latio n of the linear product have flush ends.
By
exploiting th is p ro p e rty , the P C R -product w as re-circularised by b lu n t-en d
ligation. The D N A w as then transferred by transform ation to DH 5a. Colonies
th at h a d gained a circularised plasm id w ere detected by their resistance to
am picillin. The deletion of the nic sequence from the resulting recom binant
plasm id, pN A 7, w as confirm ed by the inability of the plasm id to be m obilised
by plasm id pLG221 (Table 4.2.1).
4.2.3
Construction of pNA8 containing the omega (Q) intersposon
The next step involved the insertion of a selectable antibiotic resistance
gene carried by the om ega (D) intersposon into pNA7. The 2.0 kb fragm ent
carries a streptom ycin-spectom ycin resistance gene flanked by inverted repeats
w ith tran scrip tio n a n d tran slatio n term ination signals (Prentki and Krisch,
1984).
The Q frag m en t w as released from pHP45Q by EcoRI digestion and
ligated into the EcoRI site of plasm id pNA 7 to give pNA8 (Fig. 4.3, C). Like
pNA7, pNA 8 is also non-m obilisable by pLG221 (Table 4.2.1). Finally, further
to confirm the stru c tu re of the m u ta n t o r iT locus, pN A 7 and pNA 8 w ere
exam ined by restriction enzym e analysis (Fig. 4.4).
75
Fig. 4.4. Gel electrophoresis of restriction fragments of
pNA7 and pNA8.
Sm R/S PR
EcoRl
Ec oR l
2 kb
EcoRI
B
C lal
An i c
P stl
pNA7
3772 b p
(A) Samples in lanes are (1) X x Hzndffi; (2) pNA7 x P s t l / C l a l ; (3) pNA7 x
P s t l / C l a l / E c o R l ; (4) pN A 7 x EcoRI; (5) pN A 8 x P s t l / C l a l / ; (6) pNA8 x
Pst l/Clal/EcoRL; (7) pN A 8 x EcoRI; (8) X x H in d ll l. Fragments sizes are
presented in kb.
(B) Physical m ap of pN A 7 and the 2.0 kb Q. fragment, which on ligation
into the EcoRI site form s pNA8.
4.2.4
Construction of a Collb d rd mutant lacking the nic region
The oriTAnicuQ. m utation w as transferred by recom bination from pNA 8
to the C o l l b d r d plasm ids pLG221 (A rdA +) and pLG292 (ArdA'). The 3.1 kb Pstl Clal fragm ent w as released from pN A 8 by restriction enzym e cleavage and the
D N A tra n s fe rre d by tra n s fo rm a tio n into E. coli recD c o m p e te n t c e lls ,
DL307(pLG221) and DL307(pLG292).
T ransform ant colonies that w ere KmR,
Sm R, SpR and A ps w ere inferred only to contain Collbdrd plasm ids th at had
acquired the oriT An ic :: Q m u tatio n from pNA 8 and w ere chosen for further
ch aracterisation.
The rest of p N A 8 in clu d in g the region th a t encodes
ampicillin resistance w as presum ably degraded intracellularly.
R ecom binant C ollb p la sm id s p N A ll ( p L G 2 2 1 Anic: :Q ) and pN A 12
(pLG292Am c::Q) w ere isolated by th eir resistance to Km, Sm and Sp.
n a tu re of th e o r i T
am plification.
w ith in
The
each p la s m id w as c h arac terise d by PCR-
P rim ers B and C w ere used to am plify the o r iT regions of
plasm ids p N A ll, pNA12, pLG221, pN A 2 and pNA8 (Fig. 4.5). Any insertions
w ithin this region w ere detected d u rin g PCR-reactions by an increase in the
size of the am plification product. Results presented in Fig. 4.5 (B) show th at
p N A ll, pNA 12 and pN A 8 all have an additional 2.0 kb of DNA in the o r i T
locus, which is not present in pLG221 and pNA2 w hich carry the w ild type oriT
locus.
A lternatively, the n atu re of the o r iT locus w ithin these recom binant
p lasm id s could h av e been confirm ed by a S o uthern blot h y b rid isatio n
experim ent.
H o w ev er, d u e to the tim e constraints of this project, this
additional w ork w as not undertaken.
4.2.5
Conjugative properties of p N A ll and pNA12
Recom binant plasm ids p N A ll and pNA12 w ere tested for self-transfer
by conjugation. Test strains w ere m ade by transferring p N A ll and pNA12 by
transform ation into GI65N com petent cells and selecting for KmR, SmR and
76
Fig. 4.5. Analysis of the nature of the oriT within p N A ll and
pNA12 by PCR-amplification
SmR/SpR
E c° m
Clal
i
B
' J
p
nic p
E coR 1
P sfl
(not to scale)
(A) Relationship betw een prim ers B an d C used for PCR-amplification of the Collb
oriT locus. (-») represents the direction (5-3') and annealing sites of primer B and C.
Plasm id pNA2 and pLG221 carry an un d isru p ted oriT . Plasmids p N A ll, pNA12 and
pN A 8 are deleted of the nic region a n d contain the 2.0 kb Q insertion. Also show n is
the oriT operon prom oter (p) and nikA and nikB. The region between the annealing
sites of prim er B and C is 0.4 kb.
(B) PCR reactions w ere perform ed u sin g prim er B and prim er C with plasm ids
p N A ll, pNA12, pLG221, pNA 2 and pN A 8. Gel electrophoresis of the resulting
extension products and their sizes in kb are presented. Lanesl and 7 contain X
x H i n d U l m olecular w eight m arkers. Tem plates used w ere (2) p N A ll; (3) pNA12; (4)
pLG221; (5) pNA2; (6) pNA8. Faint b an d s at the ends of lane 2,3 and 6 are unused
prim er.
SpR. C onjugation experim ents w ere then set up on filters using a RifR recipient
strain (GI65R). A fter 40 m inutes, the num bers of recipients that had acquired
p N A ll or pN A 12 w ere scored by p latin g on NA plates containing Rif and Km.
No transconjugants w ere detected (< 2 x 10'6 relative to the transfer efficiency
of pLG221).
H ence, bo th p N A ll a n d pNA12 w ere found to be com pletely
defective in self-transfer by conjugation.
To confirm th a t p N A ll an d pN A 12 specify all t r a n s -acting tran sfer
functions test conjugations w ere set up to exam ine w h eth er each plasm id
could m obilise the sm all recom binant plasm id carrying Collb or iT+ (pNA2).
D onor strain s (J08) w ere m ade th a t harb o u red recom binant plasm id pN A 2
and either p N A ll or pNA 12.
T hese donors w ere then m ated w ith a RifR
recipient strain for 40 m inutes on filters.
After such tim e, the num bers of
pN A 2 transconjugants w ere exam ined by plating on NA plates containing Rif
an d Ap.
Both p N A l l and pN A 12 w ere able to m obilise pNA2 w ith an
efficiency of 1.0 from a r ec A h o st relative to pLG221 directed m obilisation
(Table 4.2.1). In su m m ary p N A ll an d pNA12 are inferred to specify all of the
tran s -acting p roteins required for conjugation but to contain a cis -acting lesion
p rev en tin g self-transfer.
These resu lts also confirm that each plasm id has
retained its D rd + phenotype.
Finally, the A rd A p h en o ty p es of p N A ll and pNA 12 w ere exam ined.
The test involved infecting an EcoKI restricting E. coli strain (GI65N) w ith a X,
v ir lacking EcoKI m odification (X v i r . 0) and exam ining the num ber of plaques
form ed.
In strains h a rb o u rin g p N A ll, the num ber of plaque form ing units
p ro d u ced by X vir.O w as 3.8 x 108 m l’1 com pared to 1.7 x 106 m l'1 form ed on
GI65N alone.
In contrast, the n u m b er of plaque form ing units produced on
Y
1
strain s h a rb o u rin g pN A 12 w as 8.0 x 10 m l' (A ppendix I). These results
confirm that p N A ll has an A rdA + and pNA12 an A rdA ' phenotype.
77
4.3
Discussion
R esults in this chapter detail the successful construction of a specific
m u tatio n w ith in the or iT of Collbdrd.
The resulting m utants, p N A ll (D rd+,
A rd A +) and pN A 12 (D rd+, ArdA'), w ere completely defective in self-transfer by
conjugation.
H ow ever, the ability of p N A ll and pNA12 to specify all other
transfer functions w as confirm ed by the m obilisation of an oriT+ recom binant
p lasm id w ith a m axim al efficiency (Table 4.2.1).
In sum m ary, p N A ll and
pNA12 specify all the t r a n s - acting p ro tein s required for conjugation, yet,
contain a cis- acting lesion w ithin the o r iT preventing self-transfer.
Several n o tab le observations w ere m ade du rin g the construction of
these m utants an d they are described below .
N u c leo tid e seq u en ce sim ilarities are only found betw een the o r i T
stru ctu res of closely related plasm id s (Furuya and Komano, 1991).
This is
co nfirm ed as th e n u c le o tid e sequence of the o r i T of Collb only shares
significant seq uence sim ilarities w ith the published or iT sequence of closely
related In cll p lasm id R64 (section 4.2.2). Significant sequence similarities exist
betw een the nic regions of different conjugative plasm ids (Lanka and W ilkins,
1995). These sim ilarities have been organised into three groups presented in
C hapter O ne, Fig. 1.2.
These findings are further supported here, as the nic
region of C ollb b e ars 100% identity w ith the corresponding region of R64,
w hich in tu rn belongs to a family of nic regions harbouring the consensus 5'Y A T C C T G ^ Y -3 '.
O th er m em bers of this group include plasm ids from the
incom patibility g ro u p P and sequences from the Ti plasm id of Agrobacterium,
tumefaciens (Lanka a n d W ilkins, 1995).
The location and sequence of the Collb oriT nic site was confirmed by an
ap p ro ach alternative to m ore conventional m ethods described by Furuya and
K om ano (1991) (see C h ap ter One, section 1.3.2).
First, the location of the
p u tativ e Collb nic region w as identified by alignm ent of the oriT sequence data
w ith the consensus sequence 5'-YATCCTG^Y-3'. Secondly, the legitimacy of
the p red icted nic sequence w as confirm ed by the inability of recom binant
78
plasm id s, w h ich h ad been relieved of their nic sequence, to be m obilised by
C o llb d rd (Table 4.2.1).
This w hole approach w as enabled by the extensive
database on or iT regions.
It h as b e en p ro p o se d th a t the In c ll conjugation system m ay have
evolved follow ing fusion of two distinct types of conjugative plasm id (Rees et
al., 1987).
Such a concept arose from the findings th at In cll plasm ids and
plasm id F carry genes w hich h av e alm ost identical functions.
These genes
in clu d e p s i B an d s s b , w hich are fo u n d w ith in the leading regions of both
plasm id F an d Collb (C hapter O ne, sections 1.6.1 and 1.6.2). In addition, the
nucleotide sequences of these Collb genes share significant sim ilarity to those
of plasm id F, w hich indicates a com m on ancestry. In contrast, the oriT of Incll
plasm ids Collb and R64 share sim ilar properties to the oriT of IncP plasm ids
RP4 and R751 (Lanka and W ilkins, 1995). The oriT of both Collb and R64 can
be found situ ated adjacent to the leading region of each plasm id.
If the hybrid
hypothesis is correct th en there m u st be a point w ithin the leading region of
these tw o In c ll p lasm id s w here sequence sim ilarities w ith plasm id F diverge.
U nfortunately, the lack of sequence data available for the leading region of
plasm id F has p rev e n ted this point from being determ ined. How ever, w ork is
currently u n d e rw ay to determ ine the com plete nucleotide sequence of F.
Plasm id C ollbdrd only specifies one particular species of oriT. Removal
of 14 b p from a ro u n d the nic site elim inated the p la sm id 's ability to self­
transfer by conjugation. These results rule out the possibility of another o r iT
stru c tu re b ein g p re se n t on Collb other th an that d eterm ined by Rees et al.
(1987). If a second o r iT w ere present on Collbdrd, then transfer of the plasm id
by conjugation w o u ld not be elim inated by a lesion in the orthodox oriT locus,
unless the second o r iT operates u n d er alternative conditions to those induced
d u rin g intraspecific conjugations betw een E. coli.
79
Chapter Five
Analysis of the Alleviation of Type I and Type II Restriction Using
Non-Transferable Mutants p N A ll and pNA12
5.1
Introduction
C o n ju g a tiv e tra n s fe r of C o l l b d r d is an essential req uirem ent for
expression of the p lasm id 's anti-type II restriction alleviation function.
The
p u rp o se of th is c h ap ter is to determ in e the stage d u rin g conjugation w hen
restrictio n -allev iatio n occurs; is it m atin g -p air form ation, DNA transfer or
th ro u g h o u t th e cycle?
To test this, the C o l l b d r d o r i T m u tan t described in
C hapter Four w as exam ined for its ability to confer protection on transferring
R751.
O th er e x p erim en ts described include exam ining w hether the C o l l b d r d
or iT m u ta n ts im m o b ilised in d o n o r strains could protect transferring R751
from EcoKI an d EcoRI restriction.
5.2
Results
5.2.1
Rescue of R751 from EcoRI restriction by C ollb d rd o r i T m utant p N A ll
This section is aim ed at determ ining the stage in the Collb conjugation
cycle w h en EcoRI restrictio n is alleviated. An interrupted m ating experim ent
was p erfo rm ed on filters using a donor strain harbouring R751 and an EcoRI
restricting recipient h a rb o u rin g p N A ll. The num bers of R751 transconjugants
form ed in the restricting recipients w ere m easured throughout the experim ent
and the results are p resen te d in Fig. 5.1 (A). Over a 40-m inute period the yield
of R751 tran sco n ju g an ts p ro d u ced in recipients harbouring p N A ll w as very
sim ilar to th at p ro d u c e d in a recipients harbouring pLG221. Such results rule
out the possibility th a t the alleviation function is expressed during the act of
DNA transfer.
80
Fig. 5.1. Transfer of R751 to an EcoRI restricting recipient harbouring p N A ll.
(A) R751 tran sconjugants from conjugations of GI65R(R751) d o n o rs and either
recip ien ts GI65N (O, control), GI65N (N TP14) (#, c o n tro l), GI65N (N TP14,
pLG221) (■, control) or GI65N(NTP14, p N A ll) (♦). (B) R751 tran sco n ju g an ts
from conjugations of GI65R(R751) d on ors and recipients G I65N (O, control) or
GI65N(NTP14) ( • , control) and GI65R(R751, p N A ll) d o n o rs an d recip ien t
GI65N(NTP14) (■).
T ransconjugants w ere selected on N A p la te s containing
N al and Tc. D ata are the m ean values of three experim ents.
Log^Q transconjugants per ml
K>
4^
Log^Q transconjugants per ml
ctq’
CO
N>
o
3
n>
B
Time (min)
H O
o
o
4*
On
Qo
*
To explore the potential role of m ating-pair form ation in the alleviation
of EcoRI restriction, it w as exam ined w hether p N A ll could confer the sam e
degree of p ro tec tio n on transferring R751 w hen p resen t in the donor rather
th a n th e rec ip ie n t.
The p re d ic tio n is th at R751 sh o u ld be pro tected if
restriction is alleviated by the act of form ing m ating pairs. To this end, a donor
strain h a rb o u rin g R751 and p N A ll w as m ated w ith an EcoRI restric tin g
recipient. P lasm id p N A ll is transfer defective and will n o t be able to transfer
itself. H ow ever, the plasm id encodes all other transfer functions including the
ability to form m a tin g pairs.
The yields of R751 transconjugants form ed
d uring such experim ents are presented in Fig. 5.1 (B). These results show quite
clearly th a t n o p ro te c tio n is co n ferred on R751 by p N A ll in the donor,
suggesting th at restriction-alleviation is not a product of the act of m ating-pair
fo rm atio n .
In a d d itio n , this re su lt show s th at alleviation of restrictio n
req u ire s th e p re se n c e of the C o l l b d r d plasm id in the restricting strain.
T herefore, th e p o te n tia l for the genetic pathw ays involved in m ating-pair
form ation b eing im plicated in restriction-alleviation cannot be ruled out.
O ne im p o rta n t discovery, w hich w as m ade d u rin g these experim ents,
w as that the EcoRI p ro d u cin g plasm id NTP14 was m obilised to the R751 donor
stra in b y th e C o llb d rd plasm id in the restricting recipient.
This issue is
exam ined fu rth er in the follow ing section.
5.2.2
M obilisation o f the EcoRI producing plasmid NTP14 by Collbdrd
It w as o b se rv e d d u rin g experim ents described in section 5.2.1 th at
plasm id NTP14, w h ich encodes the type II R-M system EcoRI, w as m obilised
from a stra in also h a rb o u rin g a C ollbdrd plasm id.
To test this further, an
in te rru p te d m atin g experim ent w as set up on filters betw een a donor strain
h arb o u rin g b o th NTP14 and Collbdrd and a RifR recipient strain. The num bers
of NTP14 tran sco n ju g an ts pro d u ced w ere m easured by selecting for RifR and
A p R cells (Fig. 5.2). It is clear from these data that Collbdrd plasm ids pLG221
and p N A ll are able to m obilise plasm id NTP14 efficiently. A lthough plasm id
81
Fig. 5.2. M obilisation of NTP14 by Collb.
NTP14 tran sco n ju g an ts from conjugations of G I65N (N TP14, pLG221) (□) or
G I65N (N TP14, p N A ll ) (O) and G I65N (N TP14, pLG 272) (A) d o n o rs a n d
recip ien t GI65R.
T ransconjugants w ere selected on N A p la te s containing Rif
a n d Ap. D ata are the m ean values of tw o experim ents.
Log^Q transconjugants per ml
hrj
N3
O
H
• *1•
3n>
3M*
3
OJ
o
o
<X\
00
p N A ll cannot tran sfe r itself, it still specifies all functions required in trans for
transfer.
A t 40 m in u te s, p N A ll m obilised NTP14 w ith an efficiency of 1.0
relative to pLG221 directed m obilisation (Fig. 5.2). In contrast, the num ber of
NTP14 tran sco n ju g an ts w as red u ced by 141-fold w hen the mobilising plasm id
was Collb w ild typ e. This red u ctio n can be attributed to the repression of the
Collb conjugation system .
The p o ten tial im plications of these findings is that during experim ents
described in section 5.2.1 C ollbdrd directed m obilisation of NTP14 to R751
donors m ay result in R751 being m odified at its EcoRI target sites before entry
to the EcoRI restrictin g recipients. Therefore, the R751 plasm id w ould acquire
EcoRI protection before entry. This notion is exam ined further in C hapter Six.
5.2.3
A n o n -tra n sfe ra b le C ollbdrd confers no EcoKI protection on R751
In C h a p te r T hree, the genetic pro ced u re involving plasm id R751 w as
used to show th at th e A rdA system of Collb operates optim ally w hen specified
by a tra n sfe rrin g p la sm id (Fig. 3.5 A and Fig. 3.6 C).
H ow ever, from such
results it w as im possible to determ ine in w hich strain enhanced production of
the A rdA p ro te in o ccu rred .
It m ig h t occur in the donor strain if the A rdA
protein is tra n sfe rre d to the recipient d u rin g conjugation, as is the Collb Sog
pro tein (Rees a n d W ilkins, 1989).
To test this idea, an in terru p ted m ating
experim ent w as p e rfo rm e d on filters u sing a donor strain harbouring bo th
R751 an d p N A ll( A r d A + ) w ith an EcoKI restricting recipient. Samples of the
m atin g
m ix w e re
re m o v e d
transconjugants (Fig. 5.3 A).
and
e x am in e d
for th e n u m b e r of R751
R esults clearly show th at p N A ll is unable to
confer any p ro tec tio n on tran sferrin g R751 DNA from destruction by EcoKI.
Such a finding ru les o u t the possibility th at the A rdA protein is transm issible
by conjugation.
A sim ilar m a tin g ex p erim en t w as carried out using an R751 donor
strain h a rb o u rin g pN A 12(A rdA ') (Fig. 5.3 B). Again, no significant increase in
the n u m b er of R751 tran sco n ju g an ts w as observed.
82
Like ArdA , the second
Fig. 5.3.
T ransfer of R751 from a donor harbouring p N A ll(A r d A +) or
pNA12(ArdA") to an EcoKI restricting recipient.
(A) R751 tran sco n ju g an ts from co njugations of NM 654R(R751) d o n o rs an d
e ith e r
re c ip ie n ts
N M 816N
(O,
c o n tro l)
or
G I65N
NM 654R(R751, p N A ll ) d o n o rs a n d re c ip ie n t G I65N
(# ,
(■).
c o n tro l)
(B )
and
R751
tra n s c o n ju g a n ts from c o n ju g atio n s of NM 654R(R751) d o n o rs a n d e ith e r
rec ip ie n ts N M 816N (O, control) or GI65N (#, control) a n d NM 654R(R751,
pN A 12) d o n o rs an d recipient GI65N (■).
N A p la te s c o n ta in in g N al and Tc.
ex p erim en ts.
T ransconjugants w ere selected on
D ata are the m e a n v a lu e s of th re e
Fig. 5.3
Log^p transconjugants per ml
EcoKI, ArdA+
-O '
6
-
4-
0
10
30
20
Tim e (min)
40
LogiQ transconjugants per ml
EcoKI, ArdA
6
-
4-
0
10
20
30
Time (min)
40
EcoKI allev iatio n function encoded b y Collb is not transm issible through the
donor.
In stead , the alleviation process requires the presence of Collb in the
restricting strain.
5.2.4
C ollb d rd transfer does not m ediate retrotransfer of NTP14
D ata p re s e n te d in section 5.2.2 clearly show s th at Collbdrd is able to
efficiently m obilise plasm id NTP14. It is proposed th at Collbdrd m ight itself
evade d e stru ctio n by EcoRI d u rin g conjugation by m ediating retrotransfer of
NTP14 from th e recip ien t cell to th e d onor cell; such that transm ission of
NTP14 to the d o n o r cell resu lts in th e im m ediate expression of the gene
encoding the EcoRI m ethylase en zy m e w hich in tu rn m odifies all 20 EcoRI
target sites p re se n t on the backbone of Collbdrd before the plasm id enters the
restrictin g re c ip ie n t by conjugation.
The phenom enon of retrotransfer has
been described as the transm ission of chrom osom al or plasm id DNA from the
recipient cell to th e d onor cells su p p o rtin g conjugation (Sia et al., 1996). If this
is how Collb ev ad e s type II restriction then it m ight explain the 6-10 m inute
delay in C ollbdrd tran sco n ju g an t form ation in an EcoRI restricting recipient
harbouring NTP14 (Fig. 3.2 A). The delay being attributed to the time taken for
transm ission of N TP14 to the d onor and m ethylation of the 20 EcoRI targ e t
sites present on C ollb. Also, the requirem ent for m ultiple rounds of transfer of
Collbdrd to the restrictin g recipient could be explained in that this is required
to initiate retro tran sfer of NTP14.
To test th is idea an in te rru p te d filter m ating experim ent was perform ed
betw een a d o n o r stra in h arb o u rin g Collbdrd plasm id pLG221 and a recipient
strain h a rb o u rin g NTP14.
The n u m b er of pLG221 transconjugants produced
an d th e n u m b e r of d o n o r cells th a t acq u ired NTP14 w ere m e a su re d
th ro u g h o u t the m a tin g (Table 5.2.1).
No donor cells that acquired plasm id
NTP14 w ere d e te c te d th ro u g h o u t th e 40-m inute d u ratio n of the m atin g
experim ent d esp ite successful transm ission of pLG221 to the EcoRI restricting
recipient. These resu lts suggest th at transfer of Collbdrd cannot potentiate the
83
Table 5.2.1. Analysis of Collb-mediated retrotransfer of mobilisable plasmid NTP14
Donor
Recipient
pLG221
NTP14
Transconjugants ml"1
Transconjugants ml-1
GI65R(pLG221)
GI65N
2.6 x 107
GI65R(pLG221)
GI65N(NTP14)
1.0 x 107
<10
2.0 x 107
1.1 xlO 7
GI65N(pLG221/ NTP14) GI65R
1
Equal numbers of donors and recipients cells were mixed together to give a concentration of 108 cells of
each strain per ml. A 40 minute filter mating was performed at 37°C. The numbers of pLG221 (KmR)
and NTP14 (ApR) transconjugants were determined by plating the mating mix on NA plates containing
the appropriate antibiotic selection. Plasmid NTP14 is mobilised with a frequency of 0.55 relative to the
transfer of pLG221, where mobilisation frequency is the number of mobilised plasmids transferred per
conjugative plasmid.
retrotransfer of NTP14. This is therefore not how C o l l b d r d evades destruction
by type II restriction enzym e, EcoRI.
5.3
Discussion
Three im p o rta n t conclusions can be d raw n from data in this chapter.
First, the Collb A rd A p ro tein is n o t transm issible from the donor. Evidence is
th at a C ollbdrd (p N A ll) plasm id im m obilised in a donor strain could confer
no protection on tran sfe rrin g R751 from EcoKI restriction in the recipient (Fig.
5.3 A). In contrast, C ollbdrd (pLG221) itself confers com plete protection of R751
(C hapter 3, Fig. 3.5 A). These experim ents indicate that enhanced expression of
the a r d A gene occurs in the recipient cell shortly after entry of the C ollbdrd
plasm id.
Second, like A rdA , the com ponents m aking up the unidentified a r d A independent anti-ty p e I system are n o t transm issible by conjugation (Fig. 5.3 B).
In sum m ary, a llev iatio n of EcoKI restrictio n by Collb (ArdA') can only occur
w ithin the cell th a t contains the plasm id. The m echanism by which restriction
is alleviated is ex p re ssed constitutively by a drd+ and drd Collb plasm id (see
C hapter Three).
T hird, C o llb d rd -m ed ia te d alleviation of EcoRI restriction appeared to
occur d u rin g the fo rm atio n of m ating-pairs (Fig. 5.1 A). Further experim ents
indicated th at th e m ech an ism has to be expressed in the strain encoding the
restrictio n sy stem (Fig. 5.1 B).
T hese experim ents led to the finding th at
C o llb d rd is able to m obilise efficiently the EcoRI p ro d u cin g plasm id NTP14
(Fig. 5.2).
It m ay be possible th at m obilisation of NTP14 to the R751 donor
results in the m o d ifica tio n of R751 EcoRI target sites before the plasm id is
transferred to the restricting recipient. If such a hypothesis were correct, then it
w ould explain a n u m b e r of observations m ade du rin g experim ents described
in C h a p te r T hree.
T hese include th e initial lag in R751 transconjugant
p ro d u ctio n in re stric tin g recipients h arb o u rin g Collbdrd (Fig. 3.6 A). The lag
reflects the tim e ta k e n for NTP14 to be m obilised to R751 donors and for
84
com plete m e th y la tio n of the R751 replicon. This issue w ill be ad d ressed
furth er in C h ap ter Six.
A n o th e r o u tco m e of th is fin d in g w as th a t it p ro v id e d a possible
explanation as to how Collbdrd itself m ight avoid destruction by EcoRI during
conjugation.
The idea being th a t C ollbdrd m ediates retrotransfer of NTP14
from the recipient to the Collbdrd d onor resulting in m odification of the EcoRI
target sites of th e plasm id. H ow ever, results in Table 5.2.1 clearly show this not
to be the case.
The p o ssib ility th at a r d A -in d e p e n d e n t alleviation of EcoKI by Collb is
m ediated by m obilisation of the EcoKI R-M genes can be ruled out by the fact
that these genes are located on the E. coli chrom osom e.
One o th er dilem m a that needs to be addressed is that m obilisation of the
EcoRI R-M genes sh o u ld result in som e killing of recipient cells. All these
issues involving the m obilisation of NTP14 are addressed in C hapter Six.
85
Chapter Six
Construction of a mob Mutant of Plasmid NTP14
6.1
Introduction
D ata in C h a p te r Five clearly show ed that C ollb d rd is able to mobilise
efficiently th e EcoRI p ro d u c in g p la sm id NTP14 w hen resident in the same
strain (Fig. 5.2). The aim of this chapter is to establish w hether the protection
conferred on tra n sfe rrin g R751 (Fig. 3.6 A) from EcoRI restriction is CoXSbdrdm ed iated or the co n seq u en ce of N TP14 m obilised to the R751 donor.
To
address this d ilem m a it w as necessary to construct a m utant of NTP14, w hich
was unable to be m obilised by a conjugative plasm id.
D etails c o n cern in g the n a tu re and organisation of NTP14 are lim ited.
The only p u b lish e d d a ta available is in Smith et al. (1976), w ho reported that
NTP14 w as isolated as a recom binant plasm id present in a strain of E. coli after
an u n id en tified f i + R -factor encoding the EcoRI R-M system and a num ber of
antibiotic resistan ce d e te rm in a n ts w as m obilised by F-like plasm id R1-19K*.
NTP14 is 17 kb in size an d has a copy num ber of -14 per chromosome. The
plasm id encodes th e ty p e II R-M system EcoRI, resistance to am picillin and
colicin E l.
From D N A -D N A re-association experim ents, the com position of
NTP14 w as d e te rm in e d to be m ade u p of 33% NTP1, 33% ColEl and 34% Rl19k* (Smith et al., 1976).
The e x p e rim e n ta l d esig n for creating and isolating a mob m utant of
NTP14 w as m ad e difficu lt d u e to the lim ited data available for the plasm id.
C onsequently, several attem p ts w ere m ade to isolate a m utant. The first was
based on the fact th a t NTP14 shares 33% of its genom e w ith ColEl. The mob
region of C olE l consists of a nic site also know n as bom (basis of mobility) and
four related m o b genes, m b e A , mbeB, m b e C and m b e D (Boyd et al., 1989). Like
NTP14, C olEl also possess a unique Clal cleavage site, which in ColEl is located
in the largest m o b gene, m b e A (Boyd et al., 1989). Based on the fact that each
86
plasm id co n tains a un iq u e Cl a l cleavage site, it w as assum ed that NTP14 had
inherited its m o b region from C olE l. The Clal site of NTP14 was utilised for
the insertion of an antibiotic resistance m arker gene w ith the aim of disrupting
the p u ta tiv e m o b region.
H o w ev e r, none of the recom binant p lasm id s
isolated, typified by pNA 14, dem onstrated a Mob' phenotype.
The se co n d a tte m p t to iso late a M ob' m u ta n t of NTP14 involved
ra n d o m
tr a n s p o s o n
m u ta g e n e sis
of the p la sm id
u sin g Tn5.
Several
N T P 1 4 ::T n 5 in se rtio n s w ere iso lated ; yet, again n o n e determ ined a M ob'
phenotype. The failure of these tw o attem pts m ay be the consequence of the
p lasm id 's copy n u m b e r such th at th e recom binant plasm ids m ay be p a rt of a
m ixed p o p u la tio n w h ere the original NTP14 plasm ids are able to provide the
m issing function. This prevents the M ob' phenotype from being expressed.
The fin al a tte m p t to iso late a. m u ta n t invo lv ed cloning restrictio n
fragm ents of N TP14 into a non-m obilisable cloning vector w ith the aim of
isolating a reco m b in an t plasm id w ith an R ri+, Mob" phenotype. The choice of
cloning vector for these experim ents w as critical. It w as im portant to choose a
vector th at could n o t be m obilised by Collbdrd yet had a sim ilar copy num ber
to th at of NTP14.
C lo n in g vector pBR322 has a copy num ber of -2 2 p er
chrom osom e b u t w as unsuitable for these experim ents as it carries the ColEl
b o m reg io n a n d can th erefo re be m obilised by a n u m b er of conjugative
p lasm ids (Finnegan an d Sherratt, 1982). Instead, cloning vector pBR328 w as
chosen, w h ich is a d eriv ativ e of pBR322 b u t does not carry the ColEl b o m
sequence (Soberon et al., 1980; Sam brook et al., 1989).
To th is e n d , e x p e rim e n ts d escrib ed in this c h ap ter include; first,
restrictio n en zy m e an aly ses of p lasm id NTP14; Second, the details of the
cloning of restriction fragm ents of NTP14 into pBR328 as well as the tests used
to d eterm in e w h ic h reco m b in an ts w ere R ri+, Mob'; T hird, the transm ission
kinetics of R751 a n d C ollbdrd to a recipient cell harb o u rin g the Rr i+, M ob'
recom binant are described to confirm the restriction phenotype, and finally the
c o n ju g a tio n e x p e rim e n ts are d e sc rib e d , w h ich d e te rm in e w h e th er the
87
protection conferred on transferring R751 from EcoRI restriction is m ediated by
C o llb dr d in th e recipient or the consequence of NTP14 being mobilised to the
R751 donor.
A d d itio nal experim ents described in this chapter include exam ining the
viability of u n m o d ified recipient cells th at acquired the transm itted EcoRI R-M
genes by conjugation.
6.2
Results
6.2.1 Restriction analysis of plasm id NTP14
As a p re re q u isite to the cloning of restriction fragm ents of NTP14 a
physical m ap of the p lasm id h a d to be generated.
C onstruction of the m ap
involved restrictio n enzym e analysis of NTP14 using enzym es that cleave the
plasm id no m ore th a n twice. These enzym es included H m dlll, Clal, Sail, Bgll l
and Bam H l. To g enerate useful d ata for m apping the cleavage sites on NTP14,
single, double an d trip le digests w ere perform ed. The combinations used and
the resu ltin g re stric tio n d ata o b tain ed are p resen ted in Table 6.2.1.
The
restriction m ap of NTP14 is presented in Fig. 6.1 A.
The location of the EcoRI R-M genes on NTP14 is unknow n. How ever,
the location of th ese genes is k n o w n for E. coli plasm id R113.
The EcoRI
re stric tio n e n d o n u c le a s e an d m e th y la se genes are fo u n d w ith in close
proxim ity of each o th er an d span 2.2 kb of R113. The nucleotide sequence of
these genes a n d su rro u n d in g regions has been d eterm ined and contains an
in tern al 1.8-kb H m d lll fragm ent 1.4-kb upstream of a Sail site (Greene et a l ,
1981; EMBL: J01675). Interestingly, NTP14 also has a 1.8 kb H m dlll fragm ent
located 1.4-kb from a u n iq u e Sail site (Fig. 6.1 A). From these similarities it is
p rop o sed th a t the EcoRI R-M genes of NTP14 lie in the vicinity of the 1.8 kb
H zndill fragm ent. C onsequently, the strategy for cloning fragm ents of NTP14
w ith the aim of iso la tin g recom binants th at are Rri+ w as based around this
observation.
88
Table 6.2.1 Restriction data for NTP14 (17 kb)
Gel No.
Lane No.
Digest
1
2
HindUl
15.2
3
Bglll
17
4
Clal
17
5
Sail
17
6
Hindll/BglU
15.2
1.6
0.2
7
HindU l/Clal
11.1
4.1
8
H indU l/C lal/
Bglll
11.1
4.1
1.8
1.6 0.2
9
Clal/Bglll
11.3
5.7
10
11
S a il / C la l
9.7 7.3
13.8 1.8
9.7 4.1
2
Sail/HindUl
12
Sail/H indU l/
Clal
2
Ba m H l
3
Bam H l/H indlU
4
BamHl/Sail
5
Bam H l/H indU l/
Sail
Fragment sizes (kb)
1.8
1.4
1.8
17
9.5
8.9
5.7 1.8
8.1
8.1
5.7
1.8 1.4
Gel 2
G e ll
■
1 2 3 4 5 6 7 8 9 101112
1.4
1
2
3
4
5
Restriction fragm ents of NTP14 w ere separated on 0.8% agarose gels by
electrophoresis. X x H i n d U l m olecular weight markers were run in lane 1 of
each gel. The size of each restriction fragm ent of NTP14 was calculated and
is shown in kb next to each gel and in the above table. Faint bands running
at 3.8 kb in gel 1, lanes 2-5 and 10-11 and gel 2, lanes 2-5 are uncut NTP14.
Fig. 6.1. Diagram depicting the construction of recom binant plasm ids pN A 16
and pNA17.
(A )
P h y sical m a p of 17 kb p la sm id NTP14 sh o w in g th e ta rg e t sites for
restrictio n e n zy m es H m d lll, B g ll l, C la l , B a m H l and S ail.
ru n from th e u n iq u e C la l site.
EcoRI R-M genes ('
C o-ordinates in bp
A lso show n is the su sp ec ted location of the
as fo u n d on plasm id R113 on a 2.2 kb fra g m e n t
o v erlap p in g the 1.8 kb H m dlll fragm ent (Greene et ah, 1981; EMBL database acc.
no. J01675). M ap w as com piled using the restriction d ata in Table 6.2.1.
(B) NTP14 w as digested w ith Sail and Clal yielding tw o fragm ents of 7.3 kb and
9.7 kb in size.
T hese tw o frag m en ts w ere ligated in to the 4.2 kb S a l l - C l a l
frag m en t of cloning vector pBR328 (th in line), form ing pN A 16 a n d pN A 17,
resp ectiv ely .
p N A 17 carries the EcoRI system ; pN A 16 does not.
recom binants are non-m obilisable.
B oth
Fig. 6.1
Clal
N T P14
H m d lll
12900
17000 bp
Bglll
11330
H m d lll
11100
Sal I
9700
B
EcoRI
Ball
PstI
EcoRI
Bal l
Clal
Pstl
Clal
Ava
Ava I
S a il
' on
pN A 17
11585 bp
p cS
Sal I
H m d lll
H m d lll
N ot To Scale
Bglll
pN A 16
13985 bp
6.2.2
Construction of pNA16 and pNA17
It is p ro p o se d th at the EcoRI R-M genes of NTP14 overlap the 1.8 kb
H indU l frag m ent of the plasm id.
To isolate recom binant plasm ids that carry
these genes an d n o t the mob region of NTP14, a strategy w as em ployed, which
involved cloning fragm ents of NTP14 avoiding d isru p tin g the 1.8 kb H m d lll
fragm ent an d s u rro u n d in g region.
To this end, the 7.3- and 9.7-kb Cl al -S al l
frag m en ts of N T P14 w ere rem o v e d by restriction enzym e digestion and
isolated from a 0.8% agarose gel after separation by electrophoresis. Both the
7.3- and 9.7-kb fragm ents w ere p urified from the agarose using the QIAEX II gel
extraction kit (Q iagen) and ligated into the 4.2 kb Clal -Sa ll portion of pBR328
form ing reco m b in an ts pN A 17 an d pN A 16, respectively (Fig. 6.1 B). Isolation
of these reco m b in an t plasm ids w as achieved by transferring the ligated DNA
by tran sfo rm atio n to D H 5 a com petent cells. T ransform ant colonies that w ere
A p R, C m R and Tcs w ere inferred to carry the vector and a cloned insert at the Tc
gene. C onstructs w ere confirm ed initially by restriction enzym e analysis.
6.2.3
Characterisation of pNA16 and pNA17
C h a ra c te ris a tio n
of re c o m b in a n ts pN A 16 a n d
pN A 17 in v o lv e d
exam ining th e m o b ilisatio n and restriction phenotypes of each plasm id. The
Rri p h en o ty p es of pN A 16 and pN A 17 w ere exam ined by infecting their E. coli
host strain (GI65N) w ith a X vir lacking EcoRI m odification and exam ining the
n u m b er of p la q u e s form ed.
The e.o.p of X v i r . K w as 1.0 in GI65N(pNA16)
relative to its p la sm id free host a n d 0.001 in GI65N(NTP14). In contrast, the
e.o.p of X v i r . K on strain s h arb o u rin g pNA 17 w as 0.001 (A ppendix I). These
resu lts co n firm th a t p N A 17 h as a Rr i + p h e n o ty p e and pN A 16 an Rr i‘
p h en o ty p e, as p re d ic te d from restrictio n enzym e cleavage com parisons of
NTP14 w ith R113 (Fig. 6.1 A). It w as assum ed that pN A 17 m ust also carry the
EcoRI m ethylase gene to p re v e n t the host strain from attack by the EcoRI
endonuclease c o m p o n en t.
89
Table 6.2.2. Mobilisation of recombinant plasmids pNA16 and pNA17 by Collbdrd
Transconjugants per ml
Donor
GI65N(pLG221, NTP14)
GI65N(pLG221, pBR328)
GI65N(pLG221, pNA16)
GI65N(pLG221, pNA17)
’'Mobilisation
frequency
Recipient
pLG221
GI65R
2.7 x 107
2.4 x 107
It
4.3 x 107
<10
< 2.3 x 10’7
H
3.1 x 107
<10
< 3.2 x 10-7
H
1.5 xlO 7
<10
< 6.7 x 10‘7
Recombinant plasmid
0.88
The frequency of transfer of each plasmid was determined after a 40 minute filter mating at 37°C, using
GI65N as the donor host strain and GI65R as the recipient. Plasmids pNA16, pNA17, pBR328 and
NTP14 all confer resistance to ampicillin. Helper plasmid pLG221 confers resistance to kanamycin.
Transfer of pNA16, pNA17, pBR328 and NTP14 was measured by plating the mating mixture on NA
plates containing Ap (100 pg ml"1) and Rif (25 pg m l'1) and transfer of the helper plasmid measured by
plating on NA plates containing Km (25 pg m l'1) and Rif (25 pg m l'1). ^Mobilisation frequency is the
number of mobilisable plasmids transferred per conjugative plasmid.
R ecom binants pNA 16 and pN A 17 were then tested for their ability to be
m obilised by C ollbdrd.
Test strains w ere m ade by transferring pNA16 an d
pNA17 DN A by transform ation to GI65N(pLG221) and selecting for KmR, A pR
and C m R.
C o n ju g atio n e x p erim e n ts w ere set u p on filters using d onors
described in T able 6.2.2 an d a recip ien t strain (GI65R).
At 40 m inutes, the
num bers of recipients that h a d acquired either pNA16 or pNA17 were scored
by plating on N A p lates containing Rif and Ap (Table 6.2.2). Despite efficient
transfer of pLG221, n either pNA16 n o r pNA17 w as detected in recipient cells.
These results co nfirm th at the cloning strategy described in section 6.2.2 w as
successful in iso lating a recom binant plasm id that w as Mob’. In addition, these
results also su g g est th at the mob region of NTP14 m ust overlap either the Cla l
site or the S a l I site w h e re NTP14 w as cleaved as a p re lu d e to m ak in g
constructs.
To
e x a m in e
f u r th e r
th e
re s tric tio n
p ro p e rtie s
of pN A 17, th e
tran sm issio n k in e tic s of pLG221 a n d R751 to a recipient h arb o u rin g the
recom binant w ere m easu red . Two separate conjugation experim ents w ere set
up on filters u sin g either GI65R(pLG221) or GI65R(R751) as donors and a N alR
recipient h a rb o u rin g pNA 17. The yields of pLG221 and R751 transconjugants
are show n in Fig. 6.2 A and B, respectively. EcoRI restriction still has the sam e
effect on the tra n sm issio n of pLG221 and R751 if it is encoded by NTP14 or
pNA17. These resu lts confirm th at pN A 17 is a suitable non-m obile source of
the EcoRI R-M genes.
Finally, th e colicin E l p roducing phenotypes of pNA16 and pNA17 w ere
exam ined. E xperim ents w ere perform ed as described in C hapter Two, section
2.3.1. Test strains GI65N, GI65N(pNA16), GI65N(pNA17) and GI65N(NTP14)
were exam ined for colicin pro d u ctio n using GI65N as an indicator strain. Only
strain GI65N(NTP14) w as found to be colicin producing (data not show n),
suggesting th at th e colicin E l gene, cea , of NTP14 overlaps either the Cl a l or
Sail cleavage site of the plasm id.
A dditionally, pNA16 and pNA17 w ere also
exam ined for th e ir ability to confer im m unity against the lethal effects of
90
Fig. 6.2.
Transfer o f pLG221 and R751 to a recip ien t strain harbouring
recom binant plasm id pNA17.
(A) pLG221 tran sco n ju g an ts from conjugations of GI65R(pLG221) donors an d
recipients G I65N (O, control), GI65N(NTP14) (#, control) a n d G I65N (pN A 17)
(■). (B) R751 tran sco n ju g an ts from conjugations of GI65R(R751) d o n o rs an d
e ith e r
re c ip ie n ts
GI65N (pN A17) (■).
G I65N
(O, co n tro l); G I65N (N T P 14)
(# ,
c o n tro l)
or
T ransconjugants w ere selected on N A p la te s contain in g
eith er N a l/K m or N a l/T c.
►
n
era
L°gio transconjugants per ml
NJ
^
<T>
Logio transconjugats per ml
KJ
00
N3
O
M_
3M1
O
Time (min)
H
* i#
9
(D
a\
NJ
O
w
o
o
^
ON
00
colicin E l on th eir ho st strain. GI65N(NTP14) w as used as the test strain and
GI65N, G I65N (pN A 16), G I65N (pN A 17) and GI65N(NTP14) as the indicator
strains. O nly pN A 16 and NTP14 w e re able to confer any protection on their
hosts strains in d icatin g th at the colicin E l im m unity gene, z'ram, of NTP14 can
be found lo cated so m ew h ere w ith in the 9.7 kb C l a l - S a l l fragm ent of the
plasm id (Fig. 6.1 A).
6.2.4
Collb cannot alleviate EcoRI restriction in trans
To d e te rm in e w h e th e r the p ro te c tio n conferred on transferring R751
against EcoRI restriction (Fig. 3.6 A) is C ollb-m ediated or due to m obilisation of
NTP14 to th e R751 d o n o r, a c o n ju g atio n experim ent w as carried out using
pN A 17.
M a tin g e x p e rim e n ts w e re set u p on filters betw een a d o n o r
harbouring R751 an d a recipient h a rb o u rin g pLG221 and pNA17. Sam ples of
the m ating cells w ere rem oved at intervals and exam ined for the num bers of
R751 tra n sc o n ju g a n ts p ro d u c e d .
F igure 6.3 clearly show s that no EcoRI
protection is co nferred on tran sferrin g R751 by ColVodrd w hen the R-M genes
cannot be m o b ilise d to the R751 d o n o r.
These resu lts confirm th a t the
protection o rig in a lly conferred on R751 from EcoRI restriction, as show n in
Fig. 3.6 A, is n o t C ollb-m ediated. Such protection m ust be due to m obilisation
of NTP14 to th e R751 d o n o r strain an d subsequent m ethylation of R751 before
transfer.
Therefore, it seem s likely th a t any evasion of EcoRI restriction observed
d u rin g tran sfer of C o U b d r d (Fig. 3.2 A) m ust be due to a m echanism that can
only operate on ColVodrd rather th an a trans -acting m echanism as suggested in
C hapter Three (section 3.2.3). Such findings explain w hy no significant EcoRI
protection is co n ferred on R751 by C ollb d r d w hen the tw o plasm ids are co­
transferred together (Fig. 3.3 A).
91
Fig. 6.3.
T ransfer of R751 to a recip ient harbouring b o th C o llb d r d and
recombinant plasm id pNA17 (R-M
r i
+ ).
R751 tra n sc o n ju g a n ts from co njugations of GI65R(R751) d o n o rs a n d e ith e r
recipients G I65N (O, control); GI65N(pNA17) (•); GI65N(pLG221, pN A 17) (■)
or G I6 5 N (p N A ll, pNA17) (A).
containing N al an d Tc.
T ransconjugants w ere selected on N A p lates
LogiQ transconjugants per ml
Fig. 6.3
6
-
4-
0
10
20
30
T im e (m in)
40
6.2.5
C onjugative transfer of the EcoRI R-M genes causes some k illin g of
recipient cells
Type II R-M genes are considered to be selfish as they tend to im pose
selective p re s s u re fo r the m ain ten a n ce of the plasm id that encodes them
(Naito et ah, 1995; O 'N eill et ah, 1997). H ow ever, this is not necessarily true for
type I R-M system s. As described in C hapter One, section 1.5.3, the restriction
activity of the EcoKI enzym e in a new E. coli host strain is m odulated by the
ClpXP p ro tease en zy m e leaving its m odification activity in tact. The result of
EcoKI re stric tio n a ctiv ity b e in g m o d u la te d is very little cell death after
tran sm issio n of th e R-M genes to a new unm odified host (M akovets et ah,
1998).
It has b e en sh o w n in experim ents described in this thesis that plasm id
NTP14, w hich encodes the type II R-M system EcoRI, is mobilisable by Collbrfri
(Fig. 5.2). This o bservation raises the question of how recipients of the plasm id
su rv iv e th e a c q u isitio n of the n ew R-M genes.
This section is aim ed at
exam ining th e consequences for an unm odified E. coli strain of receiving the
EcoRI R-M genes by transfer of the plasm id NTP14.
The e x p erim e n t involved m ating donors harbouring p N A ll and NTP14
and an u n m o d ified recip ien t strain.
The conjugations w ere set up on filters
and the n u m b e rs of NTP14 tran sco n ju g an ts p ro d u ced w ere determ ined at
intervals d u rin g th e m ating.
The yield of NTP14 transconjugants w ere then
co m p ared to th e in p u t n u m b er of recipient cells in o rder to evaluate the
viability of th e rec ip ie n ts after th e acquisition of the EcoRI R-M genes. As a
u sefu l c o n tro l, a sim ila r e x p e rim e n t w as p e rfo rm ed u sing a recip ien t
h a rb o u rin g pJH 16.
T his is a recom binant plasm id th at carries the EcoRI
m ethylase gene (H e itm an et ah, 1989). The results of these experim ents are
p re se n te d in T ab le 6.2.3.
It is clear from th e percentage of NTP14
transconjugants p ro d u c e d in an unm odified host com pared to those produced
in a host carrying pJH 16 that conjugative transfer of the EcoRI R-M genes on a
plasm id m u st h av e resu lted in som e recipient cell death, although the effect is
92
Table 6.2.3. Analysis of the viability of an unmodified E. coli strain during the acquisition of the EcoRI R-M genes by
conjugation
Donor
GI65N(pNAll, NTP14)
GI65N(pNAll, NTP14)
NTP14
transconjugants per ml
Recipient
Time
(min)
GI65R
0
7.5 x 107
0
ND
5
5.3
4.0 x 106
10
7.3 x 107
4.5 x 107
20
1.5 xlO 7
30
3.4 x 107
20
1.5 x 107
40
2.4 x 107
16
1.2 xlO7
0
6.5 x 106
0
<10
5
5.2 x 106
15
1.0 x 106
10
4.6 x 106
30
2.0 x 106
30
9.0 x 106
46
3.0 x 106
40
8.0 x 106
81
5.3 x 106
GI65R(pJH16)
Recipients per ml
*% transconjugants
Equal numbers of donors and recipient cells were mixed together and a filter mating was performed at 37°C for 40 minutes. Samples
of the mating cells were removed at intervals and examined for the number of NTP14 transconjugants by plating on NA plates
containing Rif (25 pig ml4 ) and Ap (100 pg ml4 ). Throughout the experiment the number of recipient cells were monitoured by plating
samples of the mating mix on Rif plates. Helper plasmid p N A ll carries a cis-acting lesion within the oriT which prevents its self­
transfer. However, the plasmid still specifies all other transfer functions in trans. Plasmid pJH16 is a recombinant plasmid carrying the
EcoRI methylase gene. * % transconjugants were calculated by comparing the input number of recipient cells/m l to the number of
NTP14 transconjugants/m l produced. Numbers are the mean value of three experiments.
m inim al. T hese resu lts suggest th at, like other type II plasm id-encoded R-M
system s te s te d (N a ito et al., 1995), the EcoRI g en es also display selfish
behaviour. The fact th at n o t every recipient cell is killed by EcoRI could be due
to either the activ ity of rep air system s em ployed by th e E. coli host strain to
m end D N A cleavages or p ro d u c tio n of the m ethylase p rio r to synthesis of the
endonuclease.
6.3 Discussion
R esults in th is ch ap ter d e ta il the successful isolation of a recom binant
plasm id w ith an R ri+, M ob' p h enotype. The plasm id, pNA17, was isolated by
cloning th e 7.3 kb C l a l - S a l l fra g m e n t of NTP14 in to vector pBR328.
In
addition, pN A 17 w as inferred to specify a sim ilar R r i+ phenotype to NTP14 as
determ in ed d u rin g ex p erim en ts exam in in g the transm ission kinetics of bo th
R751 and ColT bdrd to a recipient h arb o u rin g either NTP14 or pNA17 (Fig. 6.2).
D u rin g th e c o n stru c tio n of reco m b in an t pN A 17, several other notable
o b se rv a tio n s
w e re
m ade
w h ic h
f u rth e r
c h a ra c te rise NTP14.
T hese
observations are described below.
The cloning of th e tw o C l a l - S a l l fragm ents of NTP14 resulted in the
generation of tw o recom binant p lasm id s, pNA16 and pNA17, neither of w hich
w ere m obilisable b y Col Vo dr d (Table 6.2.2). These findings indicate that the
mob region of N TP14 m u st overlap either the Clal or Sail site of the plasm id.
If the m o b reg io n of N TP14 is h o m o lo g o u s to th at of plasm id C olEl, then
com parisons b e tw ee n the restriction data for the tw o plasm ids w ould suggest
that d isru p tio n is d u e to cleavage by Clal (Section 6.1).
Such cloning ex p erim en ts w ere also useful in indicating that the colicin
El gene (cea) of NTP14, w hich m u st have been inherited from ColEl, can be
found o v erlap p in g eith er the Cl a l or Sail cleavage sites of the plasm id (section
6.2.3).
H ow ever, e x am in a tio n of the nucleotide sequence of ColEl revealed
that there are no C l a l or S ai l cleavage sites present w ith in cea. It seems m ore
likely th a t th e ce a g en e of N TP14 is n o t o v e rla p p in g one of these tw o
93
restriction sites a n d th at som e o th er explanation is necessary. Furtherm ore, it
w as show n b y S m ith et al. (1976) th at about 1 /3 p o rtio n of NTP14 (~ 5.6 kb)
consists of C o lE l D N A . For b o th the mob region an d cea gene of NTP14 to be
inherited from C o lE l and be d isru p te d by Clal and Sail is impossible as these
two sites are 7.3- a n d 9.7 kb a p a rt (Fig. 6.2). One possibility is that the ColEl
derived D N A in NTP14 carries an insertion or is interspersed throughout the
NTP14 genom e.
D espite these com plications, the colicin E l im m unity gene
imm w as fo u n d located w ithin the 9.7 kb Clal-Sall fragm ent of NTP14 (Fig. 6.1).
F urther w o rk is re q u ire d to locate the exact locations of these three loci on
NTP14.
D espite the in terestin g observations that w ere m ade during the course of
the w ork d e scrib e d in this ch ap ter, only one im p o rtan t conclusion could be
draw n, w hich is rele v an t to the m ain b o d y of this thesis. That is, that C o l l b d r d
does n o t allev iate EcoRI restrictio n in trans d u rin g its conjugative tran sfer
(section 6.2.4, Fig. 6.3). It ap p ears th at Collb itself evades EcoRI restriction by a
cis- acting a n ti-restrictio n function rath er than a tr an s - acting one as previously
su g g ested (C h a p te r T hree, section 3.2.3).
Such fin d in g s explain w h y no
significant p ro tec tio n is conferred on R751 by C o l l b d r d against EcoRI restriction
w hen the tw o p la sm id s are co-transferred together (Fig. 3.3 A). In addition, the
h y potheses th a t co n ju g ativ e tran sfe r of Collbdrd alleviates EcoRI restriction
either by alterin g th e physiological state of the recipient cell or by substrate
saturation of the restrictio n enzym es can now be ruled out as both w ould have
a trans- acting effect. H ow ever, the possibility that Collb carries another anti­
restriction gene c an n o t be ru led out, although the p ro d u ct of this gene w ould
have to act in-czs.
T hese a ssu m p tio n s w ill be discussed further in C hapter
Eight.
O ne o th er o b se rv atio n m ade d u rin g this w ork w as that transfer of the
EcoRI R-M g en es b y co n ju g atio n decreases, only slightly, the viability of
recipient cells. P resu m ab ly , any killing is due to the detrim ental effects of the
endonucleolytic a ctiv ity of the EcoRI restriction enzym e on the unm odified
94
h o st genom e of the recipient cell.
C onstruction of a restriction m u tan t of
NTP14 for use in a control experim ent w ould have been useful in confirm ing
th at killing of recipient cells is due to the EcoRI restriction enzym e and no
o th er p la sm id -en c o d ed function.
The results of tran sfe rrin g this m u tan t
p lasm id to un m odified recipient cells could have been used to compare w ith
the results obtained using w ild type NTP14 (Table 6.2.3). U nfortunately, due to
the tim e co n straints of the project this useful NTP14 m u ta n t w as not m ade.
As an alternative control, a strain harbouring recom binant plasm id pJH16 w as
used as a source of a recipient w ith a m odified genom e.
H ow ever, to w hat
ex ten t the stra in s genom e is m ethylated as a result of h arb o u rin g such a
p lasm id is n ot know n. Despite this, results in Table 6.2.3 suggest that the slight
decrease in viability of recipient cells acquiring plasm id NTP14 is due to the
acq u isitio n of g en es encoding the EcoRI restriction endonuclease.
results will not be discussed further in this thesis.
95
These
Chapter Seven
Determination and Analysis of the Nucleotide Sequence
Of the Collb Leading Region
7.1
Introduction
This c h a p te r is concerned w ith the determ ination and analysis of the
n u cleo tid e seq uence of the Collb leading region. A lthough peripheral to the
m ain b o d y of th is thesis, such an investigation w as useful in pro v id in g an
in te re stin g in sig h t in to a relatively uncharacterised region of a conjugative
p lasm id .
The lea d in g reg io n is defined as the first segm ent of a conjugative
p lasm id to en ter th e recipient cell du ring bacterial conjugation. To date, only
th ree genes h av e b e e n identified w ithin this region of C ollb, w hich are ssb,
p s iB an d a r d A .
A lth o u g h not essential for conjugation, the products of these
genes h av e been sh o w n to play an im portant ancillary role in plasm id DNA
m etab o lism (Loh et al., 1989; Jones et al., 1992; Read et ah, 1992; see C hapter
O ne, section 1.6). Each gene is expressed early in a transient b u rst in the new ly
in fe c te d tra n s c o n ju g a n t cell p ro m o tin g estab lish m en t of the im m ig ran t
p la sm id (H ow land et al., 1989; Jones et al., 1992; Althorpe et al., 1999). H ow the
e x p re ss io n of th e se g en es is enhan ced d u rin g c o n ju g atio n is u n k n o w n .
H o w ev er, a n u m b er of hypotheses exist (Chapter One, section 1.6.5).
The aim of th is ch ap ter is to use the sequence d ata for a num ber of
p u rp o s e s in c lu d in g d e te rm in in g the genetic o rg a n isa tio n of the region,
id e n tify in g m ore p o te n tia l pro tein coding regions and, th ro u g h sequence
co m p ariso n s, d e te rm in in g their possible function or evolutionary ancestry. It
w a s also h o p e d th a t ind icatio n s of the possible m echanism for enhanced
ex p ressio n of these genes during conjugation m ight be revealed.
The w ork described in this chapter is the result of a joint effort w ith Dr
S. B ates, a p o st-d o c to ra l researcher in this laboratory.
96
The recom binant
p lasm id s co n structed by m yself and S. Bates for sequencing the Collb leading
region are described in Fig. 7.1. Of the 11.7 kb of sequence data generated, 6.4 kb
w as o b tain ed d u rin g this w ork and the other 5.3 kb by S. Bates. Analysis of the
sequence d ata w as a joint effort.
o b ta in e d
d u r in g
th e
W ith the perm ission of Dr S. Bates, all data
c o lla b o ra tio n
is p re se n te d
w ith in
this ch ap ter.
E xperim ents described include the strategy used to clone and sequence 11.7 kb
of th e C ollb le a d in g region and the com puter-based analyses em ployed to
identify in terestin g features w ithin the resulting sequence data.
N o attem p ts w ere m ade to identify prom oters w ithin the leading region
by exam ining the sequence data for the classical -10 and -35 RNA polym erase
b in d in g
and
re c o g n itio n c o n sen su s sequences.
S tu d ies of n u m e ro u s
collections of p ro m o te rs identified in £. coli has led to a divergence from the
o rig in al co n sen su s sequences p ro p o sed by Pribnow (-10) and M aniatis (-35)
w here a base su b stitu tio n at each position is possible. Such degeneracy has led
to the conclusion th a t a p rom oter can be found every 200 bp of sequence. Use
of the consensus sequences to identify prom oters has to be treated w ith caution
an d an y c a n d id a te s m u st be considered arbitrary until functional data are
obtained (H enaut an d D anchin, 1996).
7.2
Results and Discussion
7.2.1
Strategy for determ ining the nucleotide sequence of the Collb leading
reg io n
The leading reg io n of Collb is found located adjacent to the oriT w ithin
the larg est EcoRI (E l) frag m en t of the plasm id (Fig. 7.1 A). The length of the
lead in g region is estim ated to be ~ 17 kb from oriT to the genes encoding UV
p ro tectio n functions (imp). To generate a library of subclones suitable for DNA
se q u en cin g , sm aller restric tio n fragm ents of the region w ere isolated from
e ith e r pCRS4 or pCRS3 (Rees, 1986; Rees et al., 1987) an d ligated into the
ap p ro p ria te cleavage sites of cloning vector pIC19H (Fig. 7.1 C). Recombinants
97
Fig. 7.1. Schem e sh ow ing the construction of a sm all library of subclones used
to generate the 11.7 kb nucleotide sequence of the Collb lead in g region.
(A) Physical m ap of the large EcoRI (E l) fragm ent of C ollb, w hich encom passes
the leading region an d p art of the tran sfer region in c lu d in g or iT and the o r i T
o peron. R estriction enzym e cleavage sites are indicated by B (BglTL), C {Clal), E
(EcoRI), P (Psfl) and S {Sail). Also indicated are the p o sitio n s of ssb, psiB, a r d A
a n d the nic site w ith in oriT.
(B)
S chem atic d ia g ra m sh o w in g th e stra te g y d e v is e d to d e te rm in e th e
n u cleo tid e seq uence of both DNA stra n d s of the C ollb lead in g region.
O ne
a rro w (5'—► 3 ') m ay represent m ore th an one sequencing reaction to g enerate
d a ta for one stra n d of the c o rresp o n d in g subclone.
P rim ers u se d in th ese
sequencing reactions are in C hapter Two, Table 2.1.4.
(C) L ibrary of subclones constructed to generate sequence data for the C ollb
lead in g region.
R estriction enzym e cleavage sites are indicated.
Subclones
generated from pCRS4 (Rees, 1986) an d the resulting sequence data w ere by S.
Bates.
Subclones gen erated from recom binant pN A 3 a n d resulting sequence
d a ta was p a rt of this w ork w ith the exception of pLG290 (Read et al., 1992). The
source of the in sert for pNA 3 w as pCRS3 (Rees et al., 1987). Subclones pR R 2-l
(Roscoe, 1996) pN A 6 and pCRS4 w e re used to g en erate sequence d a ta over
restriction enzym e cleavage sites. The A rdA p h en o ty p es of pN A 6 an d pLG290
w ere exam ined and the results are sh o w n in A ppendix I.
Fig. 7.1
kb
8
10
12
16
14
18
El fragment
20
Transfer
operon
Leading region
“
I-------
II------nic
EPS
l LL
M r
PCB_ P
i
psiB
ssb
~
1
P
I llT I i
ardA
oriT
5'
3'
3'
5'
B
pRR2-l
pCRS3
SS
pCRS4
pNA3
pNA6
pSBCPl
I
f
pSBCP2
! pLG290
P
s
|pSBSP21
|
P P
I I
pNA13
P
P
I pNAlO |
u
pNA9
C
pNA2
J
pLG 290 (Read et al., 1992) an d pN A 2 (A lthorpe et al., 1999; C hapter Four,
section 4.2.1) w ere isolated during other studies.
A ttem p ts w ere m ade by S. Bates to subclone the region upstream of ssb.
H o w ev er, all recom binants isolated resulted in rearrangem ents of the Sall-Pstl
insert.
Such a p h en o m e n o n has also been described by H ow land et al. (1989)
d u rin g the cloning of S4, w hich is a Sail fragm ent internal of the E l fragm ent
of C ollb (Fig. 7.1 A ). U nfortunately, d u e to time constraints this problem w as
n o t reso lv ed an d consequently no sequence data are available beyond 400 bp
u p stre a m of ssb.
Sequence reactions w ere perform ed as described in C hapter Two using
eith er M 1 3 /p U C u n iv ersal forw ard or reverse prim ers or a specially designed
p rim er as described in Table 2.1.4. Each subclone was sequenced completely on
b o th stra n d s a cc o rd in g to the strategy show n in Fig. 7.1 B.
G eneration of
se q u en ce d a ta o v e r restrictio n enzym e cleavage sites w as achieved u sin g
specifically d esig n ed prim ers and one of the larger subclones, pCRS4, pNA6 or
p R R 2 -l.
The seq u en ce data generated from these reactions, com bined w ith the
d ata g enerated for the oriT region (C hapter Four, Fig. 4.2) w ere com piled using
the GEL set of p ro g ram s from the GCG package to give a contig of 11,712 bp in
length. The raw sequence data was then annotated and is show n in Fig. 7.3. In
a d d itio n , this d a ta can also be found in the EMBL database accession num ber
AJ238399. M uch of this w o rk is also published in Bates et al. (1999).
7.2.2
Id e n tific a tio n of p u ta tiv e p ro te in coding reg io n s (or/s) in the C ollb
le a d in g region
To identify p u ta tiv e protein coding regions w ithin the leading region of
C ollb th e seq u en ce d a ta generated w as analysed u sing the GCG p ro g ram
CO D O N PREFEREN CE a n d the £. coli codon usage table of highly expressed
genes (G ribskow et al., 1984; H enaut and D anchin, 1996).
Furtherm ore, the
tra n sla tio n table w a s altered so that as well as ATG, GTG start codons w ere
98
Fig. 7.2. Protein coding regions encoded by Collb leading region.
P utative p ro tein coding regions (or/s) and previously id en tife d genes (ssb, psiB
an d ardA) w ere identified by analysis of the Collb leading region sequence data
u sin g the GCG p ro g ram CODONPREFERENCE (w indow 25 bp) and the E. coli
codon usage table of highly expressed genes. Only or/s w ith ATG or GTG start
codons w ere searched for.
Panel A sh o w s the analysis ru n n in g from ssb tow ards th e nic site of the oriT.
P an el B show s the analysis ru n n in g in the opposite o rie n ta tio n from the n ic
site to ssb. N ote th at the potential or/s identified, and ssb, psiB and a r d A are all
transcribed tow ards oriT.
Codon preference
Codon preference
OJ
N>
o
T
■■3
aj
iJ
Or4
o
o
ij
(ft
cr
ir>
il
w
in co rp o rated in to the analyses. Both orientations of the 11.7 kb sequence w ere
an aly sed an d the CODONPREFERENCE statistical plots and orfs identified are
sh o w n in Fig. 7.2. In total, ten orfs (Fig. 7.2 and Table 7.2.1) w ere identified,
th ree of w h ic h in clu d e p rev io u sly identified genes ssb, psiB and a r d A . The
m ost com m on sta rt codon w as ATG found for eight of the ten orfs, w here the
GTG sta rt co d o n w as found for or fl and or/3. TGA w as the only stop codon
fo u n d .
A d d in g to th e authenticity of these potential orfs, good m atches to the
Shine-D algarno consensus sequence (3'-AUUCCUCCACUGCAU-5') (M athew s
and v an H olde, 1990) for ribosom e binding were located for each orf betw een 48 b p u p stre a m of each sta rt codon.
These ribosom e-binding sites (r b s ) are
indicated in Fig. 7.3.
The m o st strik in g feature of these new ly identified orfs is that like ssb,
psiB an d a r d A , th ey are all orientated in the same direction tow ards oriT. Such
a fin d in g raises the possibility th at these genes m ight be transcribed as p a rt of
an o p e ro n ra th e r th a n as single separate units.
In addition, the biological
significance of th is o rganisation of the leading region m ay be th at the D N A
stra n d d e stin e d for tran sfer (T -strand) form s the tem plate strand for m R N A
synthesis. This m ay be im p o rtan t to ensure that each gene is expressed soon
after infection of th e recipient cell by the im m igrant plasm id.
The co d in g regions of all the orfs identified w ere translated u sing the
co m p u ter p ro g ra m 'G ene Jockey IT (BIOSOFT). Both the nucleotide and am ino
acid seq u en ces of th ese coding regions w ere com pared to other sequences
p re s e n t in th e d a ta b a se s EMBL, GenBank and Sw issProt, available via the
W orld W ide W eb (C hapter Two).
7.2.3
Sim ilarities b etw een D N A and protein sequences found in the leading
region to those present in the databases
A tte m p ts
w e re
m a d e to
d e te rm in e the p o te n tia l fu n ctio n
and
ev o lu tio n ary h isto ry of the orfs identified w ithin the leading region of Collb.
99
A n aly ses in v o lv e d co m p arin g specific regions of eith er the nucleotide or
p red ic te d am ino acid sequences of the leading region to those available w ithin
the d a tab ases EMBL, GenBank and Sw issProt. The GCG program s used for
these co m p ariso n s w ere FASTA, BLAST and TFASTA (Pearson and Lipm an,
1988; A ltsc h u l et al., 1990; H e n a u t a n d D anchin, 1996).
H ow ever, once
p o te n tia l h o m o lo g u e s had b een id en tified , the GCG p ro g ram BESTFIT w as
often u sed to d eterm ine the am ount of sim ilarity and identity betw een the tw o
seq u en ces.
P o te n tia l seco n d ary stru c tu re s w ithin p ro tein sequences w ere
identified u sin g the GCG p rogram MOTIF.
In th e first p lace, seq u en ce com parisons in volved the p re v io u sly
id en tified genes ssb, psiB and a r d A to establish if any new hom ologues could
be fo u n d w ith in th e d atab ases to th o se found w hen the genes w ere first
sequenced (H o w land et al., 1989; Jones et al., 1992; Delver et al., 1991).
N o new hom ologues w ere fou nd for both ssb and psiB, despite the fact
th at a n u m b e r of p lasm id s are know n to carry ssb- and psz'B-like sequences
(Golub et al., 1988). H ow ever, a n u m b er of errors w ere found in the original
sequence of p s i B , w h ich on correction resulted in both the nucleotide and
p red icted am ino acid sequence form ing a better alignm ent w ith the tw o other
seq u en ced psiB genes of plasm id F an d R6-5 (Dutreix et al., 1988). F and R6-5
PsiB p ro tein s are th e sam e size as Collb PsiB (144 residues) and display 85.4%
and 84.6% id en tity to the Collb protein respectively.
Such alignm ents suggest
th at a stro n g er relationship exists betw een the genes of Collb, F and R6-5 than
p reviously suggested by Jones et al. (1992).
T hro u g h cross-hybridisation studies hom ologues of the Collb ar dA gene
have b een found on a n u m b er of enterobacterial plasm ids including m em bers
of th e I com plex (Il-B-K ), IncN and IncFV plasm ids (Chilley and W ilkins,
1995). Sequence sim ilarities have also been dem onstrated betw een Collb A rd A
an d those of p lasm id s R16 (IncB), pKM lO l (IncN) and F0lac (IncFV), displaying
94.0%, 60.5% an d 56.4% identity, respectively. D uring our analyses w e found
tw o n ew h o m o lo g u es of Collb A rdA , w hich w ere Orf79 of plasm id pM T l of
100
Yersinia pestis (causative agent of bubonic plaque) and O rfl8 of the conjugative
tr a n s p o s o n
Tn916.
The p re d ic te d am ino acid sequences of these A rdA -
h o m o lo g u es sh are 55% and 25% identity w ith that of Collb ArdA, respectively
(H u et ah, 1998; EMBL accession n u m b er AF053947; Clewell et al., 1995).
A nalysis of the or f found w ith in the sequence at base positions 8002-7283
(Fig. 7.3) rev ealed a sim ilarity to the p s i A genes of plasm id F and R6-5 (Loh et
al., 1989).
Like p s i A of F and R6-5, Collb p s i A also overlaps the TGA stop
cod o n of the p s i B gene, w hich suggests that these tw o orfs are co-ordinately
expressed from th e sam e transcript. The Collb PsiA protein, w hich is predicted
to b e 239 a m in o acid resid u e s in length, shares 63.4% id en tity to the
co rresp o n d in g p ro te in s of F and R6-5 w ith the m ajority of am ino acid changes
lo cated in th e C -term in a l region of the peptide.
The function of PsiA of
p lasm id F an d R6-5 is unknow n although unlike PsiB it is not believed to be
in v o lv ed in SOS in h ib itio n as PsiB confers the m ajor Psi phenotype (Bailone
et al., 1988).
The la rg e st o r f identified w ith in the sequence w as or/6, which can be
fo u n d located b e tw ee n ssb and psiB at base positions 10527-8488 (Fig. 7.3). The
p re d ic te d am in o acid sequence of Orf6 is 679 am ino acid residues w ith a
m olecular w eig h t of 74 kDa (Table 7.2.1). Com parisons of the sequence of Orf6
w ith those fo u n d in the databases identified only one full-length hom ologue,
Orf81 of Yersinia pestis plasm id pM T l (53% identity). The function of Orf81 is
u n k n o w n (H u et al., 1998). O ther hom ologues identified included m em bers of
the SpoOJ fam ily of pro tein s, w hose functions include DNA partitioning, and
the KorB tran scrip tio n a l repressor of IncP plasm id RP4. These proteins share
20-30% id e n tity w ith O rf6 over 200 am ino acids resid u es.
From these
c o m p a riso n s, it is p re d ic te d th a t Orf6 m ight be a DN A b in d in g p ro tein ,
a lth o u g h th e p ro te in exhibits an overall net negative charge (Table 7.2.1).
H o w e v e r, fu rth e r e v id e n ce to su p p o rt this notion is th at the am ino acid
sequence of O rf6 contains a potential Helix-Turn-Helix (HTH; residues 186-205)
of the A raC fam ily type. Furtherm ore, a potential P-loop structure is identified
101
Table 7.2.1. Orfs identified in the Collb leading region.
ORF
Co-ordinates
Amino acid
Mr
from nic
Residues
(kDa) t
Net charge
Motifs §
N otes
ssb
11316-10789
175
19.2
3
ssDNA binding
ssDNA -binding protein
orf6
10529-8490
679
74.3
-18
P-loop HTH motif
coiled coil
DNA binding?
p s iB
8435-8001
144
15.9
-8
-
Inhibitor of SOS induction
psiA
8004-7285
239
27.7
3
-
U nknow n
orf5
7155-5980
391
43.9
40
ardA
5531-5030
166
19.2
-25
orf4
4301-3867
144
16.5
2
orf3
3775-3590
88
10.5
6
orf2
3444-2503
313
35.8
-9
orfl
1409-561
282
32.2
-3
Possible transposase
A ntirestriction protein
-
U nknow n
U nknow n
ya d D
hom ologue
U nknow n / m ethy lase?
t Mr was predicted using the PEPTIDESORT program from the GCG package version 9.2 (Genetics com puter group, 1997)
§ Motifs were detected using the GCG program MOTIFS searching against the PROSITE database. Predicted helix turn helix (HTH)
using the GCG program s HTHSCAN and COILSCAN respectively. Table is taken from Bates et al., (1999).
at resid u es 178-185, w hich is indicative of an A TP/G TP biding site motif. Both
these regions of Orf6 have a net positive charge (Table 7.2.1).
T here is suggestive evidence th at expression of or/6 is enhanced during
co n ju g ativ e tra n sfe r of Collb, since a protein of sim ilar size (82-kDa) to the
p red ic te d Orf6 w a s found to increase in relative concentration during bacterial
co n ju g atio n (Jones et al., 1992).
The or/5 locus can be found at base position 7153-5978 in the sequence
(Fig. 7.3). The p re d ic te d am ino acid sequence of Orf5 is 391 residues w ith a
h ig h n e t p o sitiv e charge (Table 7.2.1). C om parisons of the sequence of Orf5
w ith o th er p ro te in s p resen t in the databases revealed extensive hom ologies to
the p ro te in -c o d in g reg io n s found w ith in a n u m b er of u n u su al in sertio n
elem en ts (IS) all rela te d to IS892. In fact, sim ilarities w ere detected over the
full le n g th of O rf5 to th e probable transposases of IS elem ents IS! 253 of
Dichelobacter
n o d o s u s (41% identity, 52% sim ilarity; Billington et al., 1996;
EMBL: U34772); IS 1 3 4 1 of therm ophillic bacterium PS3 (39% identity, 51%
s im ila r ity ,
M u ra i
et al.,
1995); IS605 (t n p B ) of He lio cb a c te r
pylori
cag
p ath o g en icity isla n d (34% identity, 45% sim ilarity, Censini et al., 1996; EMBL:
U95957) a n d I S 8 9 1 of C y an o b acteriu m A n a b a e n a sp. (39% identity, 44%
sim ilarity; B ancroft a n d W olk, 1989; EMBL: M24855). Hence, the p ro d u ct of
or/5 ap p ea rs to be a transposase (Table 7.2.1). O ur analysis also revealed that
like th e IS elem ents m en tio n ed above, the N -term inal 120 am ino acids of Orf5
h a v e a h ig h d e g re e of hom ology to VirE (81% identity) and VsdF (79%
id e n tity ) , w h ic h
Salmonella
a re
e n c o d e d by v iru le n c e -a sso c ia te d
t y p h i m u r i u m and Salmonella
p lasm id s from
d u b l i n , respectively (Gulig et al.,
1992; K rause et al., 1991).
N o in v e rte d re p e a t sequences th at are classically associated w ith the
en d s of IS elem ents could be found su rrounding or/5. H ow ever, as found for
1ST253, an im p e rfec t d irec t repeat sequence w ith internal dyad sym m etry,
p o ssib ly d irectin g tran sp o sase recognition, was found flanking orf5 (Fig. 7.3).
Interestingly, th e location of or/5 corresponded to a region of the sequence that
102
Fig. 7.3. 11.7 kb D N A sequence of the C ollb leading region.
F e a tu re s sh o w n in clude the
/ lGTG sta rt a n d
stop codons of ssb,
p s i B , p s i A , a r d A , o r f l , orf2, orf3, orf4, o r f 5, a n d or/6.
T he associated ribosom e
b in d in g site (rbs) of each o r f is u n d e rlin e d .
A m ino acid sequences d ed u ced
fro m th e D N A sequences of all orfs a re p re s e n te d w h e re th e start of each
tra n s la te d am ino acid is in uppercase. All orfs are tran scrib ed in the rightw ards
d ire c tio n (5 '—► 3 '). Restriction enzym e cleavage sites are B g ll l, Clal, P s t l and
Sail.
T he s s i sites (indicated by single lines) are p u ta tiv e p ro m o te rs for rig h tw ard s
tra n sc rip tio n of the transferring D N A stra n d . T hese ssi sites w ere identified by
th e ir sim ila rity in sequence to F r p o , w h ic h fu n c tio n s as a sin g le-stra n d ed
p ro m o te r in p lasm id F (Masai a n d A rai, 1997; EMBL: D90178).
T he n ic site is indicated (A) an d the d ire c tio n of tra n sfe r of the plasm id to the
re c ip ie n t d u rin g conjugation from this site is from rig h t to left (5-3').
Im p e rfe c t
( Z . _______
d ir e c t
re p e a ts
fla n k in g
orfS in
th e
T -s tra n d
and are:
5945 5' -TGCTCCCCGCCCTG - TCGGGCGAGGCTTCCC-3' 5974
7233 5 ’- TCCTCCCCACCCGCATTGGGCGAGGGTTCTC-3' 7263
are in d ic a te d
Fig. 7.3.
11712
AGACAGCGCGGCACTGGACGCGAGGGACGTGTGGACTGCCACACACTCCTTTGACGCGGA 1 1 6 b 5
1 1 6 5 4 CTACCGCGTCGTCAGAAGGGAGGACGGCGGTGGAGACGCCGGACAAAGGGCGACACCTGA 1 1 5 9 5
1 1 5 94
AAGGCCCCCCGTCTGCATTGGGGGAGGGCAAGGTAGACAGGTCCCACTCTACGTGGCCGG 1 1 5 3 5
1 1 5 3 4 TGTTTTAAAAATCGGTACTTGGGCCGTTTTTTAAAACGCAGGCGGGGGCCTGTCGACAGG 1 1 4 7 5
1 1 4 7 4 GCACTCCGCCATTTGCCCGGGGGTAGCCTTTCCAGGTGACGCCCCTCTTTGGGGACACTT 1 1 4 1 5
AAGGGGCACATGAACGTCCCGTCTCCGGT
----------------- + --------------------+ --------------------- + H 3 5 5
11414
CACCTGCCGTCCTCCTCGAAAGCGAGGAGACTTCCCCGTGTACTTGCAGGGCAGAGGCCA
11354
ATCCGGTTTATCTCACATCTTTCAGTCAGGAGGTTCT'ljATGlAGTGCACGTGGTATCAACA
-------------------- + ---------------------- + -------------------- + ------------------- + ------------------- + --------------------- + 1 1 2 9 5
TAGGCCAAATAGAGTGTAGAAAGTCAGTCCTCCAAGAATACTCACGTGCACCATAGTTGT
rbs
ssb
M e tS e r A la A r g G ly lle A s n L y s
11294
AGGTCATCCTCGTCGGGCGTCTGGGCAATGATCCGGAGGTCCGTTACATCCCCAACGGTG
-------------------- + ---------------------- + -------------------- + -------------------+ ------------------- + --------------------- + 1 1 2 3 5
TCCAGTAGGAGCAGCCCGCAGACCCGTTACTAGGCCTCCAGGCAATGTAGGGGTTGCCAC
V a l 1 1 e L e u V a l G l y A r g L e u G l y A s n A s p P r o G l u V a l A r g T y r I l e P r o A s n G ly G l y
PstI
g c g c a g t g g c a a a c c t g c a g Ig t g g c c a c g t c a g a a a g c t g g c g c g a c a a a c a g a c g g g g g
11234
--------------------+ ----------------------+ --------------------+ ------------------- + -------------------- + ---------------------+ 1 1 1 7 5
CGCGTCACCGTTTGGACGTCCACCGGTGCAGTCTTTCGACCGCGCTGTTTGTCTGCCCCC
A la V a lA la A s n L e u G ln V a lA la T h r S e r G lu S e r T r p A r g A s p L y s G ln T h r G ly G lu
AGATGCGGGAGCAGACGGAATGGCACCGTGTTGTGCTGTTCGGCAAGCTCGCGGAAGTGG
1 1 1 7 4 -------------------- + --------------------- + -------------------- + -------------------+ -------------------- +
+ 11115
TCTACGCCCTCGTCTGCCTTACCGTGGCACAACACGACAAGCCGTTCGAGCGCCTTCACC
M e t A r g G lu G lu T h r G lu T r p H is A r g V a lV a lL e u P h e G ly L y s L e u A la G lu V a lA la
CAGGTGAATATCTGCGCAAGGGCGCGCAGGTCTACATCGAGGGGCAACTCCGTACCCGTA
1 1 1 1 4 -------------------- + --------------------- + -------------------- + -------------------+ -------------------- +
+ 11055
GTCCACTTATAGACGCGTTCCCGCGCGTCCAGATGTAGCTCCCCGTTGAGGCATGGGCAT
G ly G lu T y r L e u A r g L y s G ly A la G ln V a lT y r lle G lu G ly G ln L e u A r g T h r A r g S e r
11054
GCTGGGACGACAACGGCATCACCCGCTACATCACTGAAATTCTTGTTAAGACCACGGGCA
--------------------+ ----------------------+ --------------------+ -------------------+ -------------------- +
+ 10995
CGACCCTGCTGTTGCCGTAGTGGGCGATGTAGTGACTTTAAGAACAATTCTGGTGCCCGT
T r p A s p A s p A s n G ly lle T h r A r g T y r lle T h r G lu I le L e u V a lL y s T h r T h r G ly T h r
10994
CCATGCAGATGCTGGGGAGTGCACCACAGCAGAACGCTCAGGCGCAACCGAAGCCTCAGC
-------------------- + ---------------------+ -------------------- + -------------------- + --------------------+
+ 10935
GGTACGTCTACGACCCCTCACGTGGTGTCGTCTTGCGAGTCCGCGTTGGCTTCGGAGTCG
M e tG ln M e tL e u G ly S e r A la P r o G ln G ln A s n A la G ln A la G ln P r o L y s P r o G ln G ln
10934
AGAATGGGCAGCCACAGAGTGCTGACGCGACGAAAAAAGGTGGCGCGAAAACGAAAGGCC
--------------------+ ----------------------+ -------------------- + -------------------- + ------------------- +
+ 10875
TCTTACCCGTCGGTGTCTCACGACTGCGCTGCTTTTTTCCACCGCGCTTTTGCTTTCCGG
A s n G ly G ln P r o G ln S e r A la A s p A la T h r L y s L y s G ly G lv A la L y s T h r L y sG ly A r g
10874
GTGGACGTAAGGCCGCGCAGCCCGAGCCTCAGCCGCAAACGCCGGAGGGGGAGGATTACG
--------------------+ ----------------------+ -------------------- + -------------------- + ------------------- +
+ 10815
CACCTGCATTCCGGCGCGTCGGGCTCGGAGTCGGCGTTTGCGGCCTCCCCCTCCTAATGC
G ly A r g L y s A la A la G ln P r o G lu P r o G ln P r o G ln T h r P r o G lu G ly G lu A s p T y r G ly
g g t t t t c a g a c g a c a t c c c g t t c Ftga It c g g g c t g a c t g t g a c a a c c g c c c c g c c c t g t g c
10814
--------------------+ ----------------------+ -------------------- + -------------------- + ------------------- + ---------------------+ 1 0 7 5 5
CCAAAAGTCTGCTGTAGGGCAAGACTAGCCCGACTGACACTGTTGGCGGGGCGGGACACG
P h e S e r A s p A s p I le P r o P h e *
10754
GGGGCATCACCGGAGATATGAGGATGAGCGAATATTTCAGAATACTTCAGGGACTGCCGG
--------------------+ ---------------------- + -------------------- + ------------------- + -------------------- + ---------------------+ 1 0 6 9 5
CCCCGTAGTGGCCTCTATACTCCTACTCGCTTATAAAGTCTTATGAAGTCCCTGACGGCC
10694
ACGGCTCCTTTACCCGCGAACAGGCGGAAGCCGTTGCCGCACAGTACCGGAACGTCTTTA
--------------------+ ---------------------- + -------------------- + ------------------- + -------------------- + ---------------------+ 1 0 6 3 5
TGCCGAGGAAATGGGCGCTTGTCCGCCTTCGGCAACGGCGTGTCATGGCCTTGCAGAAAT
10634
TCGAGGATGACCACGGAGAACATTTTCGCCTGGTTGTCCGTAATAACGGAACAATGGTCT
--------------------+ ---------------------- + -------------------- + ------------------- + -------------------- + ---------------------+ 1 0 5 7 5
AGCTCCTACTGGTGCCTCTTGTAAAAGCGGACCAACAGGCATTATTGCCTTGTTACCAGA
10574
GGGGTACCTGGAATTTTGAGGACGGTGCCGGGTACTGGATGAACdATGhcATCCGTGATT
--------------------+ ---------------------- + -------------------- + ------------------- + -------------------- + ---------------------+ 1 0 5 1 5
CCGCATGGACCTTAAAACTCCTGCCACGGCCCATGACCTACTTGGTACGGTAGGCACTAA
rbs
orf 6
M e tP r o S e r V a llle
10514
TCGGGATTCTTAAGTAAGAGAGGTGCCGGACGCGCGAACGTCCGGCAGGACATAAGCAAT
--------------------+ ---------------------- + -------------------- + ------------------- + -------------------- + ---------------------+ 1 0 4 5 5
AGCCCTAAGAATTCATTCTCTCCACGGCCTGCGCGCTTGCAGGCCGTCCTGTATTCGTTA
S e r G ly P h e L e u S e r L y s A r g G ly A la G ly A r g A la A s n V a lA r g G ln A s p I le S e r A s n
10454
TATAAGGGGATGATTATGCCTGTAACGAAGTGTGAACCAGAAACCACCCGCAAAGCAAGC
--------------------+ ---------------------- + -------------------- + ------------------- + -------------------- + ---------------------+ 1 0 3 9 5
ATATTCCCCTACTAATACGGACATTGCTTCACACTTGGTCTTTGGTGGGCGTTTCGTTCG
T y r L y s G ly M e tlle M e t P r o V a lT h r L y s C y s G lu P r o G lu T h r T h r A r g L y s A la S e r
10394
CGTAAATCTGCAAAAACGCAGGAAACTGCCCTGTCTGCCCTGCTGGCGCAGACGGAGGAA
--------------------+ ---------------------- + -------------------- + ------------------- + -------------------- + ---------------------+ 1 0 3 3 5
GCATTTAGACGTTTTTGCGTCCTTTGACGGGACAGACGGGACGACCGCGTCTGCCTCCTT
A rgL y s S e r A la L y s T h r G ln G lu T h r A la L e u S e r A la L e u L e u A la G ln T h r G lu G lu
10334
GTGAGCGTGCCGCTGGCCTCACTGATTAAATCACCGCTGAATGTGCGCACGGTGCCGTAT
--------------------+ ---------------------- + -------------------- + ------------------- + -------------------- + --------------------- + 2 0 2 7 5
CACTCGCACGGCGACCGGAGTGACTAATTTAGTGGCGACTTACACGCGTGCCACGGCATA
10274
TCTGTGGAGTCCGTCAGCGAACTGGCTGGGTCCATTAAGGGCGTTGGCCTGTTGCAGAAT
------------------- + ---------------------- + --------------------+ -------------------+ -------------------- + -------------------- +1 0 2 1 5
AGACACCTCAGGCAGTCGCTTGACCGACCCAGGTAATTCCCGCAACCGGACAACGTCTTA
V a lS e r V a lP r o L e u A la S e r L e u I le L y s S e r P r o L e u A s n V a lA r g T h r V a lP r o T y r
S e r V a lG lu S e r V a lS e r G lu L e u A la G ly S e r lle L y s G ly V a lG ly L e u L e u G ln A s n
CTGGTCGTGCATACCCTGCCTGGTGACCGTTACGGTGTCGCCGCAGGCGGTCGCCGACTG
•• 1 0 2 1 4 -------------------- + --------------------- + -------------------- + ------------------- + -------------------- + -------------------- +1 0 1 5 5
GACCAGCACGTATGGGACGGACCACTGGCAATGCCACAGCGGCGTCCGCCAGCGGCTGAC
L e u V a lV a lH is T h r L e u P r o G ly A s p A r g T y r G ly V a lA la A la G ly G ly A r g A r g L e u
GCAGCACTCAACATGCTGGCAGAGCGCAACATCCTTCCGGCTGACTGGCCTGTCCGCGTG
1 01 54 ---------------- +----------------- +---------------- +---------------- +---------------- +----------------- + 10095
CGTCGTGAGTTGTACGACCGTCTCGCGTTGTAGGAAGGCCGACTGACCGGACAGGCGCAC
A la A la L e u A s n M e tL e u A la G lu A r g A s n lle L e u P r o A la A s p T r p P r o V a lA r g V a l
Clal
I
AAAATTATTCCGCAGGCACTGGCGACGGCTGcETCGATbACCGAGAACGGTCATCGTCGG
10094
-------------- +-------------- +--------------+__L-------- J_+------------- +-------------- +1003 5
TTTTAATAAGGCGTCCGTGACCGCTGCCGACGTAGCTACTGGCTCTTGCCAGTAGCAGCC
Ly s I le lle P r o G ln A la L e u A la T h r A la A la S e r M e tT h r G lu A s n G ly H is A r g A r g
GATATGCACCCAGCCGAACAGATTGCCGGATTCCGCGCAATGGCGCAGGAAGGCAAAACA
10034
+----------------+------------- +---------------+--------------- +--------------- + 99?5
CTATACGTGGGTCGGCTTGTCTAACGGCCTAAGGCGCGTTACCGCGTCCTTCCGTTTTGT
A s p M e t H is P r o A la G lu G ln lle A la G ly P h e A r g A la M e tA la G ln G lu G ly L y s T h r
CCTGCGCAGACTGGCGACCTGCTGGGCTATTCACCCCGCCACGTCCAGCGAATGCTGAAA
9974
------------ +------------- +-----------+------------ +-------------+-------------+ 99i5
GGACGCGTCTGACCGCTGGACGACCCGATAAGTGGGGCGGTGCAGGTCGCTTACGACTTT
P r o A la G ln T h r G ly A s p L e u L e u G ly T y r S e r P r o A r g H is V a lG ln A r g M e t L e u L y s
CTGGCAGACCTTGCACCCGTCATCCTTGATGCGCTGGCAGAAGACCGCATCACCACCGAA
9914
+---------------- +------------- +---------------+----------------+--------------- + 9855
GACCGTCTGGAACGTGGGCAGTAGGAACTACGCGACCGTCTTCTGGCGTAGTGGTGGCTT
L e u A l a A s p L e u A l a P r o V a 1 1 1 e L e u A s p A l a L e u A l a G lu A s p A r g 1 1 e T h r T h rG l u
CACTGTCAGGCGCTGGCGCTGGAGAACGACACCGCGCGTCAGGTGCAGGTGTTTGAAGCC
9854
i----------------- +
|_
).---------------- ^--------------- 1_9795
GTGACAGTCCGCGACCGCGACCTCTTGCTGTGGCGCGCAGTCCACGTCCACAAACTTCGG
H is C y s G ln A la L e u A la L e u G lu A s n A s p T h r A la A r g G ln V a lG ln V a lP h e G lu A la
GCCTGCCAGTCAGGATGGGGCGGTAAACCGGATGTGCGGGTTATCCGCAACCTGATTACC
9794
---------------- +----------------- +----------------+-----------------+------------------+----------------- + 9 7 3 5
CGGACGGTCAGTCCTACCCCGCCATTTGGCCTACACGCCCAATAGGCGTTGGACTAATGG
A la C y s G ln S e r G ly T r p G ly G ly L y s P r o A s p V a lA r g V a llle A r g A s n L e u I le T h r
GAAAGTGAAGTGGCGGTGGCGGGGAACAGTAAATTCCGCTTCGTGGGGGCTGATGCCTTC
9734
-------------- +---------------+------------- +-------------- +--------------- +---------------+ 9675
CTTTCACTTCACCGCCACCGCCCCTTGTCATTTAAGGCGAAGCACCCCCGACTACGGAAG
G lu S e r G lu V a lA la V a lA la G ly A s n S e r L y s P h e A r g P h e V a lG ly A la A s p A la P h e
TCGCCAGACGAACTGCGCACCGATTTGTTCAGCGACGACGAGGGTGGCTATGTGGACTGC
9674
-------------- +
+
h
--------------- 1------------------ 1--------------- k9615
AGCGGTCTGCTTGACGCGTGGCTAAACAAGTCGCTGCTGCTCCCACCGATACACCTGACG
S e r P r o A s p G lu L e u A r g T h r A s p L e u P h e S e r A s p A s p G lu G ly G ly T y r V a lA s p C y s
GTGGCGCTCGATGCCGCCCTGCTGGAAAAACTCCAGGCTGTCGCTGAACACCTTCGGGAA
9614
---------------- +------------------ +---------------+-----------------+----------------- +----------------- +
9555
CACCGCGAGCTACGGCGGGACGACCTTTTTGAGGTCCGACAGCGACTTGTGGAAGCCCTT
V a lA la L e u A s p A la A la L e u L e u G lu L y s L e u G ln A la V a lA la G lu H is L e u A r g G lu
GCCGAAGGCTGGGAATGGTGCGCCGGGCGCATGGAGCCTGTCGGTGAGTGCCGTGAGGAT
9554
---------------- +------------------ +---------------+-----------------+----------------- +----------------- +
9495
CGGCTTCCGACCCTTACCACGCGGCCCGCGTACCTCGGACAGCCACTCACGGCACTCCTA
A la G lu G ly T r p G lu T r p C y s A la G ly A r g M e t G lu P r o V a lG ly G lu C y s A r g G lu A s p
GCCGGAACATACCGCTGTCTGCCGGAGCCGGAAGCGGTGCTGACGGAGGCAGAAGAAGAA
9494
---------------- +------------------ +---------------+-----------------+----------------- +----------------- +
9435
CGGCCTTGTATGGCGACAGACGGCCTCGGCCTTCGCCACGACTGCCTCCGTCTTCTTCTT
A la G ly T h r T y r A r g C y s L e u P r o G lu P r o G lu A la V a lL e u T h r G lu A la G lu G lu G lu
CGCCTGAACGAACTGATGACGCGTTACGACGCGCTGGAAAACCAGTGTGAGGAATCCGAC
9434
---------------- +------------------ +---------------+-----------------+----------------- +----------------- + 9 3 7 5
GCGGACTTGCTTGACTACTGCGCAATGCTGCGCGACCTTTTGGTCACACTCCTTAGGCTG
A r g L e u A s n G lu L e u M e t T h r A r g T y r A s p A l a L e u G l u A s n G l n C y s G lu G lu S e r A s p
9374
CTGCTGGAAGCAGAAATGAAGCTGATGCGCTGCATGGCGAAGGTCAGAGCGTGGACGCCG
--------------------+ ----------------------+ --------------------+ -------------------- + -------------------+ ---------------------+ 9 3 1 5
GACGACCTTCGTCTTTACTTCGACTACGCGACGTACCGCTTCCAGTCTCGCACCTGCGGC
L e u L e u G lu A l a G lu M e t L y s L e u M e t A r g C y s M e t A l a L y s V a lA r g A la T r p T h r P r o
9314
GAGATGCGTACCGGAAGCGGTGTGGTGGTGTCCTGGCGTTACGGTAATGTGTGTGTCCAG
--------------------+ ---------------------- + -------------------- + -------------------- + -------------------+ ---------------------+ 9 2 5 5
CTCTACGCATGGCCTTCGCCACACCACCACAGGACCGCAATGCCATTACACACACAGGTC
G lu M e t A r g T h r G ly S e r G ly V a lV a lV a lS e r T r p A r g T y r G ly A s n V a lC y s V a lG ln
9254
CGTGGTGTGCAGTTGCGCAGTGAAGATGACGCGGCTGACCGCACGGAACAGGTGCAGGAG
--------------------+ ----------------------+ -------------------- + -------------------- + -------------------+ ---------------------+ 9 1 9 5
GCACCACACGTCAACGCGTCACTTCTACTGCGCCGACTGGCGTGCCTTGTCCACGTCCTC
A r g G ly V a l G l n L e u A r g S e r G l u A s p A s p A l a A l a A s p A r g T h r G l u G l n V a l G l n G l u
9194
AAAGCATCAGTGGAGGAAATCAGTCTGCCACTGCTGACGAAAATGTCTTCCGAACGCACG
------------------- + ---------------------- + -------------------- + -------------------- + -------------------+ ---------------------+ 9 1 3 5
TTTCGTAGTCACCTCCTTTAGTCAGACGGTGACGACTGCTTTTACAGAAGGCTTGCGTGC
L y s A la S e r V a lG lu G lu I le S e r L e u P r o L e u L e u T h r L y s M e tS e r S e r G lu A r g T h r
9134
CTGGCAGTCCAGGCGGCACTCATGCAGCAACCGGACAAATCTCTGGCACTGCTGGCATGG
------------------- + ---------------------- + -------------------- + -------------------- + -------------------+ ---------------------+ 9 0 7 5
GACCGTCAGGTCCGCCGTGAGTACGTCGTTGGCCTGTTTAGAGACCGTGACGACCGTACC
L e u A la V a lG ln A la A la L e u M e t G ln G ln P r o A s p L y s S e r L e u A la L e u L e u A la T r p
9074
ACGCTCTGCCTGAATGTGTTTGGCAGCGGAGCGTACAGTAAACCAGCACAAATCAGCCTG
------------------- + ---------------------- + -------------------- + -------------------- + -------------------+ ---------------------+ 9 0 1 5
TGCGAGACGGACTTACACAAACCGTCGCCTCGCATGTCATTTGGTCGTGTTTAGTCGGAC
T h r L e u C y s L e u A s n V a lP h e G iy S e r G ly A la T y r S e r L y s P r o A la G ln lle S e r L e u
9014
GAATGTAAACATTATTCGCTGACCAGCGATGCGCCGTCAGGGAAGGAAGGTGCCGCGTTC
------------------- + ---------------------- + -------------------- + -------------------- + -------------------+ ---------------------+ 8 9 5 5
CTTACATTTGTAATAAGCGACTGGTCGCTACGCGGCAGTCCCTTCCTTCCACGGCGCAAG
G lu C y s L y s H i s T y r S e r L e u T h r S e r A s p A l a P r o S e r G l y L y s G l u G l y A l a A l a P h e
8954
ATGGCGCTGATGGCAGAAAAAGCCCGTCTTGCGGCCCTGTTACCGGAGGGATGGTCACGG
------------------- + ---------------------- + -------------------- + -------------------- + -------------------+ ---------------------+ 8 8 9 5
TACCGCGACTACCGTCTTTTTCGGGCAGAACGCCGGGACAATGGCCTCCCTACCAGTGCC
M e tA la L e u M e t A la G lu L y s A la A r g L e u A la A la L e u L e u P r o G lu G ly T r p S e r A r g
8894
GACATGACGACGTTCCTGTCGCTCAGCCAGGAGGTGCTGTTATCCCTGCTCAGTTTCTGC
------------------- + -----------------------+ -------------------+ -------------------- + -------------------- + ---------------------+ 8 8 3 5
CTGTACTGCTGCAAGGACAGCGAGTCGGTCCTCCACGACAATAGGGACGAGTCAAAGACG
A s p M e tT h r T h r P h e L e u S e r L e u S e r G ln G lu V a lL e u L e u S e r L e u L e u S e r P h e C y s
8834
ACCGCGTGCAGCATCCACGGCGTTCAGACCCGCGAGTGTGGTCACACGTCACGCAGCCCG
------------------- + -----------------------+ -------------------+ -------------------- + -------------------- + ---------------------+ 8 7 7 5
TGGCGCACGTCGTAGGTGCCGCAAGTCTGGGCGCTCACACCAGTGTGCAGTGCGTCGGGC
T h r A la C y s S e r l l e H i s G ly V a lG ln T h r A r g G lu C y s G ly H is T h r S e r A r g S e r P ro
8774
CTGGATACGCTGGAGAGCGCCATCGGTTTTCACATGCGCGACTGGTGGCAGCCGACAAAA
------------------- + -----------------------+ -------------------+ -------------------- + -------------------- + ---------------------+ 8 7 1 5
GACCTATGCGACCTCTCGCGGTAGCCAAAAGTGTACGCGCTGACCACCGTCGGCTGTTTT
L e u A s p T h r L e u G lu S e r A la lle G ly P h e H is M e tA r g A s p T r p T r p G ln P r o T h r L y s
8714
GCAAACTTCTTCGGACACCTGAAAAAGCCACAAATTATCGCAGCCCTGAATGAGGCCGGA
------------------- + -----------------------+ ------------------- + -------------------- + -------------------- + ---------------------+ 8 6 5 5
CGTTTGAAGAAGCCTGTGGACTTTTTCGGTGTTTAATAGCGTCGGGACTTACTCCGGCCT
A la A s n P h e P h e G ly H is L e u L y s L y s P r o G ln lle lle A la A la L e u A s n G lu A la G ly
8654
CTGTCCGGTGCCGCACGGGACGCGGAGAAGATGAAGAAAGGTGATGCGGCTGAACATGCA
-------------------- h--------------------- + --------------------- 1--------------------- +
*■ 8 5 9 5
GACAGGCCACGGCGTGCCCTGCGCCTCTTCTACTTCTTTCCACTACGCCGACTTGTACGT
L e u S e r G ly A la A la A r g A s p A la G lu L y s M e tL y s L y s G ly A s p A la A la G lu H is A la
8594
GAGCACCATATGAAAGACAACCGCTGGGTTCCAGGCTGGATGTGTGCTCCACATCCACAG
--------------------+ --------------------- + -------------------- + ------------------- + ------------------ +
+
85
35
CTCGTGGTATACTTTCTGTTGGCGACCCAAGGTCCGACCTACACACGAGGTGTAGGTGTC
G lu H is H is M e t L y s A s p A s n A r g T r p V a lP r o G ly T r p M e t C y s A la P r o H is P r o G ln
8534
ACAGATGCCACTGAACGCACCGATAACCTGGCTGATGCCGcdrGAtTGA^.CAACCACACCG
--------------------+ --------------------- + -------------------- + ------------------- + ------------------ +
+
8475
TGTCTACGGTGACTTGCGTGGCTATTGGACCGACTACGGCGGACTACTTGTTGGTGTGGC
T h r A s p A la T h r G lu A r g T h r A s p A s n L e u A la A s p A la A la J l
r\jS
p siB
*
CCCCGCCGGAGACGGGGCGGCAGCAAGGGAGATACCGTGkTG kAAACTGAACTGACCGTG
8474
------------ +------------- +------------ +------------ +----------- +-------------- + 8415
GGGGCGGCCTCTGCCCCGCCGTCGTTCCCTCTATGGCACTACTTTTGACTTGACTGGGAC
M e t L y s T h r G lu L e u T h r L e u
PstI
AATGCC^TGCAG|rCCATGAACGCACAGGAATATGAAGATATCCGTGCTGCGGGAAGCGAT
8414
------------ +------------- +------------ +------------ +----------- +-------------- + 8355
TTACGGGACGTCAGGTACTTGCGTGTCCTTATACTTCTATAGGCACGACGCCCTTCGCTA
A s n A la L e u G ln S e r M e tA s n A la G ln G lu T y r G lu A s p I le A r g A la A la G ly S e r A s p
ATGCGCCGTAATCTCACTCACGAGGTGATGCGTGAAGTGGACGCACCGGCTAACTGGATG
8354
---------------- +------------------ +-----------------+---------------- +--------------- +------------------- + 8295
TACGCGGCATTAGAGTGAGTGCTCCACTACGCACTTCACCTGCGTGGCCGATTGACCTAC
M e t A r g A r g A s n L e u T h r H is G lu V a lM e tA r g G lu V a lA s p A la P r o A la A s n T r p M e t
ATGAATGGCGAGTATGGCAGTGAGTTCGGGGGCTTTTTCCCCGTCCAGGTTCGTTTCACG
8294
i-
+
h----------------- 1-
!--------------------- + 8235
TACTTACCGCTCATACCGTCACTCAAGCCCCCGAAAAAGGGGCAGGTCCAAGCAAAGTGC
M e tA s n G ly G lu T y r G ly S e r G lu P h e G ly G ly P h e P h e P r o V a lG ln V a lA r g P h e T h r
CCAGCCCACGAACGTTTCCACCTGGCATTATGTTCGCCGGGAGACGTCTCTCAGCTCTGG
8234
---------------- +------------------ +-----------------+----------------+----------------+------------------ + 8175
GGTCGGGTGCTTGCAAAGGTGGACCGTAATACAAGCGGCCCTCTGCAGAGAGTCGAGACC
P r o A la H is G lu A r g P h e H is L e u A la L e u C y s S e r P r o G ly A s p V a lS e r G ln L e u T r p
ATGCTGGTTCTGGTGAATTGTGGTGGACAGCCTTTCGCCGTCGTTCAGGTGCAACATATC
8174
---------------- +-------------------+-----------------+----------------+----------------+------------------ + 8115
TACGACCAAGACCACTTAACACCACCTGTCGGAAAGCGGCAGCAAGTCCACGTTGTATAG
M e t L e u V a lL e u V a lA s n C y s G ly G ly G ln P r o P h e A la V a lV a lG ln V a lG ln H is I le
TTCACGCCTGTCGCTATCAGTCACACGCTGGCGCTTGCCGCGACACTTGATGCGCAGGGG
8114
---------------- +-------------------+-----------------+----------------+----------------+------------------ + 8055
AAGTGCGGACAGCGATAGTCAGTGTGCGACCGCGAACGGCGCTGTGAACTACGCGTCCCC
P h e T h r P r o V a lA la lle S e r H is T h r L e u A la L e u A la A la T h r L e u A s p A la G ln G ly
rbs
pjsi£.
TACAGTGTTAACGACATCATCCATATCCTGATGGCAGAAGGAGGTCAGGC12T'
8054
JCGCAC
■+ 7995
ATGTCACAATTGCTGTAGTAGGTATAGGACTACCGTCTTCCTCCAGTCCGTACTCGCGTG
T y r S e r V a lA s n A s p I le lle H is I le L e u M e t A la G lu G ly G ly G ln A la *
M e tS e r A la A r g
7994
GTTCACGGGCACTGATCCCCCTCAGCGCAGAGCAACAGGCCGCCATGCAGGCTGTGGCTG
------------------- + --------------------- + -------------------- + -------------------- + -------------------- + ---------------------+ 7 9 3 5
CAAGTGCCCGTGACTAGGGGGAGTCGCGTCTCGTTGTCCGGCGGTACGTCCGACACCGAC
S e r A r g A la L e u I le P r o L e u S e r A la G lu G ln G ln A la A la M e tG ln A la V a lA la V a l
7934
TCACAGAACAACGTCGTCGTCAGGGACGCACACTTTCAGCATGGCCTTATGCCAGCGCTT
--------------------+ --------------------- + -------------------- + -------------------- + -------------------- + ---------------------+ 7 8 7 5
AGTGTCTTGTTGCAGCAGCAGTCCCTGCGTGTGAAAGTCGTACCGGAATACGGTCGCGAA
T h r G lu G ln A r g A r g A r g G ln G lu A r g T h r L e u S e r A la T r p P r o T y r A la S e r A la P h e
7874
TCTTTCGCTGCCTGAATGGCAGCCGCCGGATTTCGCTGACCGATCTCCGCTTTTTTGCTC
------------------- + --------------------- + -------------------- + -------------------- + -------------------- + ---------------------+ 7 8 1 5
AGAAAGCGACGGACTTACCGTCGGCGGCCTAAAGCGACTGGCTAGAGGCGAAAAAACGAG
P h e A r g C y s L e u A s n G ly S e r A r g A r g lle S e r L e u T h r A s p L e u A r g P h e P h e A la P r o
CTGCGCTGACGAAGGAGGAATTTCATGGCAACCGTCTCCTGTGGCTGGCTGCCGTGGATA
+
7814
+
+
+
+
+ 7755
GACGCGACTGCTTCCTCCTTAAAGTACCGTTGGCAGAGGACACCGACCGACGGCACCTAT
A la L e u T h r L y s G lu G lu P h e H is G ly A s n A r g L e u L e u T r p L e u A la A la V a lA s p L y
AACTGATTGAAAGTTTTGGTGAAGTCTGTGTTCTTCCCCTGCCATCCGATGCTGGGCATC
+----------------+------------- +---------------- +-------------- +-------------- + 7695
7754
TTGACTAACTTTCAAAACCACTTCAGACACAAGAAGGGGACGGTAGGCTACGACCCGTAG
L e u I le G lu S e r P h e G lu G lu V a lC y s V a lL e u P r o L e u P r o S e r A s p A la G ly H is A r g
GTCTGTTCCCGTCCGTTCCTTTTCGTGAAGGTGAGCGGCGTCGTCAGAAAACCACGCTGA
+---------------- +--------------+---------------- +-------------- +-------------- + 7635
7694
CAGACAAGGGCAGGCAAGGAAAAGCACTTCCACTCGCCGCAGCAGTCTTTTGGTGCGACT
L e u P h e P r o S e r V a lP r o P h e A r g G lu G ly G lu A r g A r g A r g G ln L y s T h r T h r L e u T h r
CAGAGCAGAAATACAGCCGCCAGCGGGAACGTGAGGCAGAACGACGGGAACTGGAATACC
+--------------- +-------------- +----------------+---------------+------------- + 7575
7634
GTCTCGTCTTTATGTCGGCGGTCGCCCTTGCACTCCGTCTTGCTGCCCTTGACCTTATGG
G lu G l n L y s T y r S e r A r g G l n A r g G l u A r g G l u A l a G l u A r g A r g G l u L e u G l u T y r G l n
AGACATGTTTTGCTCAGGCGCAGATTGACCTTGCGTTTCATACTCCCGCCACGGTCGGAA
+----------------+-------------- +----------------+---------------+------------- + 7515
7574
TCTGTACAAAACGAGTCCGCGTCTAACTGGAACGCAAAGTATGAGGGCGGTGCCAGCCTT
T h r C y s P h e A la G ln A la G ln lle A s p L e u A la P h e H is T h r P r o A la T h r V a lG ly S e r
GCTGGTTGTCCCGCTGGTCTGGTGTTGTTGAGGAGCATGATCTGGAAACGATTTTCTGGG
7514
---------------- +------------------ +----------------+------------------+----------------+----------------- + 7455
CGACCAACAGGGCGACCAGACCACAACAACTCCTCGTACTAGACCTTTGCTAAAAGACCC
T r p L e u S e r A r g T r p S e r G ly V a lV a lG lu G lu H is A s p L e u G lu T h r lle P h e T r p G ly
7454
GGTGGTGCGGGCGTTTTCCATCACTGTCATCATTTGACCGGTTTTTCTGGCAGGAGGAAC
---------------- +------------------- h----------------+----------------- +----------------+------------------h7395
CCACCACGCCCGCAAAAGGTAGTGACAGTAGTAAACTGGCCAAAAAGACCGTCCTCCTTG
T r p C y s G ly A r g P h e P r o S e r L e u S e r S e r P h e A s p A r g P h e P h e T r p G ln G lu G lu P r o
CACTCTGGCGGCTGATTTTTGAAGCCGGTGAGGCCGGTCGTGGTGCACCGGTACAGATAC
7394
---------------- +------------------ +----------------+------------------+----------------+----------------- + 7 3 3 4
GTGAGACCGCCGACTAAAAACTTCGGCCACTCCGGCCAGCACCACGTGGCCATGTCTATG
L e u T r p A r g L e u I le P h e G lu A la G ly G lu A la G ly A r g G ly A la P r o V a lG ln lle A r g
GTGCACTTGAGCAGTGGATGATCCCGAACAAGCTGGAGAACGCAATAfTGAfTGA^ATCAGC
7334
---------------------+ ------------------------ + -------------------- + -----------------------+ -------------------- + ---------------------- + 7 2 7 5
CACGTGAACTCGTCACCTACTAGGGCTTGTTCGACCTCTTGCGTTATACTACTTTAGTCG
A la L e u G lu G ln T r p M e tlie P r o A s n L y s L e u G lu A s n A la lle *
*
GAAAAGCCGCCGAGAACCCTCGCCCAATGCGGGTGGGGAGGAAAGGCGGAAAAGCCCGAA
7274
--------------------- + -----------------------* --------------------- + ----------------------+ ----------------------+ ---------------------- +
7215
CTTTTCGGCGGCTCTTGGGAGCGGGTTACGCCCACCCCTCCTTTCCGCCTTTTCGGGCTT
direct repeat
rJys orf 5
GGGCTTTAAAAATATTATTACGGTGTTAGCATAAAAACCTGTACCAATGAGCGGTGACT|A
7214
---------------- +------------------+-----------------+-----------------+-----------------+----------------- + 7 1 5 5
CCCGAAATTTTTATAATAATGCCACAATCGTATTTTTGGACATGGTTACTCGCCACTGAT
^
M et
TGjTTAAGAGCAACAAAAATACGCATCTATCCTACTCCTGAACAGGCTGCATTTCTCAACG
7154
---------------- +------------------+-----------------+-----------------+-----------------+----------------- + 7 0 9 5
ACAATTCTCGTTGTTTTTATGCGTAGATAGGATGAGGACTTGTCCGACGTAAAGAGTTGC
L e u A r g A la T h r L y s I le A r g lle T y r P r o T h r P r o G lu G ln A la A la P h e L e u A s n A la
CCCAGTTCGGTGCGGTACGTTTTGCGTACAACAAAGCTCTTCACATCAAAAAACACGCTT
7094
---------------- +------------------+-----------------+-----------------+-----------------+----------------- + 7 0 3 5
GGGTCAAGCCACGCCATGCAAAACGCATGTTGTTTCGAGAAGTGTAGTTTTTTGTGCGAA
G ln P h e G ly A la V a lA r g P h e A la T y r A s n L y s A la L e u H is I le L y s L y s H is A la T y r
ACCAGAGACACGGAGTAAATTTAAGTCCGCGTAACGATCTGAAACCGTTGTTGTCTGTGG
7034 ---------------- +------------------+-----------------+-----------------+---------------- +
+ 6975
TGGTCTCTGTGCCTCATTTAAATTCAGGCGCATTGCTAGACTTTGGCAACAACAGACACC
G ln A r g H is G ly V a lA s n L e u S e r P r o A r g A s n A s p L e u L y s P r o L e u L e u S e r V a lA la
CCAAAAAGTCCCGTAAATATGCCTGGCTCAAAGAATTTGACTCAATGGCATTGCAACAGG
6974 ---------------- +------------------+-----------------+-----------------+---------------- +
+ 6915
GGTTTTTCAGGGCATTTATACGGACCGAGTTTCTTAAACTGAGTTACCGTAACGTTGTCC
Ly s L y s S e r A r g L y s T y r A la T r p L e u L y s G lu P h e A s p S e r M e tA la L e u G ln G ln A la
CGGTAATCAATATTGATGTGGCATTTTCCAACTTTTTTAATCCGAAGCTGAAAGCGCGGT
6914 ---------------- +-------------------+----------------+-----------------+----------------+------------------ + 6855
GCCATTAGTTATAACTACACCGTAAAAGGTTGAAAAAATTAGGCTTCGACTTTCGCGCCA
V a llle A s n lle A s p V a lA la P h e S e r A s n P h e P h e A s n P r o L y s L e u L y s A la A r g P h e
TCCCGACGTTTAAACGCAAACACGGAAAACAATCGAGCTATCACTGTGTCGGGATTAAGG
6854 ---------------- +------------------ +----------------+---------------- +----------------+------------------ + 6795
AGGGCTGCAAATTTGCGTTTGTGCCTTTTGTTAGCTCGATAGTGACACAGCCCTAATTCC
P r p T h r P h e L y s A r g L y s H is G ly L y s G ln S e r S e r T y r H is C y s V a lG ly lle L y s V a l
TGCTGGATAATGCCATCAAAATCCCCAAACTGGCCCCGATAGAAGCACGCCTTCATCGTG
6794 ---------------- +------------------ +----------------+-----------------+----------------+------------------ + 6735
ACGACCTATTACGGTAGTTTTAGGGGTTTGACCGGGGCTATCTTCGTGCGGAAGTAGCAC
L e u A s p A s n A la lle L y s I le P r o L y s L e u A la P r o I le G lu A la A r g L e u H is A r g G lu
AACTTCATGGAAAGCTGAAAAGCATCACTGTCACCCGTTCTGCAACGGGGAAATACTACG
6734 ---------------- +------------------ +----------------+-----------------+----------------+------------------ + 6675
TTGAAGTACCTTTCGACTTTTCGTAGTGACAGTGGGCAAGACGTTGCCCCTTTATGATGC
L e u H is G ly L y s L e u L y s S e r lle T h r V a lT h r A r g S e r A la T h r G ly L y s T y r T y r A la
CTTCCATTCTTTGTGACGATGGCGCTTCCGCACCAGAGAAACCCACGTACCTGAAGGAAG
6674 ----------------- h------------------ 1------------------- 1----------------- 1-----------------h
+ 6615
GAAGGTAAGAAACACTGCTACCGCGAAGGCGTGGTCTCTTTGGGTGCATGGACTTCCTTC
S e r lle L e u C y s A s p A s p G ly A la S e r A la P r o G lu L y s P r o T h r T y r L e u L y s G lu G lu
AAAAGATTACAGGTCTGGATATGGGACTGGAGCACTATGCCATCACTTCTGATGCTGTAA
6614 ---------------- +------------------+-----------------+-----------------+--------------- +
+ 6555
TTTTCTAATGTCCAGACCTATACCCTGACCTCGTGATACGGTAGTGAAGACTACGACATT
L y s I le T h r G ly L e u A s p M e tG ly L e u G lu H is T y r A la lle T h r S e r A s p A la V a lL y s
AAGTTCCGAATCCTCGCCATCTTATCAATGTAAGTCGTAATCTGCGACGCAAACAAAAAG
6554 ---------------- +------------------+-----------------+-----------------+--------------- +
+ 6495
TTCAAGGCTTAGGAGCGGTAGAATAGTTACATTCAGCATTAGACGCTGCGTTTGTTTTTC
V a lP r o A s n P r o A r g H is L e u I le A s n V a lS e r A r g A s n L e u A r g A r g L y s G ln L y s A la
CATTATCCCGTAAGCAAAAGGGAAGCGCGAATCGTAAAAAGGCCAGAATCCGTCTTGCGG
6 4 9 4
----------------- +-----------------+-----------------+-----------------+--------------- +
+ 6435
GTAATAGGGCATTCGTTTTCCCTTCGCGCTTAGCATTTTTCCGGTCTTAGGCAGAACGCC
L e u S e r A r g L y s G ln L y s G ly S e r A ia A s n A r g L y s L y s A la A r g lle A r g L e u A la A la
CCTTACACGAACGGGTGGCGAATGCCCGTGCTGATTTTCAACACAAGCTCTCTTGCGCGA
6434 ---------------- +------------------+-----------------+-----------------+----------------+
+ 6375
GGAATGTGCTTGCCCACCGCTTACGGGCACGACTAAAAGTTGTGTTCGAGAGAACGCGCT
L e u H is G lu A r g V a lA la A s n A la A r g A la A s p P h e G ln H is L e u S e r C y s A la lle
Sail
TTpTCGACpAAAACCAAGCGGTAATTGTGGAGACGCTGAAAACAGCCAACATGATGAAAA
6374
---------- +------------------+-----------------+-----------------+----------------+
+ 6315
AACAGCTGCTTTTGGTTCGCCATTAACACCTCTGCGACTTTTGTCGGTTGTACTACTTTT
V a lA s p G lu A s n G ln A la V a llle V a lG lu T h r L e u L y s T h r A la A s n M e tM e tL y s A s n
ACCACAATCTGGCAAGAGCGATAGGTGATGCTGGCTGGCACAGCTTCATCACAAAGCTGG
6314 ---------------- +------------------+-----------------+-----------------+----------------+
+ 6255
TGGTGTTAGACCGTTCTCGCTATCCACTACGACCGACCGTGTCGAAGTAGTGTTTCGACC
H is A s n L e u A la A r g A la lle G ly A s p A la G ly T r p H is S e r P h e lle T h r L y s L e u G lu
AGTACAAGGCAGCGACAAAAGGCGTTCACCTGGTAAAACTCGACCAGTGGTTTGCCAGTT
+---------------- +---------------+------------- +---------------+--------------- + 6195
6254
TCATGTTCCGTCGCTGTTTTCCGCAAGTGGACCATTTTGAGCTGGTCACCAAACGGTCAA
T y r L y s A la A la T h r L y s G ly V a lH is L e u V a lL y s L e u A s p G ln T r p P h e A la S e r S e r
CGAAAACGTGCCATTGTTGTGGTTACAAAATGCCGGAAATGCCACTTCATAAACGCATCT
+----------------+---------------+------------- +---------------+--------------- + 6135
6194
GCTTTTGCACGGTAACAACACCAATGTTTTACGGCCTTTACGGTGAAGTATTTGCGTAGA
L y s T h r C y s H is C y s C y s G ly T y r L y s M e tP r o G lu M e tP r o L e u H is L y s A r g lle T r p
GGCGATGCCCTGAGTGTGGAGCAGAGCACGACCGCGATATCAATGCGGCACTCAACATCC
+----------------+---------------+------------- +---------------+--------------- + 6Q75
6134
CCGCTACGGGACTCACACCTCGTCTCGTGCTGGCGCTATAGTTACGCCGTGAGTTGTAGG
A r g C y s P r o G lu C y s G ly A la G lu H is A s p A r g A s p I le A s n A la A la L e u A s n l le A r g
GGCAAAAAGGAATACTGGAACTAAAGGCGGCGGGACTCGTCGTCTCTGCCCATGGAGGCC
-i----------------|----------------1---------------+
6074
|--------------- 1. 6015
CCGTTTTTCCTTATGACCTTGATTTCCGCCGCCCTGAGCAGCAGAGACGGGTACCTCCGG
G ln L y s G ly lle L e u G lu L e u L y s A la A la G ly L e u V a lV a lS e r A la H is G ly G ly G ln
AGCGTAAATCCGTCGCACAGACGGTTGCGGCCrrGAlGAAGTGGGAAGCCTCGCCCGACAGG
+--------------- +----------------- +
6014
5955
TCGCATTTAGGCAGCGTGTCTGCCAACGCCGGACTCTTCACCCTTCGGAGCGGGCTGTCC
A r g L y s S e r V a lA la G ln T h r V a lA la A la *
direct repeat
GCGGGGAGCAGTCACGGGTGGTCTGGAGGTCATGCGGCGTGTCCTCTGCACTCGCCGGAA
5954 ---------------- +----------------- +---------------- +-----------------+---------------- +
+ 5895
CGCCCCTCGTCAGTGCCCACCAGACCTCCAGTACGCCGCACAGGAGACGTGAGCGGCCTT
TAAGGAAGTCGCCGGCGGCTCCGCTTTTACCCGGCCATGCGGGGCATGGCCTTGTGGGTT
5894 ---------------- +----------------- +---------------- +-----------------+---------------- +
+ 5835
ATTCCTTCAGCGGCCGCCGAGGCGAAAATGGGCCGGTACGCCCCGTACCGGAACACCCAA
TTCAGCTCTGTGGCCTCAGCGTCGTGTGCGGGCTGTGCCGTGCCTCCATCTTAGCCGGGC
5834 ---------------- +----------------- +-----------------+-----------------+----------------+
+
5775
AAGTCGAGACACCGGAGTCGCAGCACACGCCCGACACGGCACGGAGGTAGAATCGGCCCG
TGGCAGGGATGCAAGGGTACGCTTCGCCGCTGCGGTCACCCGGTCCCTCCTTCCCGTCTG
5774
--------------------------- + ---------------------------- + --------------------------- + ----------------------------+ -------------------------- +
+
5715
ACCGTCCCTACGTTCCCATGCGAAGCGGCGACGCCAGTGGGCCAGGGAGGAAGGGCAGAC
CCGTGATTTTCCGGTCGTTCACCCGCTCAGATTTCGCGGTCTCACCCTCCAACTCCCGC
5714 -------------- +--------------- +---------------+---------------+-------------- +
+ 5555
GGCACTAAAAGGCCAGCAAGTGGGCGAGTCTAAAGCGCCAGAGTGGGAGGTTGAGGGCG
CAGCCGTGTGCGTCAGGCTGCGGCTTCCCTTGCGCCCTGTGCATCCCCGCCTTATCGCCC
5654 ---------------- +------------------+-----------------+-----------------+-----------------+---------------- +
5595
GTCGGCACACGCAGTCCGACGCCGAAGGGAACGCGGGACACGTAGGGGCGGAATAGCGGG
rbs
GGCTTTTATGGAGGCACGGCACCGCCCGGTGCCGCAGAACATG?GACTATGGAG£LATTCG
5594 ---------------- +------------------+-----------------+-----------------+-----------------+---------------- +
5535
CCGAAAATACCTCCGTGCCGTGGCGGGCCACGGCGTCTTGTACACTGATACCTCCTAAGC
ardA
GG^ATGjrCTGTTGTTGCACCTGCTGTATACGTTGGAACCTGGCACAAATACAACTGTGGA
5534
_ +---------------- +-----------------+-----------------+---------------- +----------------- +
5475
CCTTACAGACAACAACGTGGACGACATATGCAACCTTGGACCGTGTTTATGTTGACACCT
M e tS e r V a lV a lA la P r o A la V a lT y r V a lG ly T h r T r p H is L y s T y r A s n C y s G ly
AGCATCGCCGAACGCTGGTTTGACCTGACCACGTTTGATGATGAGCGCGACTTTTTCGCC
-------------- +--------------- +---------------+--------------- +-------------- +--------------- + 5415
TCGTAGCGGCTTGCGACCAAACTGGACTGGTGCAAACTACTACTCGCGCTGAAAAAGCGG
S e r lle A la G lu A r g T r p P h e A s p L e u T h r T h r P h e A s p A s p G lu A r g A s p P h e P h e A la
GCCTGCCGTGCTCTTCACCAGGATGAAGCCGATCCTGAACTGATGTTTCAGGATTATGAG
5414
---------------- +------------------ +----------------+-----------------+-----------------+
+
5355
CGGACGGCACGAGAAGTGGTCCTACTTCGGCTAGGACTTGACTACAAAGTCCTAATACTC
A la C y s A r g A la L e u H is G ln A s p G lu A la A s p P r o G lu L e u M e tP h e G ln A s p T y r G lu
5354
GGATTCCCGGGGAATATGGCCTCTGAATGCCATATCAACTGGGCCTGGGTTGAAGGCTTC
--------------------+ ---------------------- + ------------------- + -------------------- +-------------------- +
+ 5295
CCTAAGGGCCCCTTATACCGGAGACTTACGGTATAGTTGACCCGGACCCAACTTCCGAAG
G ly P h e P r o G ly A s n M e t A la S e r G lu C y s H is I le A s n T r p A la T r p V a lG lu G ly P h e
5294
CGCCAGGCACGGGATGAAGGCTGCGAAGAGGCTTATCGTCTCTGGGTGGAGGATACCGGT
■“ h---------------------- 1--------------------------------------------+ -------------------- h--------------------- +■ 5 2 3 5
GCGGTCCGTGCCCTACTTCCGACGCTTCTCCGAATAGCAGAGACCCACCTCCTATGGCCA
A r g G ln A la A r g A s p G lu G ly C y s G lu G lu A la T y r A r g L e u T y r V a lG lu A s p T h r G ly
5234
GAGACGGATTTTGACACCTTCCGCGATGCCTGGTGGGGCGAGGCTGACAGTGAGGAGGCT
--------------------+ ---------------------- + ------------------- + -------------------- + -------------------- + ---------------------+ 5 1 7 5
CTCTGCCTAAAACTGTGGAAGGCGCTACGGACCACCCCGCTCCGACTGTCACTCCTCCGA
G lu T h r A s p F P h e A s p T h r P h e A r g A s p A l a T r p T r p G l y G l u A l a A s p S e r G l u G l u A l a
5174
TTTGCGGTTGAGTTCGCCAGTGATACCGGCCTGCTGGCTGACGTGCCGGAGACGGTGGCG
--------------------+ ---------------------- + ------------------- + -------------------- + -------------------- + ---------------------+ 5 1 1 5
AAACGCCAACTCAAGCGGTCACTATGGCCGGACGACCGACTGCACGGCCTCTGCCACCGC
P h e A la V a lG lu P h e A la S e r A s p T h r G ly L e u L e u A la A s p V a lP r o G lu T h r V a lA la
CTCTATTTTGACTATGAGGCGTATGCGCGGGATTTATTCCTGGACTCCTTCACCTTTATT
5114
------------ +--------------+------------+------------ +------------ +-------------+5055
GAGATAAAACTGATACTCCGCATACGCGCCCTAAATAAGGACCTGAGGAAGTGGAAATAA
L e u T y r P h e A s p T y r G lu A la T y r A la A r g A s p L e u P h e L e u A s p S e r P h e T h r P h e lle
GACGGTCATGTGTTCCGTCGG|TGA|rTTACTCCCCCGCTCCGGCGGGGGTATGGCCTGCCA
+---------------- +---------------- +
5054
+
4995
CTGCCAGTACACAAGGCAGCCACTAAATGAGGGGGCGAGGCCGCCCCCATACCGGACGGT
A s p G ly H is V a lP h e A r g A r g *
GGCCGCCGGAAAACCCTGGCAGGCTTACGCCTGCCTGAAATGCAGGAGGGCCGCGCCTGC
4994
---------------- +----------------- +---------------- +-----------------+---------------- +
+
4935
CCGGCGGCCTTTTGGGACCGTCCGAATGCGGACGGACTTTACGTCCTCCCGGCGCGGACG
GGCGCTGCCCTTCCTGCCCGTCATGGTGTGAGGCATTTTTCTGTTATGTCGTTTCTGTTG
4934
---------------+--------------- +---------------+---------------+-------------- +
+ 4875
CCGCGACGGGAAGGACGGGCAGTACCACACTCCGTAAAAAGACAATACAGCAAAGACAAC
4874
TTCTGATTTCCGGAGGCGGGGACACCTTCGGCTCCCGGCTGCCTGGCGGCATCCGGTCGT
--------------------+ -------------------- + --------------------+ -------------------- + ------------------- +
+ 4815
AAGACTAAAGGCCTCCGCCCCTGTGGAAGCCGAGGGCCGACGGACCGCCGTAGGCCAGCA
4814
CAGGCCCGACTCCGACAGGCAGCTGCTGGCGCACCCGCCAGTCTCCGCCGAACCCGCTGG
--------------------+ -------------------- + -------------------- + -------------------- + ------------------- +
+ 4755
GTCCGGGCTGAGGCTGTCCGTCGACGACCGCGTGGGCGGTCAGAGGCGGCTTGGGCGACC
CGCGGTTTCGGGCTGCCGCTACGGTCCGATGTCTGAAAAACCAGGCTTGCAGCGACCGTT
4754
-------------- +--------------- +---------------+---------------+-------------- +
+ 4695
GCGCCAAAGCCCGACGGCGATGCCAGGCTACAGACTTTTTGGTCCGAACGTCGCTGGCAA
CCGGTCGCGCCGCCCCTGTCGCGCCGGAAACGGCGC
4694
GGCCAGCGCGGCGGGGACAGCGCGGCCTTTGCCGCGAGGGACGTGTGGACTGCAACACAT 4 6 3 5
ssi2
4 6 3 4 TCCGGTGACGCGGACTACCGCGTCAGTTGGGAAGGCGGCGGTGGGGACGCCGGACAAAGG 4 5 7 5
4 5 7 4 GCGACACCTGAAAGGCCCCCGACCTCATTGGTGTAGGGCAAAGTCGTCAGGTCCCCTTCT 4 5 1 5
4 514
ATATGGCAGGTGTTTTAAAAATCGGTATTTGGGCCGTTTTTTAAAACGCAGGCGGGGGCC 4 4 55
4 4 5 4 TGTCGACGGGGCACTGCACCACTGCCTGCGGGGTAGCCTTTCCAGGTGACGCCCCTCTTT 43 9 5
GGGAGCAACCGGTCGGGCC
-----------------+
+
4335
4 3 9 4 GGGGCTTCTTCACCTGCCGTCTTCCCCGAAAGCGGGGAGGCCCCTCGTTGGCCAGCCCGG
rbs
orf 4
►
c g g c g a c c t g a t t c a g c a g a a g g a g a t g t t t t c Ia t g Kc a g t c a g c a g c a c g a t t t c c g t t
4334
--------------------+ ---------------------+ --------------------- + ------------------+ --------------------- + ---------------------+ 4 2 7 5
GCCGCTGGACTAAGTCGTCTTCCTCTACAAAAGTACTGTCAGTCGTCGTGCTAAAGGCAA
M e tT h r V a lS e r S e r T h r lle S e r V a l
4274
TTTTGCCGCGACGGGGTGTTCCGTACCGTTTACTGCCACCTGCACGGGGAGCCGACCTGG
--------------------+ ---------------------+ --------------------- + ------------------+ --------------------- + ---------------------+ 4 2 1 5
AAAACGGCGCTGCCCCACAAGGCATGGCAAATGACGGTGGACGTGCCCCTCGGCTGGACC
P h e C y s A r g A s p G ly V a lP h e A r g T h r V a lT y r C y s H is L e u H is G ly G lu P r o T h r T r p
AACGGTCGCATCCTGCATACTCACTATGCCACCGGTCAGCAGGCCGAAGCCCTGGTTGAA
4 2 1 4 -------------------- + -------------------- + --------------------- + ------------------+ --------------------- + ---------------------+ 4 1 5 5
TTGCCAGCGTAGGACGTATGAGTGATACGGTGGCCAGTCGTCCGGCTTCGGGACCAACTT
A s n G ly A r g lle L e u H is T h r H is T y r A la T h r G ly G ln G ln A la G lu A la L e u V a lG lu
4154
CACGGTGATATCCGTTGCCTCGGTCCCCGTTGTGACAAACCCGCCGGGCATACGCTTCAG
--------------------+ --------------------+ ---------------------- + ------------------+ --------------------- + ---------------------+ 4 0 9 5
GTGCCACTATAGGCAACGGAGCCAGGGGCAACACTGTTTGGGCGGCCCGTATGCGAAGTC
H is G ly A s p I le A r g C y s L e u G ly P r o A r g C y s A s p L y s P r o A la G ly H is T h r L e u G ln
4094
AACCCGGTGGACGGTGTGACGGCTTATTACGGACGTGACAGTGGTTTCCGGATGGACAGT
--------------------+ --------------------+ ---------------------- + ------------------+ --------------------- + ---------------------+ 4 0 3 5
TTGGGCCACCTGCCACACTGCCGAATAATGCCTGCACTGTCACCAAAGGCCTACCTGTCA
A s n P r o V a lA s p G ly V a lT h r A la T y r T y r G ly A r g A s p S e r G ly P h e A r g M e t A s p S e r
4034
GAGGCGCGTGAGTACCGTTCTTTCAGGGAGGCTATTGCCACTGAAAGCACTGAAGAGGTG
--------------------+ --------------------+ ---------------------- + ------------------+ --------------------- + ---------------------+ 3 9 7 5
CTCCGCGCACTCATGGCAAGAAAGTCCCTCCGATAACGGTGACTTTCGTGACTTCTCCAC
G lu A la A r g G lu T y r A r g S e r P h e A r g G lu A la lle A la T h r G lu S e r T h r G lu G lu V a l
3974
CGCTTCCATTATGTGTTCATCGACGGCTACTGGAAGGTGATGTACCGCACGCCGGAAGGC
------------------- + --------------------+ ---------------------- + ------------------+ --------------------- + ---------------------+ 3 9 1 5
GCGAAGGTAATACACAAGTAGCTGCCGATGACCTTCCACTACATGGCGTGCGGCCTTCCG
A r g P h e H is T y r V a lP h e lle A s p G ly T y r T r p L y s V a lM e tT y r A r g T h r P r o G lu G ly
3914
TGGAAGATGAAAGCGCTCGCGCTGGCACTGCGTCGCTGTCCGAAAIGAAAAAAAGGCGGG
------------------- + ---------------------+ -------------------- + --------------------+ ---------- 1------ \--+ -------------------- + 3 8 5 5
ACCTTCTACTTTCGCGAGCGCGACCGTGACGCAGCGACAGGCTTTACTTTTTTTCCGCCC
T r p L y s M e tL y s A la L e u A la L e u A la L e u A r g A r g C y s P r o L y s *
3854
GCGATAAACCCTGCCTCTCTCCGCCGTTACTTCCCCGCCAGGAAGAGCGGCAGTCATCAA
--------------------+ --------------------+ ---------------------- + ------------------+ --------------------- +
+ 3795
CGCTATTTGGGACGGAGAGAGGCGGCAATGAAGGGGCGGTCCTTCTCGCCGTCAGTAGTT
o r f 3 —►
3 7 9 4
CAACATAAGGAGTAATATTpTGAGACCATCAATTATCTTCGCAACCGCCGAGTATGTAAA
-------------------- + -------------------W - --------------- + ------------------+ --------------------- +
+ 3735
GTTGTATTCCTCATTATAACACTCTGGTAGTTAATAGAAGCGTTGGCGGCTCATACATTT
V a lA r g P r o S e r I le lle P h e A la T h r A la G lu T y r V a lL y s
3734
GCGTCTGCGTGAAGAGTGCCTGCGGGAGAATAAACCCCTGCACCGCCATACCCGCTTCAG
--------------------+ --------------------- + -------------------- + -------------------- + -------------------- + -------------------+
3675
CGCAGACGCACTTCTCACGGACGCCCTCTTATTTGGGGACGTGGCGGTATGGGCGAAGTC
A r g L e u A r g G lu G l u C y s L e u A r g G lu A s n L y s P r o L e u H i s A r g H i s T h r A r g P h e A r g
ACGTCAGGAGCTGGCACAGGATGAGATTAACCCGGACGTCCTGGCGATGAGCGGCCATAT
3674
+---------------+---------------+---------------+---------------+-------------- + 3615
TGCAGTCCTCGACCGTGTCCTACTCTAATTGGGCCTGCAGGACCGCTACTCGCCGGTATA
A r g G lu G ln L e u A la G ln A s p G lu I le A s n P r o A s p V a lL e u A la M e tS e r G ly H is I le
P stI
cgccagacgE tg caS tgagcagaagcgggtgcgtatccccgctatgaaagtcagcgaatg
3614
-------------------- hr------- J ---------- + -------------------+ -------------------- + -------------------+
+ 3555
GCGGTCTGCGACGTCACTCGTCTTCGCCCACGCATAGGGGCGATACTTTCAGTCGCTTAC
A la A r g A r g C y s S e r G lu G ln L y s A r g V a lA r g lle P r o A la M e tL y s V a lS e r G lu T r p
GGGCCACCTGCTCCGCGCGCTTGAAATAGAGCGGGTCTGCCAC|rGAtrTAACCCTTGCCGT
3554
--------------------+ ----------------------+ -------------------+ --------------------+ -------------------+ ----------------------+ 3 4 9 5
CCCGGTGGACGAGGCGCGCGAACTTTATCTCGCCCAGACGGTGACTAATTGGGAACGGCA
G ly H is L e u L e u A r g A la L e u G lu I le G lu A r g V a lC y s H is *
rbs
orf 2 —►
CTGCCTGTGCAGGCGGCAGGATACGTTCAGACATCTCACCAGGAGGAACCjGTGAGTAAGA
3494
+ 3435
GACGGACACGTCCGCCGTCCTATGCAAGTCTGTAGAGTGGTCCTCCTTGGCACTCATTCT
V a lS e r L y sL y s
3434
AGAAAAACACCACAACGCCCACGCCGCATGATGCCGCGTTCCGGTCGTTCCTGGCGAATC
-------------------- h---------------------- H--------------------- H--------------------- H---------------------+
h3375
TCTTTTTGTGGTGTTGCGGGTGCGGCGTACTACGGCGCAAGGCCAGCAAGGACCGCTTAG
L y s A s n T h r T h r T h r P r o T h r P r o H is A s p A la A la P h e A r g S e r P h e L e u A la A s n P r o
3374
CCGACGTCGCCAGAGATTTTCTGGAACTGCATCTTCCTGCGGAGTACCGGCAGTTGTGCG
--------------------+ ---------------------+ -------------------- + -------------------- + -------------------- + ---------------------+
3315
GGCTGCAGCGGTCTCTAAAAGACCTTGACGTAGAAGGACGCCTCATGGCCGTCAACACGC
A s p V a lA la A r g A s p P h e L e u G lu L e u H is L e u P r o A la G lu T y r A r g G ln L e u C y s A s p
3314
ACCTGTCCACGCTGAAGCTGGAACCCGCCACCTTTGTTGAGCCGGACCTGCATCAGTACG
--------------------+ --------------------- + -------------------- + -------------------- + -------------------- + ---------------------+ 3 2 5 5
TGGACAGGTGCGACTTCGACCTTGGGCGGTGGAAACAACTCGGCCTGGACGTAGTCATGC
L e u S e r T h r L e u L y s L e u G lu P r o A la T h r P h e V a lG lu P r o A s p L e u H is G ln T y r A la
CCAGCGATATCCTCTGGAGCGTGAAAACCACCGGGGGTGAAGATGGTTATGTTTATACGC
3254
---------------------------+ -----------------------------+ --------------------------- + ----------------------------+ --------------------------- + ---------------------------- +
3195
GGTCGCTATAGGAGACCTCGCACTTTTGGTGGCCCCCACTTCTACCAATACAAATATGCG
S e r A s p I le L e u T r p S e r V a lL y s T h r T h r G ly G ly G lu A s p G ly T y r V a lT y r T h r L e u
TCATCGAGCACCAGAGCACCGAAAATCTGTACATGCCTTTTCGCATGTTACGCTACAGTG
3194
--------------------------- + ------------------------------ + -------------------------- + --------------------------- + --------------------------- + ---------------------------- +
3135
AGTAGCTCGTGGTCTCGTGGCTTTTAGACATGTACGGAAAAGCGTACAATGCGATGTCAC
I le G lu H is G ln S e r T h r G lu A s n L e u L y s M e tP r o P h e A r g H e tL e u A r g T y r S e r V a l
3134
TGGCGGCGATGCAGAGACATCTGGAGCAGCACAAAACGTTGCCACTGGTCATTCCGGTGC
--------------------+ ----------------------+ ------------------- + -------------------- + -------------------- + ---------------------+ 3 0 7 5
ACCGCCGCTACGTCTCTGTAGACCTCGTCGTGTTTTGCAACGGTGACCAGTAAGGCCACG
A la A la M e t G ln A r g H is L e u G lu G ln H is L y s T h r L e u P r o L e u V a llle P r o V a lL e u
3074
TGTTCTATCACGGTGAGCGCAGCCCGTACCCGTACAGCATGAACTGGCTGGACTGTTTTG
--------------------+ ----------------------+ ------------------- + -------------------- + -------------------- + ---------------------+
ACAAGATAGTGCCACTCGCGTCGGGCATGGGCATGTCGTACTTGACCGACCTGACAAAAC
3015
P h e T y r H is G ly G lu A r g S e r P r o T y r P r o T y r S e r M e tA s n T r p L e u A s p C y s P h e G lu
3014
AGAATCCGGCGCTTGCGGCTAAAATATACACAAAGCCGTTTCCGCTGGTTGATATCACTG
--------------------+ ----------------------+ -------------------+ -------------------- + -------------------- + ---------------------+ 2 9 5 5
TCTTAGGCCGCGAACGCCGATTTTATATGTGTTTCGGCAAAGGCGACCAACTATAGTGAC
A s n P r o A la L e u A la A la L y s I le T y r T h r ly s P r o P h e P r o L e u V a lA s p I le T h r V a l
2954
TCGTTGATGACAATGAAATCATGAACCATCGCCGGATGGCCGCACTGACGCTGCTGATGA
-------------------- + ---------------------+ -------------------- + --------------------+ --------------------+
+ 2895
AGCAACTACTGTTACTTTAGTACTTGGTAGCGGCCTACCGGCGTGACTGCGACGACTACT
V a lA s p A s p A s n G lu I le M e tA s n H is A r g A r g M e tA la A la L e u T h r L e u L e u M e tL y s
P stI
2894
AGCATATCCGTCAGCGGGATATGCTGATGTGTCTGGACAACCTGGTCAGAGCACTGCAGp
-------------------- + ---------------------+ -------------------- + --------------------- + ------------------+
y
=*+ 2 8 3 5
TCGTATAGGCAGTCGCCCTATACGACTACACAGACCTGTTGGACCAGTCTCGTGACGTCC
H is I l e A r g G l n A r g A s p M e t L e u M e t C y s L e u A s p A s n L e u V a l A r g A l a L e u G l n A s p
2834
ACATCCAGGATGAAGAGCAGATTACAGTTCTTTTCAACTATCTGCTTAATGGCAGCGAAC
-------------------- + ---------------------+ -------------------- + --------------------- + ------------------+ ---------------------- + 2 7 7 5
TGTAGGTCCTACTTCTCGTCTAATGTCAAGAAAAGTTGATAGACGAATTACCGTCGCTTG
I le G ln A s p G lu G lu G ln lle T h r V a lL e u P h e A s n T y r L e u L e u A s n G ly S e r G lu H is
2774
ATGTAACGGTTGAATTTTTGCAGACGCTGGCGCAGCGACTGCCGCAGCACGAGGACAGCA
-------------------- + ---------------------+ -------------------- + --------------------- + ------------------+ ---------------------- + 2 7 1 5
TACATTGCCAACTTAAAAACGTCTGCGACCGCGTCGCTGACGGCGTCGTGCTCCTGTCGT
V a lT h r V a lG lu P h e L e u G ln T h r L e u A la G ln A r g L e u P r o G ln H i s G l n A s p S e r l l e
2714
TTATGACACTGGCAGAACGTCTTAAGCAGGAAGGTATCCAGCAAGGTATCCAGCAGGGTA
-------------------- + --------------------- + -------------------- + --------------------- + ------------------+ ---------------------- + 2 6 5 5
AATACTGTGACCGTCTTGCAGAATTCGTCCTTCCATAGGTCGTTCCATAGGTCGTCCCAT
M e t T h r L e u A la G l u A r g L e u L y s G l n G lu G l y l l e G l n G l n G l y l l e G l n G l n G l y l i e
2654
TCCAGCAGGGTATCCAGCAGGGAGTTCAGCAGGGGGCGCTTCAAAAAGCACGGGAAATCG
-------------------- + ---------------------+ -------------------- + --------------------- + ------------------+ ---------------------- + 2 5 9 5
AGGTCGTCCCATAGGTCGTCCCTCAAGTCGTCCCCCGCGAAGTTTTTCGTGCCCTTTAGC
G ln G ln G ly I le G ln G ln G ly V a lG ln G ln G ly A la L e u G ln L y s A la A r g G lu I le A la
2594
CCCGGGAGCTCCGGAACGCGGGAATGCCGGCAGCACAAATCTGTCAGCTGACCGGACTTT
-------------------- + ---------------------+ -------------------- + --------------------- + ------------------+ ----------------------+ 2 5 3 5
GGGCCCTCGAGGCCTTGCGCCCTTACGGCCGTCGTGTTTAGACAGTCGACTGGCCTGAAA
A r g G lu L e u A r g A s n A la G ly M e t P r o A la A la G ln lle C y s G ln L e u T h r G ly L e u S e r
2534
C TGAAGC TGAACTGAAG AACATC AC TC A cflG A rGA GAGCCAAAAGGCCCGGCAAAATGCC
-------------------- + -------------------- + -------------------- + --------------------- + ------------------+
+ 2475
GACTTCGACTTGACTTCTTGTAGTGAGTGACTACTCTCGGTTTTCCGGGCCGTTTTACGG
G lu A la G lu L e u L y s A s n lle T h r H is *
2474
*
GGGCCTTTTGCCAGCAGGAGCAGAGAAAACAGTATGACGATTGCAGAACGTCTTATACAG
-------------------- + -------------------- + -------------------- + --------------------- + ------------------+ ---------------------- + 2 4 1 5
CCCGGAAAACGGTCGTCCTCGTCTCTTTTGTCATACTGCTAACGTCTTGCAGAATATGTC
AAAGGTTTTGAAAAAGGTGCTCTTGAAGTGGCGCGGGAAATAGCCTGCCGGCTTCGGGAT
2 4 1 4 --------------------- + -------------------- h---------------------+ ---------------------+ ------------------+
+ 2355
TTTCCAAAACTTTTTCCACGAGAACTTCACCGCGCCCTTTATCGGACGGCCGAAGCCCTA
2354
ATGGGCTGGACGCCGGAACGGATTCAGGAGGCCACGGGACTTTCCGGTGAAGAACTGAAA
--------------------+ --------------------- + -------------------- + ---------------------+ ------------------+
+ 2295
TACCCGACCTGCGGCCTTGCCTAAGTCCTCCGGTGCCCTGAAAGGCCACTTCTTGACTTT
2294
AAACTGTTTCCTGATGAGCAGTAGCCTGGCATTCTGCCAGGCTGTGAACCACGCTCACAC
--------------------+ --------------------- + -------------------- + ---------------------+ ------------------+
+ 2235
TTTGACAAAGGACTACTCGTCATCGGACCGTAAGACGGTCCGACACTTGGTGCGAGTGTG
2234
ATCCTCTGCCGTTTCCCCCAGTTCATTTTCCAGACGCCTGATGATATCTGCCTTGCGCAT
--------------------+ --------------------- + -------------------- + ---------------------+ ------------------+
+ 2175
TAGGAGACGGCAAAGGGGGTCAAGTAAAAGGTCTGCGGACTACTATAGACGGAACGCGTA
CCCCTGCATGTGAGGCAGCAGGTCACGGACTGAAAGTGCCTGGGTGGTCCTCCAGACGGT
2 1 7 4 --------------------- + --------------------+ -------------------- + ---------------------+ ------------------+
+ 2115
GGGGACGTACACTCCGTCGTCCAGTGCCTGACTTTCACGGACCCACCAGGAGGTCTGCCA
2114
GACATCCACCTGTTCCGCATTTTCCCAGGCGTGCCATGTTCTCTGTGTCACGCCAAATTC
-------------------- + -------------------- + -------------------- + --------------------+ -------------------- +
+ 2055
CTGTAGGTGGACAAGGCGTAAAAGGGTCCGCACGGTACAAGAGACACAGTGCGGTTTAAG
2054
TCTGGCCGCTTTTTCGCGTGACCAGAGCATGCTTTTTCGCCAGATTCGCAGTTCCCAGCC
-------------------- + -------------------- + -------------------- + --------------------+ --------------------+
+ 1995
AGACCGGCGAAAAAGCGCACTGGTCTCGTACGAAAAAGCGGTCTAAGCGTCAAGGGTCGG
GGTCATAAAACACCTTTGAAAAAGTGAAAAAACTTCACTTTATTTTATCACCATAACCAC
1 9 9 4 ---------------+---------------+---------------+---------------+---------------+
+ ig35
CCAGTATTTTGTGGAAACTTTTTCACTTTTTTGAAGTGAAATAAAATAGTGGTATTGGTG
1934
CAAATCAGCGCGAAAAATAAGTGTGAAAAAGTGAAGGAATTTCACTTTTTTTGATTGTAG
-------------------- + -------------------- + --------------------+ --------------------+ --------------------+
+ 1875
GTTTAGTCGCGCTTTTTATTCACACTTTTTCACTTCCTTAAAGTGAAAAAAACTAACATC
1874
GTGTCGTGCTGTTTTCTCTGTTTTCACCTGTGCGGGAGTGGTGTGCCAGTGACCACCACA
-------------------- + -------------------- + -------------------- + --------------------+ --------------------+ ---------------------+ 1 8 1 5
CACAGCACGACAAAAGAGACAAAAGTGGACACGCCCTCACCACACGGTCACTGGTGGTGT
TGCCATTGTTGCGCCGTCGTTTTTCTTC
S S il
1 8 1 4 -------------------- + -------------------- + -----------------ACGGTAACAACGCGGCAGCAAAAAGAAGTCAGCGCGGCCTACGCCGCGAGGGACGTGTGG 1 7 5 5
1 7 5 4 AATGCCACACATTCCGGTGACGCGGACTACCGCGTCGACAGAGACGGACAGACGGCGGCG 1 6 95
16 94
TGACGCCGGACAAGAGGCGTCTACCTGAAAGGCCCCCATGTATGTGCTGGTGTAGGGCAA 1 6 3 5
1 6 3 4 AGTCAGCAGGTCCCCTCTCTACATGGTCGGTGTTTTGAAAAACGGCGTCCGCAGTTTTTG 1 5 7 5
1574
AAAACGCAGACGGGGGCCTGTTGACGGGGCACTGCACCACTCGCAGGGGGCAGCCTTTCC 1 5 1 5
1514
GGAA
+ 1455
AGGTGACGCCCCTTTAGGGGCTTCTGGGCCTGCCGTCTTCCTCGAAGCGAGGAGGCCCTT
rbs
a t g a c c t g g c t g a c c c g g c a g t c g t g a c g a t g a g g a g a c a a t g t g Ia t g Ra t c a g a c t t t a
1454
--------------------+ --------------------- + -------------------- + -------------------- + -------------------- + ------------------- + 1 3 9 5
TACTGGACCGACTGGGCCGTCAGCACTGCTACTCCTCTGTTACACTACTTAGTCTGAAAT
M e t A s n G ln T h r L e u
1394
CCCACTGCTGACCTGAATACTGCCGGCACGACAGATGTTATTCCGTCTGTGGCCATCGAC
--------------------+ --------------------- + -------------------- + -------------------- + -------------------- + ------------------- + 1 3 3 5
GGGTGACGACTGGACTTATGACGGCCGTGCTGTCTACAATAAGGCAGACACCGGTAGCTG
P r o T h r A la A s p L e u A s n T h r A ia G ly T h r T h r A s n V a llle P r o S e r V a lA la lle A s n
1334
CGCATCATCGCGCAGCGTAACGAAGGTATTGCACTGTTCATGCAGGCGATGGAATGCCTG
--------------------+ --------------------- + -------------------- + -------------------- + -------------------- + ------------------- + 1 2 7 5
GCGTAGTAGCGCGTCGCATTGCTTCCATAACGTGACAAGTACGTCCGCTACCTTACGGAC
A r g lle lle A la G ln A r g A s n G lu G ly lle A la L e u P h e M e tG ln A la M e tG lu C y s L e u
1274
GCGACAGCGCGCAGGATTCTGCTTGATGCGTCAGGTGATATTTTTCTTTACGGTTTTGAA
--------------------+ --------------------- + -------------------- + -------------------- + -------------------- + ------------------- + 1 2 1 5
CGCTGTCGCGCGTCCTAAGACGAACTACGCAGTCCACTATAAAAAGAAATGCCAAAACTT
AlaThr A l a A r g A r g l l e L e u L e u A s p AlaSe rGlyAspIlePheLeuTyrGlyPheGlu
GACTGCGTGACCGACTCCGTTCGGTGCATGGATAAACCGGAAGAAGCGAAAAGGAATATC
1 2 1 4 --------------- H
-------------------- 1------------------+------------------H
----------------- h----------------+ 1155
CTGACGCACTGGCTGAGGCAAGCCACGTACCTATTTGGCCTTCTTCGCTTTTCCTTATAG
A s p C y s V a lT h r A s p S e r V a lA r g C y s M e tA s p L y s P r o G lu G lu A la L y s A r g A s n lle
ACCCGTCTTGCCGACCGGAAAATCTGGGACCGCCTGATGACGGATACGGGGATGTACACC
1 1 5 4 --------------- +------------------ +-----------------+-----------------+-----------------+----------------+ 1095
TGGGCAGAACGGCTGGCCTTTTAGACCCTGGCGGACTACTGCCTATGCCCCTACATGTGG
T h r A r g L e u A l a A s p A r g L y s I le T r p A s p A r g L e u M e t T h r A s p T h r G l y M e t T y r T h r
TTCATGAGTTCATGTCAGCGTGATGAGTGGAACAGCCAGCTGATGAGCGACACCTGTCCT
1094 ---------------- +------------------+-----------------+-----------------+-----------------+----------------+ 1035
AAGTACTCAAGTACAGTCGCACTACTCACCTTGTCGGTCGACTACTCGCTGTGGACAGGA
P h e M e t S e r S e r C y s G l n A r g A s p G lu T r p A s n S e r G l n L e u M e t S e r A s p T h r C v s P r o
GAAATCACCCTGGACAATGTACTGGCAACTTTTCGCCATCTGAATGCCAGTAAGATGCAG
1034 ---------------- h------------------- +-----------------+-----------------+-----------------+----------------+ 975
CTTTAGTGGGACCTGTTACATGACCGTTGAAAAGCGGTAGACTTACGGTCATTCTACGTC
G lu I le T h r L e u A s p A s n V a lL e u A la T h r P h e A r g H is L e u A s n A la S e r L y s M e tG ln
ACATTTGAACAGGGACTGATTGATGTCTACCGGAAATTGTCATGGGATTACAGAACCAAT
974 ----------------- h------------------- h------------------ h----------------+---------------- +----------------+ 915
TGTAAACTTGTCCCTGACTAACTACAGATGGCCTTTAACAGTACCCTAATGTCTTGGTTA
T h r P h e G lu G ln G ly M e t lle A s p V a lT y r A r g L y s L e u S e r T r p A s p T y r A r g T h r A s n
AATCCCTGCCGTCTGGGCAAGAGAATCATTATTGAAAACCTGCTGTACCGCTGGAGTAAC
9 ! 4 --------------------- + -------------------- + --------------------- + -------------------+ -------------------- + ------------------- + 855
TTAGGGACGGCAGACCCGTTCTCTTAGTAATAACTTTTGGACGACATGGCGACCTCATTG
A s n P r o C y s A r g L e u G ly L y s A r g lle lle lle G lu A s n L e u L e u T y r A r g T r p S e r A s n
P stI
8 5 4 --
GGGCGTGTTACGCTGG^CTGCAGCGGACGGGAGGCACTGGATGACCTGGTACGTCCGTTT
+ -----------------------------+ --------------------+ --------------------+ -------------------- +
795
CCCGCACAATGCGACCTGACGTCGCCTGCCCTCCGTGACCTACTGGACCATGCAGGCAAA
G ly A r g V a lT h r L e u A s p C y s S e r G ly A r g G lu A la L e u A s p A s p L e u V a lA r g P r o P h e
7 9 4
TATCTGCTGGAGGGGCGCAACGTTCCTGACTTCCGGAGCAGCATCGGGGCGCAGTACGGT
--------------------- + -------------------- + -------------------- + -------------------- + -------------------- + ------------------- +
735
ATAGACGACCTCCCCGCGTTGCAAGGACTGAAGGCCTCGTCGTAGCCCCGCGTCATGCCA
T y r L e u L e u G lu G ly A r g A s n V a lP r o A s p P h e A r g S e r S e r lle G ly A la G ln T y r G ly
7 3 4
GAATTTATCGGGAACGGCGACAATGTCGGTAAGCTGTTAGAAGGGGAATATTTTACGGTG
--------------------- + -------------------- + -------------------- + -------------------- + -------------------- + ------------------- +
675
CTTAAATAGCCCTTGCCGCTGTTACAGCCATTCGACAATCTTCCCCTTATAAAATGCCAC
G lu P h e lle G ly A s n G ly A s p A s n V a lG ly L y s L e u L e u G lu G ly G lu T y r P h e T h r V a l
674
CGTGGCTACCAGAAAGGGACCGTACACATTGTCTTTAAGCGTCCTGACCTTGTTGAAAAA
+--------------- +---------------+---------------+---------------+-------------- + 615
GCACCGATGGTCTTTCCCTGGCATGTGTAACAGAAATTCGCAGGACTGGAACAACTTTTT
A r g G ly T y r G ln L y s G ly T h r V a lH is I le V a lP h e L y s A r g P r o A s p L e u V a lG lu L y s
CTGAATGATATTATTGCACGGCATTATCCTGGTTCATTGCCGCCACGAGTCjTGAjrTAAAC
6 1 4 ----------------- +---------------- +----------------- +----------------+---------------- +---------------- +
555
GACTTACTATAATAACGTGCCGTAATAGGACCAAGTAACGGCGGTGCTCAGACTAATTTG
L e u A s n A s p I le lle A la A r g H is T y r P r o G ly S e r L e u P r o P r o A r g V a l*
5 5 4
AGAAAAGCCCTGGTATTTATGCCGGGGCTTTTTTTCTGTAATCATCATAATATCAGAACA
--------------------- + -------------------- + --------------------- + -------------------+ --------------------+ --------------------+ 495
TCTTTTCGGGACCATAAATACGGCCCCGAAAAAAAGACATTAGTAGTATTATAGTCTTGT
TGATGTGACATTGTCACATCAATTGTTGTTCATATCGATGCCATCTTTCCTGGCTGAATC
494
—
i----------------1----------------
—
—h--------------- 1-
h
435
ACTACACTGTAACAGTGTAGTTAACAACAAGTA^AG|CT^CGGTAGAAAGGACCGACTTAG
CM
TGTCTTTTTAGATGCTGTTTTAGAGGAAGAACGGCGGGATGGCTTTTTCGATTCTGCTTC
434 --------------+-------------- +-------------- +-------------- +--------------+
+ 375
ACAGAAAAATCTACGACAAAATCTCCTTCTTGCCGCCCTACCGAAAAAGCTAAGACGAAG
CCGAATAATGTCACGAAGTGCCTTCTCTCCTACTTCATACCCTGCATTTTTGAGCGTGTC
374 --------------- 1--------------- _|--------------- 1---------------1_---------------(--------------- 1. 315
GGCTTATTACAGTGCTTCACGGAAGAGAGGATGAAGTATGGGACGTAAAAACTCGCACAG
ACGAACATCTGCCAGTGTATAACCCTTTGTCCTTACCAGAACAATAATGTCATCACGAAT
314 -------------- +-------------- +-------------- +-------------- +--------------+-------------- + 255
TGCTTGTAGACGGTCACATATTGGGAAACAGGAATGGTCTTGTTATTACAGTAGTGCTTA
BgUI
GGCATCAAGAAAATCACGCAATGTTTTCCGTTGAGCGGTGAGATCTpGCAATTCCGATAA
254
+
+
+
+■=-
+
+ 195
CCGTAGTTCTTTTAGTGCGTTACAAAAGGCAACTCGCCACTCTAGACCGTTAAGGCTATT
AGCAGCTTTTGCCAGCTGGATGTCATCATCTGAGTAAAATTTTTTAGAAGCCATTGGCAC
194
--------------------------- + ---------------------------- + ----------------------------+ --------------------------- + -------------------------- + ---------------------------- +
135
TCGTCGAAAACGGTCGACCTACAGTAGTAGACTCATTTTAAAAAATCTTCGGTAACCGTG
TTTCTCTCCGTTTCATGTTGAAGTCTGATTTGATCATCAAAAACTGACTCCTGGCAGGCT
134 -------------- +-------------- +-------------- +-------------- +--------------+-------------- + 75
AAAGAGAGGCAAAGTACAACTTCAGACTAAACTAGTAGTTTTTGACTGAGGACCGTCCGA
GCGCCCTGCCTCTGCCGTCTGCATAAGACTATGATGCACAAAAATAACAGGCTATAATGG
---------------+--------------- +---------------+---------------+-------------- +
+ 15
CGCGGGACGGAGACGGCAGACGTATTCTGATACTACGTGTTTTTATTGTCCGATATTACC
CCTGAAAAACGGGA
1 4 ------------ +------- i
GGACTTTTTGCCCT
w as d istin g u ished by its low GC content (see section 7.2.4; Fig. 7.5). H ow ever, it
rem ains to be determ ined if such a p u tativ e IS elem ent is still active.
C om parisons of the predicted am ino acid sequence of orf2 to sequences
p resen t in the databases revealed th at Orf2 shares hom ology (47-50% identity)
to a fam ily of hypothetical proteins th a t have been identified in E. coli through
the genom e sequencing project (B lattner et al., 1997). The functions of these
p ro tein s YADD, YFAD, YHGA and YJIP are unknow n. O ne other hom ologue
(55.6% identity) to Orf2 is the plasm id-encoded Orf73 of Yersinia pestis plasm id
pM T l. Again, the function of this p ro tein of pM T l is unknow n.
The p red icted am ino acid sequence of orfl displayed a w eak hom ology
(29% identity, 35% sim ilarity) over 197 am ino acid residues of the C -term inal
region to a p lasm id -en co d ed restriction m ethylase gene of IncH plasm id R478
(EMBL: U60283). H ow ever, no other sim ilar hom ologues w ere found. Finally,
the p red icted am ino acid sequence of orf4 show ed no significant hom ology to
o th er p ro tein s av ailable in the d atab ases and or/3 w ith E. coli h y p o th etica l
p ro tein YDFB.
The p o ten tial functions of all these orfs identified w ithin the leading
region of Collb are sum m arised in Table 7.2.1.
7.2.4
G + C content of the Collb leading region
The overall G + C content of the 11.7 kb leading region of Collb w as
55.7% (Fig. 7.5), w h ich is higher th an the predicted value of 51-52% for the
genom e th at the p lasm id w as originally isolated in, nam ely Shigella sonnei P9
(O chm an and Law rence, 1996).
The G + C content drops significantly below the average at base positions
7500-6000 to 45 % (Fig. 7.5). On the basis that the GC contents of closely related
organism s ten d to be sim ilar, such a finding is indicative of an insertion into
the backbone of the lea d in g region du rin g its evolution.
Interestingly, this
region corresponds to the position of orf5 and the putative IS elem ent w e have
identified (Section 7.2.3).
103
Fig. 7.4. A lingm ent of the nucleotide sequences of s s i elem ents in the C ollb Tstrand and Frp o.
L ine 1, s s i 3 ; line 2, ssz‘2; line 3, s s i l ; line 4, F r p o .
N u c le o tid e s th a t a re
hom ologous are boxed. C oordinates in the leading region sequence are ssi3, 2331; ssi2, 7036-7361; s s i l , 9928-10256. F rpo is taken from M asai and Arai (1997).
Figure is taken from Bates et ah, (1999).
Fig.7.4
2 0 ___________________ 30
10
A o
a
a a
a c a
a c T
o c a A A
a c C
a c a a a
a c T
c c t a
G a a a a
G a a a a
T T T T| 0
a a
c c ' t | c | c t o c c o t c c A C lT
C C T T C T O C C O T C C a [c]t
C C T T C T a C C q T C C| a a a
c c t t PF } t q | 'r t c c j c f r
70
T T T CC 0
A C a a a a a A - C 0 C T C A C C A C a T C AC
g
[c
r~
ale
a
T | q a q a C A T C A C T o le C A c
o
T
A T - T
A G - T
A C A T
T
T
T
T
T
T
T
T
a:
t
A C t
a
a
00^ o
A A C
0 O
a
c |o
T O O
COT
COT
COT
COT
O £
A
G
•r
A
o p r jT o
a 0 T o a c a a c a 0
a G T a a c a a c G a
a - c a a c a a c A a
c A c a" a [ c ] a a [ £ a a
310
aaaa
c
tJ c
a
c c
120
C A O C T O T C C o a a o a c
0 a A a a A -
C A
o
A 0 A -
cl a
a c
[7 |t
c |c [t
110
C A O C T O T C C O O O O O C
o t c c o o o o o c
T O T C C o a a a a c
- c 0 c A A A
- c a c A A A
- c a c A A A
A A G A C c 0 c A A A
180
t
o
260
G
A
A
O
A G
A G
C A
C A
- Aj C C C T O O A C A
C C C C T O O A C T
220
210
OcT [ tt_| oa C
j c0 - C C C C C O O A
C C A 0 - C C C C C O O A
oA
t J tc ao t T
g A C C C C C 0 0 A
q | c t | t a| qCt cC c c c | o o t | o a
0
o
o
a
- - A A
- - T T
c A O A
c A C C
320
a
a
a
c
c
a c
a c
o le
a
T
T
A
C
c t
c c t
c A
gIc
- -j
ole
A |C
c Aa 0 c
A A
A A
OT C C A
OT C C A
A A
CAa o c
a
c
a
E1
o|o
o ( c [ 7 'T * A
c a a a
o c c A T C A a 0
a c c A T C A a o
o fjvjc o lT f o |A j A ] a
a
t
340
a [o
A O O T O T O C A O O O A O C O C
0 T C A c o o c o c o a c
T T T C c a a c o c o A c
A O a T a T O C A O O O A O C O C
c o o c o c o a c
T a
CATC
240
230
A A
a c c
330
G
T
OT C C A
280
a
o
o
a
C C C C T O O A C
C C C C T O O A C
A A
270
O
a
a
a
A o a T O T a c A a a a A O c a c
o c c c 'c ] t J t * a
a c ]c |t t t t t o a o a a
T T T T O T O O
A A A A
A A A A A G T T T T o jc ]o O O A
200
0 A |o fo ]G |o
250
C O C A O
c a c a a
c a c a a
a c | c J o [<j
aaaa
A A A A A T I T T O T O O
T T T T O T O O
A A A A
A A C O O O A T O T O O
T TJ A C a a c
q o
a a t a t a
a |o
a
60
150
T T O C C
T T O C C
T T q[a]c
T T Q C C
190
T O
a 0 0
[ g1 c | c g | o | a
130
A T
t
SO
T T C T C C C C O C A Q T Q O A C C
T T C T C C C C a C A O T O O A C C
T T - T C C C C q C A O T q q A CC|
100
T T T CC 0
tJ c
40
a a a a
c A C
c T T
c T T
T A T
90
A T a a a a a C C C a T T T a c c |o fc |c |T c a c a q a
A T a a a o[c 0 T C C G T C A C C A C O T C A C O Q O
T T T CC 0
'
80
T
T
T
a
A 0
a
t* g |a |a
O C A a T T T C C T
a c a a t G G C C T
a c a a t a a C C T
a cfu ]a t T T o le ja
q ac
300
290
c
c
c
c
a
t |o 0 c
C
T
T
-
A C A C
A C A C
A C A C
± F liL £
Fig. 7.5. G + C content of the Collb leading region.
P anel show s G+C% profile of the 11.7 kb of the C ollb lea d in g region.
h o rizo n tal line indicates the m ean v a lu e of 55.7% G+C.
The
The GC profile w as
calculated u sin g the program m e W INDOW (w indow = 500; shift = 25) follow ed
b y STATPLOT.
A bove the p an el is a genetic m ap of th e lea d in g reg io n
sh o w in g its o rganisation and position of genetic loci in relatio n to the G+C%
co n ten t.
In d icated on the m ap is th e nic site of the o r i T , the p u ta tiv e o r f s
id e n tifie d , the s s i sequences and s s b , p s i B and a r d A .
R estrictio n e n zy m e
cleavage sites are also indicated; B, Bglll; C, Clal; P, Psfl; S, Sail. N ote th at at base
po sitio n s 7500 - 6000 the G+C content d ro ps significantly to 45% w hich w o u ld
be indicative of an insertion into the backbone of the leading region d u rin g its
e v o lu tio n (orf5).
Fig. 7.5
ss i2
s s il
BC P
n ic
orf1
P
orf2
ssi3
P
c
orf4
ardA
orf5
psiA psiB
orf3
0+0%
60 -
50 -
40
Position from nic (kb)
orf6
P
ssb
7.2.5
Sim ilarity of the Collb leading region to other conjugative plasmids
Sequence d ata are only available for the leading regions of IncP plasm ids
RP4 an d R751 (P ansegrau et al., 1994a; Thorsted et al., 1998) and regions of
p la s m id F.
T h ro u g h our co m p ariso n s, no significant hom ologies w ere
detected b etw een the leading region of Collb and the genomes of RP4 and R751.
E xtensive nucleotide sequence sim ilarities betw een Collb and plasm id F
w ere fo u n d ex te n d in g from the Shine-Dalgarno sequence upstream of ssb to 2b p d o w n s tre a m of p s i A .
O ver this region, there is approxim ately 80%
co n serv atio n b e tw een Collb and F at the nucleotide sequence level. H ow ever,
it is im p o rta n t to n ote that the sequence of the corresponding region of F has
n o t b een p u b lis h e d in full particularly the region betw een ssb and psiB. N o
hom ology to F w as detected beyond the ps iA gene. It rem ains to be determ ined
if any hom ology exists further upstream of Collb ssb to plasm id F.
The sim ilarities betw een Collb and plasm id F has led us to conclude that
th e reg io n from s s b to p s i A m ay exist as a conserved cassette-like m odule,
w hich m ay also be p resent on a num ber of other plasm ids. Cross-hybridisation
to p lasm id s from Inc groups FI, FII, FIV, FVI, K, II, Y, 9 and B shows that ssb
an d psiB genes exist on a num ber of conjugative plasm ids all of which display
a h ig h d eg ree of id en tity w ith each other (Golub et al., 1988). The proposed ssbp s i A m o d u le is se p a ra te d from the rest of the leading region of Collb by a
p u ta tiv e IS elem ent (or/5).
The only other p a rt of the Collb leading region that bears sim ilarity w ith
th e lead in g reg io n s of other conjugative plasm ids is the a r d A gene (Section
7.2.3).
7.2.6
Exam ination of the Collb leading region for type I restriction enzym e
cleavage sites
The lead in g region of Collb has been exam ined for type II restriction
en zy m e cleav ag e sites th ro u g h restriction enzym e analysis of the p lasm id
104
Table 7.2.2 Type I restriction enzyme cleavage sites found within 11.7 kb of the leading region of Collb.
Family
Enzyme
K
EcoKI
EcoB
EcoD
Sh/SB
A
C
Recognition sequence
a a c n 6g t g c
Number
sites
1
Position in sequence
9646-9658
2
1
2438-2452; 7286-7299
StySF
TGAN8TCCT
t t a n 7g t c y
g a g n 6r t a y g
a a c n 6g t r c
EcoA
g a g n 7g t c a
2
2144-2163; 7643-7657
EcoE
g a g n 7g t c a
-
EcoR124
g a a n 6r t c g
3
4248-4266;6461-6473; 10796-108
EcoDXXI
t c a n 7r t t c
1
7086-8000
-
-
9646-9658
Type I restriction enzyme cleavage sites in the leading region of Collb were determined by comparing the sequence data
available with the recognition sequence of the enzyme using the GCG program FINDPATTERNS. Restriction enzyme
recognition sequences were obtained from REBASE via the World Wide Web (http ://reb ase.n eb .co m /reb ase/rebase.html).
N = unspecified base, R = A /G , Y = C /T.
(Rees et al., 1987). Several of these sites are indicated in Fig. 7.3. H ow ever, in
v i t r o an aly sis of any DNA for typ e I cleavage sites is m ade difficult by the
n a tu re of the cleaving reactions for this particular class of enzym e (C hapter
O ne, section 1.5.2) an d their lim ited availability. The m ost appropriate w ay to
determ in e the n u m b er of type I cleavage sites is to probe any sequence data that
is available for the enzym es recognition sequence.
C ollb h a s b e e n estim ated to have approxim ately 7 EcoKI restrictio n
en zy m e cleav ag e sites (B. M. W ilkins, p erso n al com m unication).
From
stu d ie s w ith a r d A an d the arrfA -in d e p en d e n t restric tio n evasion p ro cess
m ed iated b y C ollb, it is of interest to this project to determ ine how m any of
these sites can be fo u n d w ithin the leading region of Collb. Consequently, the
se q u e n c e
d a ta
w as
p ro b e d
fo r
th e
E coK I
re c o g n itio n
sequence
A A C N N N N N N G T G C (Wilson and M urray, 1991). O ur analyses revealed that
on ly one of the seven EcoKI cleavage sites can be found w ithin the sequenced
reg io n of the C ollb leading region at base positions 9646-9658 in orf6 (Table
7.2.2; Fig. 7.3).
Finally, the sequence data of the Collb leading region was also probed for
th e cleavage sites of a num ber of other type I restriction cleavage sites. The
enzym es chosen an d the results obtained are in Table 7.2.2.
7.2.7
Repeat sequences w ithin the leading region
T hree copies of a ~328-bp repeat sequence w ere identified w ithin the
seq u en ce d a ta av aila b le for the leading region of Collb.
Each rep e at is
p o sitio n ed in the sam e orientation approxim ately 60 nucleotides upstream of
eith er ssb, orf4 or orfl and the three repeats share betw een 80 and 85% identity
to each o th er over th e ir entire length. The repeats w ere labelled s s i l , s s i l or
ssz‘3 a n d are fo u n d at base p o sitio n s 1787-1459, 4678-4353, 11711-11381,
respectively (Fig. 7.3). C om parisons of the nucleotide sequence of each ssi to
those p resen t in the databases identified one hom ologue belonging to plasm id
105
F, originally term ed ssi D, w hich has now been renam ed F rpo. Each ssi shares
-60% id e n tity over 160-bp of th eir central p ortion to the F rpo sequence of
p lasm id F, as sh o w n in Fig. 7.4 (N om ura et al., 1991; M asai and A rai, 1997;
EMBL: D90178).
The F rpo sequence w as originally identified in the leading region of the
p lasm id F as a single-stranded D N A synthesis initiation sequence, hence the
n am e s s i D .
Early studies w ith the single-stranded phage M13 carrying s s i D
sh o w ed th a t the locus plays an active role in prim in g DNA synthesis on
sin g le-stran d ed viral DNA (N om ura et al., 1991). It w as later found by M asai
and A rai (1997) th at the repeat locus also had additional properties that allow it
to fu n c tio n as a n ovel type of p ro m o te r active in sin g le-stran d ed form .
C onsequently, the locus was renam ed F rpo.
The p ro m o te r form s in single-stranded DNA th ro u g h the form ation of
secondary structure. The close identity that exists betw een the ssi sequences
found in the leading region of Collb and Frpo of plasm id F suggests a sim ilar
role in C ollb. It is envisaged that such sequences m ay act as single-stranded
p ro m o ters th at form on the transferring plasm id strand and facilitate transient
expression of the leading region genes in the recipient before regeneration of a
com plem entary stra n d through DN A synthesis.
The fo rm ation of secondary structure and action of these ssi sequences
as p ro m o ters involved in enhancing expression of leading region genes d u rin g
conjugative transfer of the plasm id is discussed further in C hapter Eight.
7.3
Summary
G eneration and analysis of the 11.7 kb of nucleotide sequence data for
the Collb leading region led to the identification of the following features:
* Identification of ten p o tential pro tein coding regions, three of w hich have
been prev io u sly characterised (ssb, psiB, ardA).
106
* Three of the novel or/s identified include an F-like p s i A gene, another w hich
encodes a p o ten tial DNA binding protein (or/6) and one w hich is a m em ber of
the E. coli fam ily of genes know n as YHGA (or/2).
* Id en tificatio n of an u n u su al IS elem ent and a related O rf (or/5), the am ino
acid seq u en ce of w hich bears sim ilarity to a num ber of putative transposase
enzym es.
* All or/s id e n tifie d w ith in the lead in g region are orientated in the sam e
d irectio n to w a rd s o r i T (Fig. 7.2). Such an observation raises the question of
w h eth er the genes p resen t in the leading region of Collb are transcribed as p art
of an operon.
* The or/s id e n tifie d from ssb to ps iA of Collb and plasm id F appear to be
conserved as a cassette-like m odule that m ay be present on a num ber of other
conjugative p lasm id s.
* Three of th e or/s ( a r d A , orf6 and or/2) identified had hom ology to three or/s
p re s e n t on Y e r s in ia p es ti s p lasm id pM T l.
H ow ever, there is no general
sim ilarity in the genetic organisation of these two plasm ids.
F inally, th e m o st in terestin g finding was the identification of th ree
rep eat sequences (-328 bp) present in the leading region of Collb which appear
to be analogous to F rpo. It is envisaged that the Collb ssi sequences, like F rpo,
act as sin g le-stranded prom oters. Such findings have led us to assum e a m odel
ex p lan atio n as to h o w expression of the leading region genes on Collb are
enhanced d u rin g conjugative transfer of the plasm id (C hapter Eight).
107
Chapter Eight
General Discussion
T he fact th a t C ollb h as a n a rro w rep lica tio n -m ain ten a n ce ran g e
e n co m p assin g g e n era such as Escherichia, S a lm o n el la , Shigella and Kle bsiella
from the E nterobacteriaceae fam ily raises the question of w hy the plasm id has
e v o lv ed tw o se p a ra te strategies for restriction avoidance.
H ow ever, the
fin d in g th a t stra in s of Escherichia coli encode more th an a h u n d red know n RM system s (h ttp ://re b a se .n e b .c o m /re b a se /re b a se .h tm l) not only highlights the
u b iq u ity of these system s in natu re b u t suggests th at the ability of Collb to
overcom e ty p e I a n d type II restriction barriers m u st be a significant if no t
essential aid to transm ission. W hether Collb has recognition sites for all these
enzym es an d w h e th e r the restriction-avoidance m echanism s encoded by Collb
are active against all these R-M system s has yet to be determ ined.
The resistan ce of Collb to both type I and type II restriction enzym es
d u rin g its tran sfer b y conjugation involves two distinctive m echanism s. O ne
m e c h a n ism in v o lv e s a sp ecialised p lasm id -en co d ed a n tire stric tio n gene
k n o w n as a r d A , th e p ro d u c t of w hich is active ag ain st type I restrictio n
enzym es.
A n o th e r m echanism , w hich acts independently of a r d A , alleviates
restrictio n of C ollb from bo th type I and type II enzym es in the recipient in
second or su b seq u e n t rounds of transfer. The m ain th ru st of this thesis w as to
in v estig ate fu rth e r these tw o Collb restriction-evasion m echanism s.
The use
of a specially d e sig n ed genetic system that exploited the sensitivity of IncPp
p la s m id R751 to re stric tio n w as in stru m en tal in allo w in g a n u m b er of
observ atio n s to be m ad e about these tw o m echanism s and helped to rule out
h y p o th eses w h ic h w ere m ade for the ard A -in d ep en d en t m echanism .
The
genetic sy stem re lie d on m easu rin g C ollb-m ediated rescue of R751 from
d e stru c tio n by EcoKI (I) and EcoRI (II) during conjugation.
co n c lu sio n s a n d
For sim plicity,
o b se rv a tio n s m ad e for the C ollb a r d A - i n d e p e n d e n t
108
m ech an ism w ill be discussed first follow ed by those m ade for the A rdA
system . O ther w o rk described in this thesis involved an investigation into the
re g u la to ry m ec h a n ism g o v e rn in g lead in g region gene expression d u rin g
conjugation. The p ro p o sed m odel w ill be discussed last.
The C ollb restriction-avoidance m echanism w hich was identified using
an a r d A m u ta n t of Collb w as originally described by Read et al. (1992). It was
p o stu lated by R ead et al. (1992) th at am plified transfer of 93-kb Collb m ight
o v erw h elm the restric tio n enzym es in the recipient by substrate saturation,
reg ard less of w h e th e r they are type I or type II enzym es.
Such a scenario
should result in alleviation of restriction in trans. H ow ever, data presented in
this thesis are n o t in agreem ent w ith this 'substrate sa tu ratio n ' hypothesis.
F u rth e rm o re , re s u lts su g g e st th a t one m echanism is n o t responsible for
a llev iatin g re stric tio n from b o th type I and type II restriction enzym es as
p ro p o se d by R ead et al. (1992).
o b s e rv a tio n
th a t
u n lik e
th e
Such a conclusion w as d raw n from the
a n ti-ty p e
II m ech an ism , C o llb -m e d ia te d
alleviation of ty p e I restriction occurs independently of any plasm id transfer
and ap p ears to be expressed constitutively and in trans (Fig. 3.6 B). For clarity,
observations m ad e for these tw o m echanism s will be discussed separately.
The p o ssibility th at Collb alleviates type II restriction by overw helm ing
the enzym es by su b strate saturation during amplified transfer w as ruled out by
d ata in C hapter T hree (Fig. 3.3 A). The key finding w as that CoWodrd confers
no significant p ro te c tio n on restriction-sensitive plasm id R751 w hen the tw o
p lasm id s are co -tra n sferre d together to a restricting recipient.
If am plified
tra n s fe r of C ollb fro m the d o n o r to the recip ien t re su lte d in su b stra te
satu ratio n of restrictio n enzym es, then restriction should be alleviated in trans
an d the tran sm ission frequency of R751 should approach that observed in n o n ­
restricting m atings. H ow ever, data in Fig. 3.3 (A) clearly show s this not to be
the case. It also seem s unlikely from these results th at am plified transfer of
Q o W b d r d changes the physiology of the recipient such that there is a transient
109
b re a k d o w n of restriction. A gain, such a scenario should result in alleviation
of restriction in the recipient in trans.
The fin d in g th at Collb cannot alleviate ty p e II restriction in trans
su ggests th a t the plasm id m ust avoid destruction from such enzym es by a cisacting m echanism (see C hapter Six). A num ber of phages are know n to encode
a n ti-re s tric tio n m ec h an ism s th a t are czs-acting.
O ne su ch m ech an ism
involves th e ra n d o m incorporation of unusual bases into the genom e of the
p h ag e, such th a t th e DNA is n o t recognised as unm ethylated, the signal for
cleavage b y m an y restriction enzym es (Kruger and Bickle, 1983; Bickle and
K ruger, 1993). T hese unu su al bases are quite often m odified versions of either
a d en in e or cytosine residues as these are com m only the substrates for m ost
m eth y ltra n sfe ra se enzym es w ithin restriction enzym e recognition sequences.
S u ch b a ses are m a d e at th e level of n u cleo tid e m etab o lism a n d are
in c o rp o ra te d in to the genom e of the phage only.
C onsequently, p h a g es
d e m o n strate resistance to restriction; yet, their presence in a cell has no effect
o n re s tric tio n in trans.
It seem s unlikely that C ollb em ploys a sim ilar
m ech an ism of restriction-avoidance as the plasm id is sensitive to restriction
en zy m e cleavage in vitro.
Furtherm ore, R751 DNA should also be m odified
w h e n p resen t in th e sam e cell as Collb by using the sam e nucleotides.
The p o ssib ility th at Collb carries another antirestriction gene(s) cannot
be ru led o u t by an y data in this thesis. One idea is that such a gene(s) encodes a
non-specific m ethyltransferase enzym e that random ly m ethylates the genom e
of th e p lasm id.
Such a gene m u st only be expressed d u rin g conjugation, as
C ollb DN A isolated from vegetatively growing cells is sensitive to the effects of
restric tio n in vitro and in vivo du rin g transform ation (Rees et al., 1987; Read
et al., 1992).
If the gene is lim ited to expression d u rin g conjugation, it seem s
likely th at the gene should be situated w ithin the leading region of Collb.
E x am in atio n of th e sequence data generated for the leading region of C ollb
(C h a p te r Seven) id e n tifie d only one p o ten tial orf th a t m ig h t e n co d e a
m eth y lase.
The p ro d u c t of o r f l , displays w eak sim ilarity to a p u ta tiv e
110
restrictio n m eth y lase of IncH plasm id R478 (U60283) of Serratia marcescens.
H o w ev e r, the reg io n of hom ology (29% identity, 35% sim ilarity o v er Cterm in al 197 am in o acids) does n o t encom pass the N-6 adenosine m ethylase
sig n a tu re ty p ical of DN A m ethylases.
No other or/s identified w ith in the
com plete n u cleo tid e sequence of Collb w ere found to have hom ology to other
restriction m ethylase genes (Fig. 8.1).
It seem s unlikely from these predictions m ade for O rfl that the putative
p ro te in m e th y la te s C ollb d u rin g conjugation to p ro tect the plasm id from
d e stru c tio n b y ty p e II restrictio n enzym es.
F u rth erm o re, if the enzym e
m eth y lates in trans, tim ing of expression of orfl and subsequent m ethylation
of C ollb w o u ld b e an im p o rtan t factor to consider as no cross-protection is
conferred on R751 d u rin g co-transfer of the two plasm ids (see C hapter Three).
F u rth er analyses of orfl are required before its role in the avoidance of type II
restrictio n en zy m es by Collb can be ruled out.
E xperim ents that m ig h t be
in stru ctiv e w o u ld involve cloning orfl into a vector w here it can be expressed
co n stitu tiv ely a n d exam ining the ability of the resulting construct to rescue
eith er tran sferrin g R751 or a restriction sensitive strain of phage X from the in
v iv o effects of ty p e II restriction enzym es. Such a construct could also be used
to determ in e if o r f l has a role in protecting Collb A rdA ' from type I restriction
enzym es.
D esign of an e x p erim en t to reveal details ab o u t an anti-restrictio n
m echanism th at is believed to be czs-acting is difficult. F urther com plications
are th a t such a m echanism appears to only be active d u rin g the process of
conjugation, as sh o w n by the inability of Collb to evade type II restriction
d u r in g th e p ro c e ss of tra n sfo rm a tio n (Read et a l ., 1992).
One line of
in v e s tig a tio n c o u ld in v o lv e cloning restrictio n frag m e n ts of C ollb an d
e x am in in g th em for th eir ability to confer protection against the effects of
E c o R l u p o n the resu ltin g construct.
The vector chosen w ould require EcoRI
cleavage sites a n d the Collb oriT locus. Such an analysis could only be utilised
if after its m obilisation by the Collb nic m utant (p N A ll) the vector is sensitive
111
Fig. 8.1. Genetic organisation of In cll plasm id Collb.
The genetic m ap w as deduced from the com plete n u c le o tid e sequence of the
p lasm id , w h ich w as recently m ade available (Sam pei a n d M izobuchi; EMBL:
AB021078). The genom e is represented by the lines m ark e d in kb coordinates.
A ll o p e n re a d in g fram es (or/s) id e n tifie d are sh o w n as rectan g les.
The
tra n s c rip tio n a l d irec tio n s of each o r / is indicated b y an arro w an d th o se
ru n n in g from left to rig h t are below the line and those from rig h t to left are
above the line. The or/s that are p a rt of the T ral region of the plasm id are S B
rectangles, w ith the exception of the shufflon, rci locus a n d E D T A -resistant
n u c le a s e n u c .
The or/s th at form th e Tra2 region of th e p la sm id are I
1
rectangles, w ith the exception of s o g and eex. The T ra l an d Tra2 regions are
indicated on the m ap, broken lines h ig h lig h t or/s that encode pili; these are the
flexible p ilu s in T ral an d the rigid p ilu s in Tra2. Loci w ith defined functions
are indicated by I H rectangles.
The or/s com prising the leading region of the
plasm id , som e of w hich w ere identified d u rin g this w ork, are indicated by C53
rectangles. P u tative or/s w ith no defin ed function are unlabelled. Locations of
o r i T and o r i V
are in d ic ate d .
T he lo catio n s of p o te n tia l sin g le -s tra n d e d
p ro m o ters {s s il , ssi2 and ssi 3 ) identified d u rin g this w ork are also show n
Fig. 8.1
0 kb I________ I
10 kb
▼
L—I II ..
■ *-
I□ □
- >
>
—
^
->
cib
repZ
ibfA ibfC
imm
<-
x6 repeat
resolvase
20 kb
10 kb
□>
iz z o
resA
parA parB
; impB
ssi3
30 kb
20 kb
K3KSSS3S3 ESSSHES
>
>
CS KS CSS CSSSS
— >
ssb
ssil
ssi2
oriT
T
30 kb
w w v
or/6
w \\V \
ES
SSH
orf 5
ardA
orf4 orf3
psiB psiA
trbB
trbC
e s s
>
orfl
orf2
trbA
1 40 kb
■
->
n ikA
x3 repeat
~
40 kb
r
50 kb
pnd
nikB
exc
I eex I r r
traY_______ traX
traW
traV
traU
traT
traR
i==1RI Pi=n
I 60 kb
50 kb
Tra2
sogS
traQ traP
1^-1 < —
traO
II < ■■
traN
—... <
traM trau± :
- 1< —— i
3 S08 l
nuc traK tral
1
70 kb
60 kb
tral traH
traG
traF
traE
rri
cVniffinr. ____21
rilU vilT
80 kb
70 kb
Tral
pilS
vilR
ilO
yiip
_______ I________I________I_______ I_______ !_______ 1 90 kb
80 kb
traC
90 kb
(ifi
traB
traA
93.399 kb
to the effects of EcoRI in the recipient. M obilisation of constructs that carry a
p a rticu la r fragm ent of Collb m ight be instructive in determ ining if a particular
gene or locus of th e plasm id can be im plicated in the anti-type II restriction
e v asio n m ech an ism .
H ow ever, the possibility th at m ore than one locus is
in v o lv ed m ay com plicate such an investigation further.
Finally, it is possible that Collb avoids the effects of type II restriction by
its m o d e of e n try du rin g conjugation. It is generally assum ed that restriction
enzym es are lo cated w ithin the cytoplasm of their host cell. This assum ption
arises from early attem pts to isolate new R-M systems, w here host cell extract is
able to frag m ent D N A (Wilson and M urray, 1991).
The fin d in g th at restriction-m odification system s can be isolated from
bacteria fo u n d in every ecological niche suggests that the random dispersal of
all restrictio n enzym es throughout the cell is a too sim plistic view to ap p ly to
every k n o w n system w ithout further investigation. It m ight be possible th at
certain restriction enzym es are com partm entalised w ithin the cell, rather th an
ev e n ly d is trib u te d th ro u g h o u t.
K ohring and M ayer (1987) sh o w ed by
im m u n o -lo calisation that betw een 70-90% of total EcoRI restriction enzym e is
found in the cell envelope of E. coli, w hilst 60-70% of the m ethyltransferase is
p resen t w ith in th e cytoplasm . Such results are in agreem ent w ith the 'cellular
d e fe n ce ' h y p o th e s is described in C h ap ter One, section 1.5.6, w h e re the
m eth y lase p ro tec ts the cells ow n DN A from d estruction and the restriction
enzym e p a rt cleaves any foreign DNA entering the cell.
If certain restrictio n enzym es are com partm entalised w ithin the cell,
p articu larly in the periplasm ic space, then such findings by Kohring and M ayer
(1987) could ex p lain w hy som e cloned R-M genes in E. coli are viable in the
r+m~ configuration. Furtherm ore, it m ay be possible that Collb itself avoids the
effects of EcoRI restriction d uring conjugation by determ ining a DNA tran sp o rt
sy stem th at e n su res transferring DNA does not come into contact w ith the
EcoRI-rich p eriplasm ic space. First, this could be the outcom e of the plasm id
m atin g -p air form ation system , w hich ensures direct entry of transferring DN A
112
into the cytoplasm of the recipient. Bacteriophage X is sensitive to restriction
by EcoRI. D u rin g the initial stages of infection by the phage, the genom e is
injected as d u p lex DNA into the periplasm ic space before it traverses the inner
m em b ran e b y a passive sugar u p tak e m echanism (D iirrenberger et a l ., 1991).
P resum ably d u rin g transfer of R751, the plasm id enters the periplasm ic space.
A ccording to the m odel proposed by D iirrenberger et al. (1991) described
in C h a p te r O ne, section 1.3.1, p lasm id DNA transferring by the process of
e n tero b acterial conjugation enters the periplasm of the recipient cell before
trav ersin g the in n er m em brane by a sim ilar m echanism to th at of p h ag e X.
H o w ev er u n lik e X, plasm id DNA at this stage is still in single-stranded form .
R estriction en zy m es are tho u g h t to cleave single-stranded DN A only w h e n
canonical d u p le x stru ctu res are form ed (Nishigaki et al., 1985; C hapter O ne,
section 1.5.4).
P erh ap s du rin g C ollb-m ediated conjugation conversion of the
p la sm id into d u p le x DN A is delay ed until entry to the cytoplasm of the
recipient. In contrast, perhaps com plem entary strand synthesis of R751 occurs
concurrently d u rin g transfer w ithin the periplasm ic space, m aking the plasm id
susceptible to cleavage. Such hypotheses are difficult to test.
If synthesis of the
second stran d is delayed until entry to the cytoplasm , this m ight explain w h y
the plasm id carries a psiB gene. Single-stranded DNA entering the cytoplasm
w ill induce the SOS response (Jones et al., 1992). R751 does not carry a sim ilar
psiB gene and it has yet to be tested if transfer of the plasm id induces the SOS
response.
If the findings by Kohring and M ayer (1987) are correct and Collb does in
fact inject its D N A d irectly in to the cytoplasm of the recipient, th e n
m o b ilisatio n of any restrictio n sensitive vector by the Collb n ic m u ta n t
(p N A ll) sh o uld avoid the effects of EcoRI restriction in the recipient. D uring
w o rk described in this thesis (Chapter Four), p N A ll w as often used to m obilise
the cloned C ollb o riT plasm id (pNA2). M obilised pN A 2 w as not sensitive to
the effects of EcoRI restriction d u rin g its transfer (data not shown). H ow ever,
w h eth er this finding is due to protection by the Collb transport system or to the
113
relative in sensitivity of pN A 2 to EcoRI through carriage of only one cleavage
site is n o t kn o w n .
These experim ents need to be repeated using a sim ilar
v ecto r c a rry in g e n o u g h EcoRI cleavage sites to m ake it a suitable assay of
restriction. U nfortunately, tim e w as not available during this work to p u rsu e
th is in v estig atio n further.
The 'su b strate saturation7 hypothesis as a m eans of explaining how Collb
A rd A ' av o ids th e effect of type I restriction enzym es can be ruled out by data
p re se n te d in th is thesis (C hapter Three).
The substrate saturation scenario
relies o n a m p lifie d transfer of C o llb d r d from the d o n o r to the restricting
recipient. H o w ev er, C oW odrd A rdA ' plasm id is still able to alleviate the effects
of type I en zym es w hen already established in the restricting recipient (Fig. 3.6
B).
O ne h y p o th e sis that has yet to be ruled out is th at either transfer of
C ollbdrd A rdA ' or presence of the plasm id in the restricting recipient induces a
change in cell physiology, w hich in tu rn leads to a breakdow n of restriction.
In te re stin g ly as early as 1965, G lover and C oulson described experim ents
involving the b reak d o w n of type I restriction due to changes in cell physiology.
Such e x p erim en ts involved the conjugative transfer of the EcoKI R-M genes
from an E. coli K-12 H fr donor to an E. coli B F recipient.
The restrictio n
p h e n o ty p e is d e la y e d in the re c ip ie n t for 15 g e n eratio n s w h ilst th e
m o d ificatio n p h e n o ty p e is observed im m ediately (Prakash-C heng and Ryu,
1993). This delay ed expression of restriction is due to the activity of ClpX and
C lp P , w h ich m ak e u p the ClpXP protease of E. coli.
ClpXP m o d u la tes
restrictio n activity by operating post-transcriptionally d u rin g assem bly of the
EcoKI com plex (see C hapter One, section 1.5.3). ClpX and ClpP form p art of the
E. coli h eat shock response that is associated w ith changes in cell physiology.
It m ay be possible th at either conjugative transfer of Collb A rd A ' (Fig.
3.4) or just the presence of the plasm id in E. coli (Fig. 3.6 B) is able to stim ulate
e ith er ClpXP or an o th er protease, w hich in tu rn m odulates type I enzym e
restriction activity. In contrast, Collb m ay encode its ow n protease, although
114
e x am in atio n of the com plete nucleo tid e sequence of the plasm id, w hich is
cu rren tly available (AB021078), identified no ORFs that have potential protease
activity. H ow ever, it should be noted that several of the ORFs identified are
still w ith o u t any predicted function (Fig. 8.1).
U n fo rtu n ately , the hypothesis th at Collb stim ulates activity of ClpXP
w as n o t tested d u rin g this work. It is predicted that if Collb stim ulates ClpXP
activity, w h ich in tu rn m odulates restriction by EcoKI, transfer of the plasm id
to c lp X and c lp P m u tan t strains of E. coli K-12 sho u ld resu lt in a significant
red u c tio n in th e plasm ids transm ission, com pared to that show n in Fig. 3.2 B.
Such a h y p o th esis should be easily tested by obtaining the appropriate strains
described.
Finally, it rem ains possible that Collb A rdA ' encodes in addition to a rd A
a n o th er anti-restriction gene(s) active against type I enzym es and is expressed
co nstitutively.
Recent findings by Rastorguev et al. (1998) show ed th at In cll
p lasm id R64 carries a gene that encodes a m oderate anti-restriction phenotype
a ctiv e sp ecifically ag ain st type I enzym es.
The gene identified is n o t
h o m o lo g o u s to a r d A , although the protein does share a sim ilar nine am ino
acid m otif com m on to A rdA and other anti-restriction proteins (see C h ap ter
O n e, sectio n 1.7).
The R64 gene is located ad jacen t to the p la sm id s
stre p to m y c in a n d tetracycline resistance genes, d o w n stre am from o r iV .
C om p ariso n of the nucleotide sequence of the gene w ith those present in the
datab ases revealed only one hom ologue, that of the arsR gene of IncFI plasm id
R773.
ArsR is a rep resso r of the arsenical resistance operon arsR D A B C .
H o w ev er, R64 carries no such operon as show n by the sensitivity of cells
carry in g the plasm id to treatm ent w ith arsenical chem icals (Rastorguev et al.,
1998). A nalysis of the com plete nucleotide sequence of Collb revealed th at the
p lasm id does n o t carry a sim ilar gene.
The arsR gene of R64 was identified by cloning fragm ents of the plasm id
and exam ining the resulting recom binants for their ability to confer protection
on restriction sensitive phage X. It w ould be of interest to this work to apply a
115
sim ilar strateg y to Collb, w ith the aim of identifying a region of the plasm id
th a t is responsible for constitutive alleviation of restriction by type I enzym es.
Zygotic ind u ctio n of Collb leading region genes, psiB and ssb, has been
d e m o n s tra te d (Jones et al., 1992; C hapter One, section 1.6.4). Only recently,
evidence h as b een obtained to show that transcription of a rd A is enhanced in
th e recipient cell d u rin g the process of conjugation. The technique used was a
com petitive RT-PCR assay, which is able to quantify mRNA transcript levels of
a p a rticu la r gene. A full description of the details relating to this technique is
a v a ila b le in A lth o rp e et al. (1999).
D uring conjugation, a r d A
mRNA
tran scrip ts w e re m easured and com pared to those from vegetatively grow ing
cells. T ran script levels of a rd A increased in a short pulse during conjugation,
w h ich b eg an a t ab o u t five-six m inutes. Transcript levels later dim inished as
tra n sc rip tio n is tu rn e d d ow n an d then existing tran scrip ts w ere d eg rad ed .
C om parisons of these results w ith the tim e of entry of ColTbdrd to the recipient
cell, nine m inutes, suggest that transcription of a rd A begins before com pletion
of the first ro u n d of plasm id transfer (Althorpe et al., 1999).
The b u rs t of a r d A tran scrip tio n during conjugation in com parison to
th at detected in vegetatively grow ing cells suggests that like psiB and ssb , a rd A
is also subject to zygotic induction.
This view is further supported b y data
p resen ted in this thesis (C hapter Three and Chapter Five), w hich has also been
p u b lish ed in conjunction w ith the transcriptional analysis of the ardA gene in
A lth o rp e et al. (1999). In experim ents involving the use of the R751 restriction
assay, A rd A -m ediated restriction alleviation was observed to be optim al w hen
enco d ed by a transferring Collbdrd plasm id rather than an equivalent plasm id
resid en t in the restricting recipient (Fig. 3.5; Fig. 3.6 C). Such results im ply that
expression of a rd A is activated d uring conjugation.
T ran scrip tio n al activation of a rd A in the recipient w as indicated by the
stro n g p ro tectio n conferred by a co-transferring C o lJ b d rd plasm id (Fig. 3.5 A)
b u t lack of even basal protection by the C oU bdrd nic m utant (Chapter Four and
C h ap ter Five, Fig. 5.3 A) im m obilised in the donor.
116
Thus, it is inferred that
n e ith e r a r d A m R N A or A rdA p ro te in are tra n sp o rte d from the d o n o r to
recipient cells. R751 is protected to an interm ediate extent by a co-transferring
C o l l b d r d A rd A m u tan t (Fig. 3.4 A ), b u t this effect is attributed to the a r d A -
in d ep e n d en t restriction-avoidance response described already in this chapter.
Some in terestin g observations about the tim ing of expression of a r d A
can be m ad e from the studies co nducted on a r d A
tra n sc rip tio n d u rin g
co n ju g atio n as m easu red by the com petitive RT-PCR assay (A lthorpe et al.,
1999).
T ran sc rip tio n of a r d A , in the recipient, extends over 10 m inutes or
m ore in the cell population. Transfer of Collb from the donor to the recipient
is n o t sy n ch ro n ised and transcription in a single pair of conjugating cells is
likely to be less th a n 10 m inutes. From m easuring and analysing the tim e of
en try of the p lasm id , the onset of a rd A transcription can be estim ated. The rate
of D N A tra n s fe r in H fr m atings is estim ated to be 45-kb m in '1 at 37°C
(B achm ann et al., 1976). A ssum ing transfer of Collb occurs at the sam e rate,
tra n sfe r of th e 100-kb plasm id (pLG221) should be com pleted w ith in 2.5
m inutes. C om pletion of the first round of transfer in a bacterial population is
m ark ed by a su rg e of transconjugant production.
su rg e occurs after nine m inutes.
In the case of Collb, this
The level of a r d A tran scrip ts increase in
abundance after five-six m inutes, w hich suggests that transcription of this gene
is initiated w ith in a m inute of entry of the plasm id. Such tim ing indicates that
tran scrip tio n occurs shortly after entry of the leading region to the recipient
cell.
One in trig u in g question is w h at is the regulatory m echanism em ployed
by Collb to allow enhanced expression of leading region genes, psiB , ssb and
a rd A , in a transient b u rst shortly after conjugative transfer of the plasm id. It is
kno w n that plasm id D N A is transferred to the recipient cell in single-stranded
form , yet, it seem s likely from the observations m ade above that these genes
are expressed before transfer of the plasm id has finished. By sequencing the
lead in g region of C ollb, the aim of C hapter Seven w as to use such data not
117
only to m ap genetic loci, b u t to look for regulatory sequences that m ight give
an in d icatio n of the m echanism governing leading region gene expression.
For all p lasm id s exam ined, a rd A and p siB -ssb genes are orientated in
th e ir le a d in g reg io n s such th a t the DNA stra n d th a t is th o u g h t to be
tra n sfe rre d to the recipient cell d u rin g conjugation also corresponds to the
te m p la te s tr a n d for tran scrip tio n of these genes (Fig. 7.5).
A nu m b er of
p u ta tiv e o rfs w ere identified from the sequence data generated, the predicted
functions of w h ic h are described in C hapter Seven, section 7.2.3. Interestingly,
all the o rfs id en tifie d w ere orientated in the sam e transcriptional orientation
as a rd A , psiB a n d ssb (Fig. 7.5).
P e rh a p s th e m ost interesting finding w as th e identification of three
rep e at seq u en ces of ~328-bp in length, which w ere nam ed s s i l , ssi2 and ssi3 .
The repeats sh are betw een 80-85% sequence identity w ith each other over their
en tire length.
R em arkably, each of these repeats aligns w ith only one other
sequence in th e databases, a sim ilar sequence found w ithin the leading region
of plasm id F, originally called ssiD , now renam ed F rpo (Fig. 7.4).
The F locus w as originally isolated by N om ura et al. (1991) and show n to
be a sin g le -stra n d e d initiation sequence capable of su p p o rtin g synthesis of
p rim ers for D N A replication, hence the nam e s s iD . Later w ork carried out by
M asai and A rai (1997) show ed th at the ssiD locus has additional pro p erties
w h ich allow it to function as a novel type of prom oter active only in single­
stra n d e d form .
C onsequently, the locus was renam ed F rpo.
The elaborate
stem -loop s tru c tu re p ro p o se d by M asai and A rai (1997) extends over -300
n u cleo tid es in the single strand and includes a -35 and -10 sequence and a
tran scrip tio n start site (Fig. 8.3). M asai and Arai (1997) found that Frpo is only
active as a p ro m o te r in single-stranded DNA.
H ow ever, dsD N A can be
activated for tran scrip tio n from such prom oters by denaturation. The Collb ssi
sequences h a v e p red icted secondary structure sim ilar to that of F rpo (Bates et
al., 1999; Fig. 8.2). The putative -10 regions of the Collb ssi sequences contain
n u m e ro u s m is-m atch es, w hich m ay aid p ro m o ter function by facilitating
118
Fig. 8.2. Com parison of the proposed secondary structure for Fr p o w ith the
sequences of the Collb ssi sites.
Figure is tak en from Bates et al. (1999). The F rpo stru c tu re is from M asai an d
A rai (1997) w ith the exception th a t o p posing G and T residues are paired. The
a rro w in d icates leftw ard extension from the 5' end of the RNA.
th e rm o d y n a m ic a lly fav o u red v a ria n t of th e sequence,
F rpo* is a
s s i stru c tu re s w e re
calculated u sin g the m fo ld 3.0 RN A folding p ro g ram (M athew s et a l ., 1999),
which
was
obtained
via
(h ttp ://w w w .ib c .w u s tl.e d u /z u k e r /).
the
World
Wide
Web
U p p e r case letters indicate n u cleo tid es
th a t conform w ith the consensus sequences of the -35 an d -10 reg io n s (5’TTGACA-3' and 5-TATAAT-3'). Figure w as draw n by B. M. W ilkins.
Fig. 8.2.
F
rpo
+
-1 0
^
-3 5
____
i
c a a
5 ' - c c g
3 7 - g g c
. . .
.
g g g g c
t c
a
c c c c g
t
t
a c
T
t c
g a a a
g c c a c g g c c g
T g c g g tg t t g g c
T
a g a g
a
e g
t
.
c
g t c c
g c
g
g
t
CA G g
g c
g g g g
g a c
a a
c c c c
t t
T
a c
a a c
a a
e g e a t t t t t g e e
g tg t
t a c
a
3
a a a a a e g g
g
%
a g
t
c
t
t
g
t
e
g c g t fc
F x p o *
4
5
-1 0
c a a
' - c c g
3 ' - g g c
. . .
-3 5
t
g a a a
a c
g c c a c g g c c g
e g
t
c
g t c c
g g g g
T g c g g tg t t g g c
T
g c
g
CA G g
c c c c
c g t g g c g tt t tg
a a
g o
.
a g a g
a
g
.
sFa.
. t c
g g g g c a
c c c c g T
t
t c
t
T
.
g c a
a
c c g c a a a a c
g c
t t t t t g c c t a
t
a a a a a c g g g t
^
ctt:
s s il
-1 0
a c
g
5 7 - e g
g g g g
3 ' - g c
c c c c
-3 5
. . . g c tc
a
g g g
a c c a c g tc e g
c a g ttg tc c g g g g g
a c
t g
t g g t g t a g
a
tA T g T g c
g c
g
a a a
. a
c a g
g tc a g C A G g T c c c c
t
c
t
c
g tc
g
t
a
c
t a
e g e a a a a
g
t t t t t g
a
e g
g t g t t t t
g
a a a a a c
g
g c
g
c
c
t
g
ss±2
-1 0
a t
g tc c
-3 5
c
a
5 ' - t c c g
g g g g c
g t
a c c a c g t c
g g g
e g
c a g e
3 '- a g g c
c c c c g
cA
a c c t
t g g t g t a g
g c
T
g
g tc g
a a a
t
g tc c g g g g g
e g
g a
e g e a a a a t tt tt
C A G g T cccc
t
fct
g c
g t g tt tt a a a a a
STfca g
c
t
g g
g c c g
t
e g g t
t
t
a t
a
t a t
ssi3
-1 0
a t
5 ' - e g
3 ' - g c
. . c
g g g g g c
c c c c c g
t
c g t
g cA
t c t
T
-3 5
t
a c c
tg g
.
g
c c t c
g g a g
g
a
e g
g c
g
g g a
g
c a
g t
a a g
g
a
t
c tg tc c g g g g
e g g
e g e a a a a t tt tt
gA C A G gT ccc g e e
g t g tt tt a a a a a
a
a
g
g
t
c
t
V <?
t
a
t
t
g g
g c c g
e g g t
t
t
a c
Fig. 8.3. Schematic diagram depicting the proposed secondary structure o f the
Frpo locus.
The figure is b a sed on the p ro p o sed stru ctu re form ed in single-stranded D N A
at the F rpo locus of plasm id F (M asai an d Arai, 1997). The stru ctu re acts as a
novel type of p ro m o te r capable of directing tran scrip tio n by RNA p olym erase
from ssD N A tem plates. Sites of in terest include the -35, -10 and tran scrip tio n
sta rt site. The stem loop stru c tu re cannot form in dsD N A as it w o u ld be an
im p erfect d u p lex .
The loops, d u e to m ispairing are seen to be esential for
function. Figure is derived from th at in M asai and A rai (1997) an d w as d ra w n
by Chris Cane.
Fig. 8.3.
CO
m eltin g of the d uplex structure and form ation of the open complex necessary
for tran scrip tio n (Bates et al., 1999).
Im p o rta n tly , F rpo and the Collb ssi sequences are orientated in their
resp ectiv e lea d in g regions such th at the prom oter structure will form in the
D N A stra n d th a t is tran sferred to the recipient.
This feature leads to the
ap p ea lin g m o d el th at enhanced expression of leading region genes is due to
activity of Frpo-like sequences in directing transcription of the tran sferrin g
plasm id stran d .
The m odel described shows a strategy for supplying proteins early in the
recipient before the second strand of the plasm id is generated. Early expression
allow s A rd A anti-restriction protein to accum ulate in the new ly infected cell
before the D N A stra n d is converted to duplex DNA, the substrate of ty p e I
re stric tio n en zy m es. The m odel allow s for rapid expression of PsiB as a
fu n ctio n th a t p re v e n ts induction of the bacterial SOS response follow ing
tran sfer of p la sm id D N A in single-stranded form.
Furtherm ore, the m odel
allow s for elev ated levels of SSB protein, which m ay prevent drainage of the
cellular c o u n te rp a rt, an essential com ponent of the chrom osom e replication
ap p aratu s.
In a d d itio n , SSB has been show n to stim ulate transcription from
Vrpo, p resu m ab ly by facilitating binding of RNA polym erase through protein-
p ro tein in teractions on tem plate DNA (Masai and Arai, 1997). It is envisaged
th a t th ese p ro m o te rs are silenced upon synthesis of the co m p lem en tary
p lasm id stra n d in the recipient, w hich w ould explain how leading region
genes are expressed in a transient burst.
D esign of an experim ent to test if the Collb ssi sequences are able to act as
sin g le-stran d ed p ro m o ters is possible. A Collb plasm id carrying a prom oterless la c Z o p ero n fusion w ithin the ssb gene has already been created in this
lab o rato ry (Jones et al., 1992). The plasm id w ould provide a useful source of a
D N A fragm ent carrying the ssbv.lacZ fusion and the upstream ssi3 sequence for
cloning into a single-stranded vector based on M13. Confirm ation that ssi3 acts
as a p ro m o ter w o u ld be achieved if elevated levels of p-galactosidase activity
119
w ere detected in cells carrying the single-stranded DN A construct. As a useful
control, a sim ilar vector carrying the Collb fragm ent inserted in the opposite
o rie n ta tio n
s h o u ld
re su lt in n o e le v ated levels of p - g a l a c t o s i d a s e .
A ltern a tiv e ly , the Q fragm ent described in C hapter Four, could be cloned
u p stre am of a r d A in a construct carrying only the leading region (see Fig. 7.5).
It is p re d ic te d th a t if zygotic in d u ctio n of a rd A is governed by ssi3 found
u p stre am of the gene, then the presence of D will d isru p t transcription and
p re v e n t e n h a n c e d expression of a r d A .
C onsequently, m obilisation of the
construct w o u ld resu lt in no A rdA -m ediated alleviation of type I restriction in
th e recipient cell. H ow ever, this experim ent does n o t confirm that ssi3 is the
p ro m o te r.
In c o n c lu sio n , d e sp ite c o m p licatio n s e n c o u n te re d , a n u m b e r of
h y p o th eses for the C ollb anti-type I and anti-type II restriction m echanism s
h av e been tested and rejected by this work. U nfortunately, it w as beyond the
scope of th is thesis to d eterm ine the m olecular basis of these two plasm id
evasion processes, although a n u m b er of new hypotheses have been generated
w h ich are described in this chapter. In addition, data in this thesis w ere not
o n ly u sefu l in p ro v id in g su p p o rtin g evidence th a t expression of a r d A is
enhanced by m atin g (A lthorpe et al., 1999) but has played a m ajor role in the
g en eratio n of a m o d el th at explains how leading region genes m ig h t be
zygotically in d u ced in E. coli du rin g conjugation (Bates et al., 1999). If the Collb
s s i regions are confirm ed as being prom oters active in single-stranded DNA
form , then it w o u ld be interesting to see if they are also active in strains other
th an E. coli.
120
Appendix I
Determination of the RKI and Rri phenotypes of E. coli strains using X vir
coli
X vir
pfu ml"1
e.o.p
X vir .0
5.0 x 108
1.0
II
1.7 xlO 6
0.003
ft
1.2 x 108
0.24
II
5.0 x 107
0.10
II
3.5 x 108
0.70
GI65N(pNA12)
II
8.0 x 107
GI65N(pNA6)
II
5.3 x 108
0.16
1.06
GI65(pLG290)
II
4.9 x 108
0.98
GI65N
GI65N(NTP14)
X vir. K
E .
host
NM816N
GI65N
GI65N(pLG221)
GI65N(pLG292)
GI65N(pNAll)
GI65N(pNA16)
1.0 xlO 12
1.0
if
1.0 xl O9
0.001
II
2.1 x 1012
2.1
ll
1.0 xl O9
0.001
GI65N(pNA17)
100 jliI of E. coli cells (107 m l'1) were mixed with 3 ml of SNA and overlayed onto a
BLA plate. 10 pi of each diluted bacteriophage suspension was spotted onto the
surface of the plate and allowed to adsorb. The plates were then incubated
overnight at 37°C. The number of plaques formed were examined and the plaque
forming units (pfu) per ml and efficiency of plating (e.o.p) were calculated. An
e.o.p value of 1.0 is equivalent to 100% plating efficiency. X vir is a virulent strain of
X, where X vir. 0 carries no methylation, X vir .K carries EcoKl methylation.
Literature Cited
A c h t m a n , M ., M o r e lli, G ., a n d S c h w u c h o w , S. (1 9 7 8 a ) C e ll-c e ll in t e r a c tio n s in
c o n ju g a tin g Escherichia coli: role o f F p ili a n d fate o f m a tin g a g g r e g a te s. / Bacteriol 135:
1 0 5 3 -1 0 6 1 .
A c h tm a n , M ., S c h w u c h o w , S., H e lm u t h , R ., M o r e lli, G ., a n d M a n n in g , P. A . (1 9 7 8 b )
C e ll-c e ll in te r a c tio n s in c o n ju g a tin g E scherichia coli: C o n - m u ta n ts a n d s ta b liz a tio n o f
m a tin g a g g re g a tes. M ol Gen Genet 164: 171-183.
A l f o l d i , L., Ja cob , F., a n d W o llm a n , E. L. (1957) Z y g o s e le ta le d a n s les c r o ise m e n ts en tre
s o u c h e s c o lic in o g e n e s e t n o n c o lic o g e n e s. A cad Sci 244: 2974-2976.
A lth o r p e , N . J., C h ille y , P. M ., T h o m a s , A . T ., B ram m ar, W . J., a n d W ilk in s , B. M .
(1 9 9 9 ) T ra n sie n t tr a n sc r ip tio n a l a c tiv a tio n o f th e I n c ll p la s m id a n ti-r e str ic tio n g e n e
(ardA ) an d SO S in h ib itio n g e n e (psiB) e a r ly in c o n ju g a tin g r e c ip ie n t b acteria. M ol M icrobiol
31: 133-142.
A lts c h u l, S. F., G is h , W ., M ille r , W ., M y e r s, E. W ., a n d L ip m a n , D . J. (1990) B a sic lo ca l
a lig n m e n t sea r ch to o l. J M ol Biol 215: 403-410.
A m a b ile -C u e v a s , C. F., a n d C h icu rel, M . E. (1992) B acterial p la s m id s a n d g e n e flu x . Cell
70: 189-199.
A n th o n y , K . G ., S h e r b u r n e , C., S h e r b u r n e , R ., a n d F rost, L. S. (1994) T he r o le o f th e
p ilu s in r e c ip ie n t c e ll r e c o g n itio n d u r in g b a c te r ia l c o n ju g a tio n m e d ia te d b y F -lik e
p la s m id s . M o l M icrobiol 13: 939-953.
A r b e r, W ., a n d D u s s o ix , D . (1962) H o s t sp e c ific ity o f D N A p r o d u c e d b y Escherichia coli
I. H o s t c o n tr o lle d m o d ific a tio n o f b a c te r io p h a g e X. J M ol Biol 5: 18-36.
B a c k m a n n , B. J. (1972) P e d ig r e e s o f s o m e m u ta n t strain s o f Escherichia coli K-12. Bacteriol
R e v 36: 5 2 5 -5 5 7 .
B a c k m a n n , B. J., L o w , K . B ., a n d T a y lo r , A . L. (1976) R e c a lib r a te d lin k a g e m a p o f
Escherichia coli K -12. Bacteriol R ev 40: 116-167.
B a g d a s a r ia n , M ., B a ilo n e , M . M ., M a n n in g , P. A ., L u r z, R ., T im m is , K. M ., a n d
D e v o r e t , R . (1986) A n in h ib ito r o f S O S in d u c tio n , s p e c ifie d b y a p la s m id lo c u s in
Escherichia coli. Proc N a tl A ca d Sci U S A 83: 5723-5726.
B a g d a s a r ia n , M ., B a ilo n e , A ., A n g u lo , J. F., S c h o lz , P., B a g d a s a r ia n , M ., a n d D e v o r e t,
R. (1992) P siB , an a n ti-S O S p ro te in , is tr a n sien tly e x p r e s s e d b y th e F se x factor d u r in g
its tr a n sm issio n to a n Escherichia coli K -12 recip ien t. M ol M icrobiol 6: 885-893.
B a ilo n e , A ., B a c k m a n , A ., S o m m e r , S ., C e le r ie r , J., B a g d a sa r ia n , M . M ., B a g d a sa r ia n ,
M ., a n d D e v o r e t, R. (1 9 8 8 ) P siB p o ly p e p t id e p r e v e n ts a c tiv a tio n o f R ecA p r o te in in
Escherichia coli. M ol Gen G enet 214: 389-395.
B a lz e r , D ., P a n s e g r a u , W ., a n d L a n k a , E. (1994) E ssen tia l m o tifs o f rela x a se (T ral) a n d
TraG p r o te in s in v o lv e d in c o n ju g a tiv e transfer o f p la s m id RP4. / Bacteriol 176: 4285-4295.
B a n c ro ft, I., a n d W o lk , C . P. (1989) C h a ra cterisa tio n o f an in se r tio n se q u e n c e (IS892) o f
n o v e l stru ctu re fr o m th e C y a n o b a c te r iu m Anabaena sp. S train M -131. / Bacteriol 171: 59495954.
B a r c u s , V . A ., a n d M u rr a y , N . E. (1 9 9 5 ) B arriers to r e c o m b in a tio n : r e str ic tio n . In
P o p u la tio n G en etics o f Bacteria. B a u m b e rg , S., Y o u n g , J. P. W ., W e llin g to n , E. M . H . a n d
S a u n d e r s, J. R. (e d s). C am b rid ge: C a m b rid g e U n iv e r sity P ress, p p . 31-58.
B a te s , S ., C a s h m o r e , A . M ., a n d W ilk in s , B. M . (1998) In cP p la s m id s are u s u a lly
e f f e c t iv e in m e d ia t in g c o n ju g a tio n o f Escherichia coli a n d S acch arom yces c e r e v is ia e :
I n v o lv e m e n t o f th e T ra2 m a tin g s y s te m . J Bacteriol 180: 6538-6543.
B a te s , S ., R o s c o e , R. R ., A lth o r p e , N . J., B ram m ar, W . J., a n d W ilk in s , B. M . (1 9 9 9 )
E x p r e s s io n o f le a d in g r e g io n g e n e s o n I n c ll p la sm id ColIb-P9: G en etic e v id e n c e for s in g le ­
s tr a n d e d D N A tr a n sc rip tio n . M icrobiology 145: 2655-2662.
B e lo g u r o v , A . A ., D e lv e r , E. P ., a n d R o d z e v ic h , O . V . (1992) In c N p la s m id p K M lO l
a n d I n c ll p la s m id C olIb -P 9 e n c o d e h o m o lo g o u s an tirestriction p r o te in s in th eir le a d in g
r e g io n s . / B acteriol 174: 5079-5085.
B e lo g u r o v , A . A ., D e lv e r , E. P., a n d R o d z e v ic h , O . V . (1993) P la sm id p K M lO l e n c o d e s
t w o n o n - h o m o lo g o u s a n tir e str ic tio n p r o te in s (A rd A a n d A rd B ) w h o s e e x p r e s s io n is
c o n tr o lle d b y h o m o lo g o u s reg u la to ry seq u en ces. / Bacteriol 175: 4843-4850.
B e l o g u r o v , A . A ., a n d D e lv e r , E. P. (1995) A m o tif c o n s e r v e d a m o n g th e ty p e I
r e s t r ic t io n - m o d if ic a t io n e n z y m e s a n d a n tir e str ic tio n p r o te in s: a p o s s ib le b a s is fo r
m e c h a n is m o f a c tio n o f p la s m id -e n c o d e d an tirestriction fu n c tio n s. N ucleic A cid s Res 23:
7 8 5 -7 8 7 .
B ic k le , T. A ., B rack , C ., a n d Y u an , R . (1978) A T P -in d u ce d c o n fo r m a tio n a l c h a n g e s in
th e r e str ic tio n e n d o n u c le a s e fro m Escherichia coli K-12. Proc N atl A cad Sci U S A 75: 3 0 9 9 3103.
B ic k le , T . A ., a n d K r u g e r , D . H . (1993) B io lo g y o f D N A restrictio n . M icrobiol R ev 57:
4 3 4 -4 5 0 .
B i ll i n g t o n , S. J., S in is t a j , M ., C h e e th a m , B. F., A y r e s, A ., M o s e s , E. K ., K a tz , M . E .,
a n d R o o d , J. I. (1 9 9 6 ) I d e n tific a tio n o f a n a tiv e D ichelobacter nodosus p la s m id a n d
im p lic a tio n s for th e e v o lu tio n o f th e vap reg io n . Gene 172: 111-116.
B ir m b io m , H . C ., a n d D o ly , J. (1979) A rap id alkalin e extraction p ro ce d u re for s c r e e n in g
r e c o m b in a n t p la s m id D N A . N u cl A cid s Res 7: 1513-1523.
B is h o f b e r g e r , N ., N g , P. G ., W e b b , T . R ., an d M a tte u c c i, M . D . (1987) C le a v a g e o f
sin g le -s tr a n d e d o lig o n u c le o tid e s b y EcoRI restriction e n d o n u c le a se . N ucl A cids Res 15: 709716.
B la ttn e r , F. R ., P lu n k e t t , G ., B lo c h , C. A ., F ern a, N . T ., B u r la n d , V ., R ile y , M .,
C o lla d o v id e s , J., G la s n e r , J. D ., R o d e , C. K ., M a y h e w , G . F., G reg o r , J., D a v is , N . W .,
K ir k p a tr ic k , H . A ., G o e d e n , M . A ., R o s e , D . J., M a u , B ., a n d S h a o , Y. (1 9 9 7 ) T h e
c o m p le te g e n o m e s e q u e n c e o f Escherichia coli K-12. Science 277: 1453-1470.
B o u ln o is , G . J., a n d W ilk in s , B. M . (1978) A C o ll-s p e c ifie d p r o d u c t, s y n th e s is e d in
n e w l y in fe c te d r e c ip ie n ts , lim its th e a m o u n t o f D N A tra n sferred d u r in g c o n ju g a tio n o f
Escherichia coli K -12. / Bacteriol 133: 1-9.
B o y d , C. A ., A r c h e r , J. A . K ., a n d S h erratt, D . J. (1989) C h a ra c terisa tio n o f th e C o lE l
m o b iliz a tio n r e g io n a n d its p r o te in p ro d u c ts. M ol Gen Genet 217: 488-498.
B r a d le y , D . E. (1980) M o r p h o lo g ic a l a n d s e r o lo g ic a l r e la tio n s h ip s o f c o n ju g a tiv e p ili.
P la s m id 4: 155- 176.
B r a d le y , D . E. (1983) D e r e p r e s s e d p la s m id s o f in c o m p a tib ility g ro u p Ix d e te r m in e t w o
d iffe r e n t m o r p h o lo g ic a l form s o f p ilu s . Plasm id 9: 331-334.
B r a d le y , D . E. (1 9 8 4 ) C h a ra c teristic s a n d fu n c tio n o f th ic k a n d th in c o n ju g a tiv e p ili
d e te r m in e d b y tran sfer d e r e p r e sse d p la s m id o f in c o m p a tib ility g r o u p s l lf I2,1 5/ B, K a n d
Z. / Gen Microbiol 130: 1489-1502.
B u k h a r i, A . I., S h a p ir o , J. A ., a n d A d h y a , S. L. (1977) B a cte ria l p la s m id s . In D N A
insertion elements, and episomes. N e w York: C o ld S prin ger H arb or, p p .621-624.
B u r c k h a r d t, J., W e is e m a n n , J., a n d Y u a n , R . (1981a) C h a r a c te r is a tio n o f th e D N A
m e t h y la s e a c t iv ity o f th e re strictio n e n z y m e fro m Escherichia coli K*. / Biol Chem 256:
4 0 2 4 -4 0 3 2 .
B u r c k h a r d t, J., W e is e m a n n , J., H a m ilt o n , D . L., a n d Y u a n , R. (1 9 8 1 b ) C o m p le x e s
fo r m e d b e t w e e n th e restriction e n d o n u c le a se EcoK an d h e te r o d u p le x D N A . } Mol Biol 153:
4 2 5 -4 4 0 .
C e n s in i, S ., L a n g e , C ., X ia n g , Z., C rab tree, J. E., G h ia ra , P ., B o r o d o v s k y , M ., R a p u o li,
R ., a n d C o v a c c i, A . (1996) Cag, a p a th o g e n ic ity isla n d o f Helicobacter pylori, e n c o d e s ty p e
I -s p e c ific a n d d is e a s e -a s s o c ia t e d v ir u le n c e factors. Proc N atl Acad Sci USA 93: 1464814653.
C h a b b e r t, Y. A ., R o u s s e l, A ., W itc h itz , J. L., S a n -S o n -L e P o r s, M . J., a n d C o u r v a lin , P.
(1 9 7 9 ) R e s t r ic t io n e n d o n u c le a s e g e n e r a te d p a tte r n s o f p la s m id s b e l o n g i n g to
i n c o m p a t ib ilit y g r o u p s I I , C, M a n d N : A p p lic a t io n to p la s m id t a x o n o m y a n d
e p id e m io lo g y . In Plasmids of Medical, Environmental and Commercial importance. T im m is, K.
N ., a n d P iih le r , A . (e d s). N o r th H o lla n d / A m ste r d a m / N e w York: E lsev ier, p p . 183193.
C h a n d r a se g a r a n , S ., a n d S m ith , H . O . (1988) A m in o acid s e q u e n c e h o m o lo g ie s a m o n g
t w e n t y - f iv e re str ic tio n e n d o n u c le a s e s a n d m e th y la se s. In Structure and Expression. From
proteins to ribosomes. Sarm a, R. H ., a n d Sarm a, M . H . (eds). N e w York: A d e n in e p r e ss Inc,
p p . 1 4 9 -1 5 6 .
C h a s e , J. W ., M e r r ill, B. M ., a n d W illia m s , K. R. (1983) F -se x factor e n c o d e s a s in g le str a n d e d D N A b in d in g -p r o te in (SSB) w ith e x te n siv e seq u en ce h o m o lo g y to Escherichia coli
SSB. Proc Natl Acad Sci USA 80: 5480-5484.
C h a t f ie ld , L. K ., O rr, E., B o u ln o is , G . J., a n d W ilk in s , B. M . (1982) D N A p r im a se o f
p la s m id C o llb is in v o lv e d in co n ju g a l D N A sy n th e sis in d o n o r a n d re c ip ie n t b acteria. /
Bacteriol 152: 118 8 -1 1 9 5 .
C h i l l e y , P. M ., a n d W i l k in s , B . M . (1995) D is tr ib u tio n o f th e a rd A
a n tirestrictio n g e n e s o n c o n ju g a tiv e p la sm id s. Microbiology 141: 2157-2164.
fa m ily o f
C l e w e l l, D . B ., F la n n a g a n , S. E., a n d J a w o r sk i, D . D . (1995) U n c o n s tr a in e d b a c te r ia l
p r o m is c u ity - th e T n 926 - T n 1545 fa m ily o f co n ju g a tiv e tr a n sp o s o n s. Trends Microbiol 3:
2 2 9 -2 3 6 .
C o h e n , A ., F is h e r , W . D ., C u r tiss III, R ., a n d A d le r , H . (1 9 6 8 ) D N A is o la te d fr o m
Escherichia coli m in ic e lls m a te d w ith F+ cells. Proc Natl Acad Sci USA 61: 61-68.
C o h e n , S . N ., C h a n g , A . C. Y., a n d H s u , L. (1 9 7 2 ) N o n - c h r o m o s o m a l a n t ib io t ic
r e s is ta n c e in b a cte ria l g e n e tic tr a n sfo r m a tio n o f Escherichia coli R -factor D N A . Proc Natl
Acad Sci USA 69: 2 1 1 0 -2 1 1 4 .
C o u tu r ie r , M ., B e x , F., B e r g q u is t, P. L., a n d M a a s, W . K. (1 9 8 8 ) I d e n tific a tio n a n d
c la s s ific a tio n o f b a cteria l p la sm id s. Microbiol Rev 52: 375-395.
C o w a n , G . M ., G a n n , A . A . F., a n d M u rra y , N . E. (1989) C o n s e r v a tio n o f c o m p le x
D N A r e c o g n itio n d o m a in s b e tw e e n fa m ilies o f restriction e n z y m e s . Cell 56:103-109.
C r a m , D ., R a y , A ., O 'G o r a m , L., a n d S k u rr a y , R. (1984) T ra n scrip tio n a l a n a ly s is o f
le a d in g r e g io n in F p la s m id transfer. Plasmid 11: 221-233.
C u r tis s , R ., C a r o , L. G ., A l li s o n , D . P ., a n d S ta llio n s , D . R. (1969) E arly s ta g e s o f
c o n ju g a tio n in Escherichia coli. J Bacteriol 100: 1091-1104.
D a n i e l , A . S ., F u lle r -P a c e , F. V ., L e g g e , D . M ., an d M u rra y , N . E. (1988) D istr ib u tio n
a n d d iv e r s it y o f hsd g e n e s in Escherichia coli a n d oth er e n te ric b acteria. J Bacteriol 170:
1 7 7 5 -1 7 8 2 .
D a tta , N ., a n d H u g h e s , V . (1983) P la s m id s o f th e sa m e Inc g r o u p s in E n terob acteria
b e fo r e a n d a fter th e m e d ic a l u se o f a n tib io tics. Nature 306: 616-617.
D a v i s , E. J., a n d H e n r y , J. (1982) C o n ju g a l tran sfer r e p lic a tio n o f R 6 M r d ll p la s m id
D N A in th e d o n o r c e lls o f Escherichia coli K -12. Mol Gen Genet 187: 305-309.
D e lv e r , E. P ., K o to v a , V . U ., Z a v ilg e ls k y , G . B ., a n d B e lo g u r o v , A . A . (1991) N u c le o t id e
s e q u e n c e o f th e g e n e (ard) e n c o d in g th e a n tirestrictio n p r o te in o f p la sm id C olIb -P 9. /
Bacteriol 173: 5 8 8 7 -5 8 9 2 .
D i L a u r e n z io , L ., F ro st, L. S., F in la y , B. B., a n d P a ra n ch y ch , W . (1991) C h a ra c terisa tio n
o f th e oriT r e g io n o f th e IncFV p la s m id p E D 208. Mol Microbiol 5: 780-785.
D ix o n , D . A ., a n d K o w a lc z y k o w s k i, S. C. (1993) T h e r e c o m b in a tio n h o ts p o t % is a
r e g u la to r y s e q u e n c e th a t acts b y a tte n u a tin g th e n u c le a se a ctiv ity o f th e E. coli R e cB C D
e n z y m e . Cell 73: 87-96.
D r e is e ik e lm a n n , B. (1994) T ra n slo ca tio n o f D N A across b acterial m em b ran es. Microbiol
Rev 58: 2 9 3 -3 1 6 .
D r y d e n , D . T . F., C o o p e r , L. P ., T h o r p e , P. H ., a n d B y r o n , O . (1997) T h e in vitro
a s s e m b ly o f th e E coK I ty p e I D N A r e s tr ic t io n /m o d ific a tio n e n z y m e a n d its in vivo
im p lic a tio n s . Biochemistry 5: 1065-1076.
D iir r e n b e r g e r , M . B ., V illig e r , W ., a n d B a e c h i, T. (1 9 9 1 ) C o n ju g a tio n a l ju n c tio n s:
m o r p h o lo g y o f s p e c ific c o n ta c ts in c o n ju g a tin g Escherichia coli b acteria. J Struct Biol 107:
1 4 6 -1 5 6 .
D u tr e ix , M ., B a c k m a n , A ., C e le r ie r , J., B a g d a sa ria n , M . M ., S o m m e r , S ., B a ilo n e , A .,
D e v o r e t, R ., a n d B a g d a s a r ia n , M . (1988) Id en tifica tio n o f psiB g e n e s o f p la s m id s F a n d
R 6-5. M o le c u la r b a s is fo r psiB e n h a n c e d ex p r e ssio n in p la s m id R6-5. Nucl Acids Res 16:
1 0 6 6 9 -1 0 6 7 9 .
D y b v i g , K ., a n d Y u , H . (1994) R e g u la tio n o f a restriction a n d m o d ific a tio n s y s te m v ia
D N A in v e r s io n in Mycoplasma pulmonis. Mol Microbiol 12: 547-560.
E n d lic h , B ., a n d L in n , S . (1985a) T h e D N A restriction e n d o n u c le a s e o f Escherichia coli B.
I. S tu d ie s o f th e D N A tr a n slo c a tio n a n d th e A T P ase a c tiv itie s. / Biol Chem 260: 5 7 2 0 5728.
E n d lic h , B ., a n d L in n , S . (1985b) T h e D N A restriction e n d o n u c le a s e o f Escherichia coli B.
II. F u rth er s tu d ie s o f th e stru ctu re o f D N A in term ed ia tes a n d p ro d u cts. / Biol Chem 260:
5 7 2 9 -5 7 3 8 .
F a lk o w , S ., T o m p k in s , L. S., S ilv e r , R. P., G u erry, P., a n d Le B la n c , D . J. (1971) T h e
r e p lic a tio n o f R -factor D N A in Escherichia coli K-12. Ann N Y Acad Sci 182: 153-171.
F a lk o w , S ., H e d g e s , R . W ., G u e rry , R ., a n d D a tta , N . (1974) P o ly n u c le o tid e s e q u e n c e
r e la tio n s h ip s a m o n g p la s m id s o f th e I co m p a tib ility c o m p le x . J Gen Microbiol 85: 65-76.
F in la y , B . B ., a n d P a ra n ch y ch , W . (1986) N u c le o tid e s e q u e n c e o f th e su rfa ce e x c lu s io n
g e n e s traS a n d traT from the IriFJac p la s m id pE D 208. J Bacteriol 166: 713-721.
F in n e g a n , J., a n d S h erratt, D . (1982) P la s m id C o lE l c o n ju g a l m o b ility : T h e n a tu r e o f
bom, a r e g io n re q u ir e d in cis for transfer. Mol Gen Genet 185: 344-351.
F irth , N ., I p p e n - I h le r , K ., a n d S k u r a y , R . A . (1996) S tru ctu r e a n d fu n c tio n o f th e F
fa cto r a n d m e c h a n is m o f co n ju g a tio n . In E sch erich ia c o li and S a lm o n e lla ty p h im u r iu m .
Cellular and Molecular Biology. 2nd e d n . N e id h a r d t, F.C. (e d .-in -c h ie f). W a s h in g to n , DC:
A m e r ic a n S o c ie ty for M icr o b io lo g y P ress, p p . 2377-2401.
F le is c h m a n n , R . D ., A d a m s , M . D ., W h it e , O ., C la y t o n , R . A ., K ir k n e s s , E. F.,
K e r la v a g e , A . R ., B u lt, C. J., T o m b , J-F., D o u g h e r ty , B. A ., M e r r ic k , J. M ., M c K e n n y ,
K ., S u tto n , G ., F itz h u g h , W ., F ie ld s , C ., G o c a y n e , J. O ., S c o tt, J., S h ir le y , R ., L iu , L. I.,
G lo d e k , A ., K e lle y , J. M ., W e id m a n , J. F., P h illip s , C. A ., S p r ig g s , T., H e d b lo m , T .,
C o tt o n , M . D ., U tte r b a c k , T. R ., H a n n a , M . C ., N g u y e n , D . T ., S a n d e k , D . M .,
B r a n d o n , R. C ., F in e , L. D ., F ritc h m a n , J. L., F u h r m a n n , J. L ., G e o g h a g e n , N . S. M .,
G r e h m , C. L., M c D o n a ld , L. A ., S m a ll, K . V ., Fraser, C. M ., S m ith , H . O ., a n d V e n te r ,
J. C. (1995) W h o le -g e n o m e r a n d o m s e q u e n c in g an d a s s e m b ly o f Haemophilus influenzae
R d. Science 269: 496-512.
F r e d e r ic q , P. (1965) G en etic s o f c o lic in o g e n ic factors. Zentbl Bakt Parasit Kde 196: 142151.
F ro st, L. S ., I p p e n - I h le r , K ., a n d S k u rr a y , R. A . (1994) A n a ly s is o f th e s e q u e n c e a n d
g e n e p r o d u c ts o f th e transfer r e g io n o f th e F se x factor. Microbiol Rev 58 :1 6 2 -2 1 0 .
F iir s te , J. P ., P a n s e g r a u , W ., Z i e g e l i n , G ., K r o e g e r , M ., a n d L a n k a , E. ( 1 9 8 9 )
C o n ju g a tiv e tr a n sfe r o f p r o m is c u o u s In cP p la sm id s: in te r a c tio n s o f p la s m id -e n c o d e d
p r o d u c ts w ith th e transfer origin . Proc Natl Acad Sci USA 86: 1771-1775.
F u r u y a , N ., a n d K o m a n o , T. (1991) D e te r m in a tio n o f th e n ic k s ite at oriT o f I n c l l
p la s m id R64: g lo b a l sim ila rity o f oriT str u c tu r es o f I n c ll a n d In cP p la sm id s. / Bacteriol
173: 6 6 1 2 -6 6 1 7 .
F u ru y a , N ., N i s i o k a , T ., a n d K o m a n o , T. (1991) N u c le o tid e se q u e n c e a n d fu n c tio n s o f
th e oriT o p e r o n in I n c ll p la sm id R64. / Bacteriol 173: 2231-2237.
F u r u y a , N ., a n d K o m a n o , T. (1994) S u r fa c e e x c lu s io n g e n e o f I n c ll p la s m id R64:
N u c le o t id e s e q u e n c e an d a n a ly sis o f d e le tio n m u tan ts. Plasmid 32: 80-84.
F u ru y a , N ., a n d K o m a n o , T. (1995) S p e cific b in d in g o f th e N ik A p ro te in to o n e a rm o f
1 7 -b a se-p a ir in v e r te d rep ea t s e q u e n c e s w ith in th e oriT r e g io n o f p la sm id R64. / Bacteriol
177: 4 6 -5 1 .
F u r u y a , N ., a n d K o m a n o , T . (1997) M u ta tio n a l a n a ly s is o f th e R 64 oriT r e g io n :
R e q u ir e m e n t for p r e c ise lo ca tio n o f th e N ik A -b in d in g se q u e n c e . / Bacteriol 179: 7291-7297.
G lo v e r , S. W ., a n d C o ls o n , C. (1965) T h e b r e a k d o w n o f th e re strictio n m e c h a n is m in
z y g o t e s o f Escherichia coli. Genet Res 6: 153-155.
G o lu b , E. I., a n d L o w , B. K. (1985) C o n ju g a tiv e p la sm id s o f e n te ric b acteria fr o m m a n y
d iffe r e n t in c o m p a tib ility g r o u p s h a v e sim ila r g e n e s for s in g le -s tr a n d e d D N A -b in d in g
p r o te in s. J Bacteriol 162: 235-241.
G o lu b , E. I., a n d L o w , B. K. (1 9 8 6 ) D e r e p r e s s io n o f s in g le -s tr a n d e d D N A - b in d in g
p r o te in g e n e s o n p la s m id s d e r e p r e sse d for con ju gation , an d c o m p le m e n ta tio n o f a n E. coli
ssb' m u ta tio n b y th e s e g en es. Mol Gen Genet 204: 410-416.
G o lu b , E. I., B a ilo n e , A ., a n d D e v o r e t, R . (1988) A g e n e e n c o d in g an SO S in h ib ito r is
p r e s e n t in d iffe r e n t co n ju g a tiv e p la s m id s . / Bacteriol 170: 4392-4394.
G o tte s m a n , S. (1996) P ro tea ses a n d th eir ta r g ets in Escherichia coli. Ann Rev Genet 30:
4 6 5 -5 0 6 .
G o tte s m a n , S ., a n d M a u r iz i, M . R. (1992) R e g u la tio n b y p r o te o ly sis: E n e r g y -d e p e n d e n t
p r o te a s e s a n d th eir targets. Microbiol Rev 56: 592-621.
G r e e n e , P. J., G u p ta , M ., B o y e r , H . W ., B r o w n , W . E., a n d R o s e n b e r g , J. M . (1 9 8 1 )
S e q u e n c e a n a ly s is o f th e D N A e n c o d in g th e EcoRI e n d o n u c le a s e m e th y la se . J Biol Chem
2 5 6 : 2 1 4 3 -2 1 5 3 .
G r ib s k o v , M ., D e v e r e u x , J., a n d B u r g e s s , R . R. (1984) T h e c o d o n p r e fe r e n c e p lot:
g r a p h ic a n a ly s is o f p r o te in c o d in g s e q u e n c e s a n d p r e d ic tio n o f g e n e e x p r e ss io n . Nucl
Acids Res 12: 539-5 4 9 .
G u lig , P. A ., C a ld w e ll, A . L., a n d C h io d o , V . A . (1992) Id e n tific a tio n , g e n e tic a n a ly s is
a n d D N A s e q u e n c e o f a 7.8 kb v ir u le n c e r e g io n o f th e Salmonella typhimurium v ir u le n c e
p la s m id . Mol Microbiol 6: 1395-1411.
H a a s e , J., L u r z , R ., G r a h n , A . M ., B a n fo r d , D . H ., a n d L a n k a , E. (1 9 9 5 ) B a c te r ia l
c o n ju g a tio n m e d ia t e d b y p la s m id R P 4 - R SF1010 m o b ilz a tio n , d o n o r s p e c ific p h a g e
p r o p a g a tio n , a n d p ilu s p r o d u c tio n req u ire th e sa m e Tra2 co r e c o m p o n e n ts o f a p r o p o s e d
D N A tr a n sp o rt c o m p le x . / Bacteriol 177: 4779-4791.
H a d i, S. M ., B ic k le , T. A ., an d Y u a n , R . (1975) T he role o f S -a d e n o s y lm e th io n in e in th e
c le a v a g e o f d e o x y r ib o n u c le ic acid b y th e restriction e n d o n u c le a se fro m Escherichia coli K. J
Biol Chem 2 50: 4 1 5 9 -4 1 6 4 .
H a m , L. M ., C ram , D ., a n d S k u rra y , R . (1989) T ran scrip tion al a n a ly sis o f th e F p la s m id
su rfa c e e x c lu s io n region : m a p p in g o f traS, traT a n d traD tran scrip ts. Plasmid 2 1 :1 -8 .
H a m a , C ., T a k iz a w a , T ., M o r iw a k i, H ., U r a s a k i, Y., a n d M iz o b u c h i, K . ( 1 9 9 0 )
O r g a n isa tio n o f th e re p lic a tio n co n tr o l r e g io n o f p la sm id C olIb -P 9. / Bacteriol 172: 19831991.
H a n a h a n , D . (1983) S tu d ie s o f tr a n sfo r m a tio n o f Escherichia coli w ith p la sm id s. / M ol Biol
166: 5 5 7 -5 8 0 .
H a r r in g to n , L. C ., a n d R o g e r s o n , A . C. (1990) T he F p ilu s o f E. coli a p p e a rs to s u p p o r t
sta b le D N A tr a n sfe r in th e a b s e n c e o f w a ll-w a ll con tact b e tw e e n c e lls. / Bacteriol 172:
7 2 6 3 -7 2 6 4 .
H a r ts k e e r l, R . A ., B e r g m a n s , J. E. N ., K a m p , M . C., a n d H o e k s tr a , W . P. M . (1 9 8 3 )
C lo n in g o f a n e x c lu s io n -d e te r m in in g fr a g m e n t o f th e In cl p la s m id , R144. Plasmid 10: 11-
20.
H a r ts k e e r l, R . A ., a n d H o e k str a , W . P. M . (1984) E x clu sio n in I n c ll-ty p e Escherichia coli
c o n ju g a tio n s : th e s ta g e o f c o n ju g a tio n a t w h ic h e x c lu s io n o p e r a te s . A ntonie van
leeuwenhoek, J Microbiol 50: 113-124.
H a r ts k e e r l, R ., T o m m a s s e n , J., a n d H o e k s tr a , W . P. M . (1985a) R e la tio n sh ip b e t w e e n
th e p r o te in s e n c o d e d b y th e e x c lu s io n d e te r m in in g lo cu s o f th e In cl p la sm id R144 a n d th e
c e llu la r lo c a liz a tio n o f th e se p r o te in s in Escherichia coli K -12. Mol Gen Genet 2 0 0 :1 3 8 -1 4 4 .
H a r ts k e e r l, R ., Z u id w e g , E., G e f f e n , M ., a n d H o e k str a , W . P. M . (1985b) T h e I n c ll
p la s m id s R 144, R 64 a n d C o llb b e lo n g to o n e e x c lu s io n g r o u p . / Gen Microbiol 131: 13051311.
H a r ts k e e r l, R . A ., a n d H o e k str a , W . P. M . (1985) E x c lu sio n b y th e In cl p la s m id R 144
d e te r m in e d b y m e a s u r in g D N A tran sfer in Escherichia coli c o n ju g a tio n s. J Gen Microbiol
131: 2 2 6 3 -2 2 6 7 .
H a r ts k e e r l, R ., O v e r d u in , P., H o e k s tr a , W ., a n d T o m m a s s e n , J. (1 9 8 6 ) N u c l e o t id e
se q u e n c e o f th e e x c lu sio n -d e te r m in in g lo c u s o f In cl p la sm id R144. Gene 42 :1 0 7 -1 1 1 .
H a v e k e s , L., T o m m a s s e n , J., H o e k s tr a , W . P. M ., an d L u g te n b e r g , B. (1977) I s o la tio n
a n d ch a ra c ter isa tio n o f Escherichia coli K -12 F" m u tan ts d e fe c tiv e in co n ju g a tio n w ith an Ity p e d o n o r . / Bacteriol 129: 1-8.
H a y e s , W . (1968) T em p er a te b a c te r io p h a g e s a n d ly so g e n y . In The Genetics of Bacteria and
their Viruses: Studies in Basic Genetics and Molecular Biology. (2nd e d ). O xford : B la c k w e ll,
p p . 4 4 7 -4 7 9 .
H e itm a n , J., T r e is m a n , J., D a v is , N . G ., a n d R u s s e l, M . (1 9 8 9 ) C a s s e tte s o f th e f l
in terg en ic reg io n . Nucl Acids Res 17: 4413.
H e n a u t, A ., a n d D a n c h in , A . (1996) A n a ly s is an d p r e d ic tio n s fr o m Escherichia coli
s e q u e n c e s, or E. coli In silico. In E sch erich ia co li and S a lm o n ella ty p h im u r iu m . Cellular and
Molecular Biology. 2nd ed n . N e id h a r d t, F.C . (e d .-in -ch ief). W a s h in g to n , DC: A m e r ic a n
S o c ie ty for M ic r o b io lo g y P ress, p p . 2047-2066
H o r iu c h i, T ., a n d K o m a n o , T . (1998) M u ta tio n a l a n a ly sis o f p la s m id R 64 th in p ilu s
p r e p ilin : th e e n tir e p r e p ilin se q u e n c e is r e q u ired for p r o c e s s in g b y ty p e IV p r e p ilin
p e p tid a s e . J Bacteriol 180: 4613-4620.
H o w la n d , C. J., a n d W ilk in s , B. M . (1988) D irectio n o f c o n ju g a tiv e tran sfer o f I n c ll
p la s m id C olIb -P 9. / Bacteriol 170: 4958-4959.
H o w la n d , C. J, R e e s , E. E. D ., B arth , P. T ., a n d W ilk in s , B. M . (1989) T he ssb g e n e o f
p la s m id C olIb -P 9. J Bacteriol 171: 2466-2473.
H u , P ., E llio tt, J., M c C r e a d y , P ., S k o w r o n s k i, E., G a m e s , J., K o b a y a s h i, A ., B r u b a k e r ,
R . R ., a n d G a rcia , E. (1998) S tru ctu ral o r g a n isa tio n of v ir u le n c e -a s s o c ia te d p la s m id s o f
Yersinia pestis. J Bacteriol 180: 5192-5202.
J o n e s , A . L. (1991) T h e le a d in g r e g io n o f I n c ll p la sm id C olIb -P 9. P h .D . th e sis, U n iv e r s ity
o f L eicester, L eice ster U K .
J o n e s , A . L., B a rth , P. T ., a n d W ilk in s , B. M . (1992) Z y g o tic in d u c tio n o f p la s m id ssb
a n d psiB g e n e s f o llo w in g c o n ju g a tiv e transfer of In c ll p la s m id C olIb -P 9. Mol Microbiol 6:
6 0 5 -6 1 3 .
K e lle h e r , J. E., D a n ie l, A . S ., a n d M u rra y , N . E. (1991) M u ta tio n s th a t co n fe r de novo
a c tiv ity u p o n a m a in te n a n c e m e th y ltra n sfera se . / Mol Biol 221: 431-440.
K o h r in g , G -W ., a n d M a y e r , F. (1987) In situ d istr ib u tio n o f E coR I m e t h y la s e a n d
restrictio n e n d o n u c le a s e in ce lls o f Escherichia coli Bs 5. FEBS Letters 216: 207-210.
K im , S -R ., a n d K o m a n o , T. (1997) T he p la s m id R64 th in p ilu s id e n tifie d as a ty p e IV
p ilu s . J Bacteriol 179: 3594-3603.
K o b a y a s h i, I., N a it o , T ., H a n d a , N ., a n d K u sa n o , K. (1995) S e lfish g e n e s - r e str ic tio n m o d ific a tio n s y s te m s force ce lls to m a in ta in th em . J Cell Biochem S 19A : 110.
K o m a n o , T ., T o y o s h im a , A ., M o r ita , K , a n d N is io k a , T. (1988) C lo n in g a n d n u c le o tid e
se q u e n c e o f th e oriT r e g io n o f th e I n c ll p la s m id R64. / Bacteriol 170: 4385-4387.
K o m a n o , T ., F u n a y a m a , N ., K im , S . R ., a n d N is io k a , T . (1990) T ran sfer r e g io n o f I n c ll
p la s m id R64 a n d r o le o f sh u fflo n in R 64 transfer. J Bacteriol 172: 2230-2235.
K o m a n o , T., K im , S. R., Y o sh id , T ., a n d N is io k a , T. (1994) D N A rea rra n g em en ts o f th e
sh u fflo n d e te r m in e s recip ien t sp e c ific ity in liq u id m a tin g s o f I n c ll p la s m id R64. / Mol Biol
243: 6-9.
K o r o n a , R ., K o r o n a , B ., a n d L e v in , B . R . (1993) S e n s it iv it y o f n a tu r a lly o c c u r r in g
c o lip h a g e s to ty p e I a n d ty p e II r e str ic tio n a n d m o d ific a tio n . J Gen Microbiol 139: 12831290.
K o r o n a , R ., a n d L e v in , B. R. (1993) P h a g e -m e d ia t e d s e le c tio n a n d th e e v o lu tio n a n d
m a in ten a n ce o f r e strictio n -m o d ifica tio n . Evolution 47: 556-575.
K o to v a , V . Y., Z a v ilg e ls k il, G . B ., a n d B e lo g u r o v , A . A . (1988) W e a k e n in g o f ty p e I
r e strictio n in th e p r e se n c e o f p la s m id s o f th e In cl g r o u p - G en era l ch a ra c ter istic s a n d
c lo n in g o f ard g en e. / Mol Biol 22: 227-232.
K r a u se , M ., R o u d ie r , C., F ierer, J., H a r w o o d , J., a n d G u in e y , D . (1 9 9 1 ) M o le c u la r
a n a ly sis o f th e v ir u le n c e lo c u s o f th e Salmonella dublin p la s m id p S D L 2. M ol Microbiol 5:
3 0 7 -3 1 6 .
K ru ger, D . H ., a n d B ic k le , T. A . (1983) B a cte rio p h a g e su rvival: M u ltip le m e c h a n is m s for
a v o id in g the d e o x y r ib o n u c le ic acid re strictio n sy s te m s o f th eir h o st. Microbiol Rev 47: 345360.
K u la k a u s k a s , S ., L u b y s , A ., a n d E h r lic h , S. D . (1995) D N A r e s tr ic t io n -m o d ific a t io n
s y s te m s m e d ia te p la sm id m a in te n a n c e . J Bacteriol 177: 3451-3454.
K u s a n o , K., N a ito , T ., H a n d a , N ., a n d K o b a y a s h i, I. (1 9 9 5 ) R e s tr ic tio n -m o d ific a tio n
s y s te m s as g e n o m ic p a r a site s in c o m p e titio n for sp e c ific se q u e n c e s. Proc Natl Acad Sci
USA 92: 1 1 0 9 5-11099.
L a n k a , E., a n d B a rth , P. T. (1981) P la s m id R P4 s p e c ifie s a d e o x y r ib o n u c le ic a c id
p rim a se in v o lv e d in its co n ju g a l tran sfer a n d m a in ten a n ce. / Bacteriol 148: 769-781.
L a n k a, E., a n d W ilk in s , B. M . (1995) D N A p r o c e ss in g re a ctio n s in b a cteria l co n ju g a tio n .
Ann Rev Biochem 64: 141-169.
L ed erb erg , J., a n d T a tu m , E. L. (1946) G e n e re co m b in a tio n in E. coli. Nature 158: 558.
L e s s l, M ., B a lzer , D ., W e y r a u c h , K ., a n d L an k a, E. (1993) T h e m a tin g -p a ir fo r m a tio n
s y s te m o f p la s m id R P4 d e fin e d b y R S F 1010 m o b iliz a tio n a n d d o n o r -s p e c ific p h a g e
p r o p a g a tio n . J Bacteriol 175: 6415-6425.
L o h , S ., C ram , D ., a n d S k u rr a y , R . (1989) N u c le o t id e s e q u e n c e o f th e le a d in g r e g io n
a d ja cen t to th e o r ig in o f tran sfer o n p la s m id F a n d its c o n se r v a tio n a m o n g c o n ju g a tiv e
p la s m id s . Mol Gen Genet 219: 177-186.
L u n n e n , K. D ., B a r s o m ia n , J. M ., C a m p , R. R ., C ard , C. O ., C h e n , S. Z ., C r o ft, R .,
L o o n e y , M . C., M e d a , M . M ., M o r a n , L. S ., N w a n k w o , D . O ., S la tk o , B. E., V a n C ott,
E. M ., a n d W ils o n , G . G . (1988) C lo n in g ty p e II restrictio n an d m o d ific a tio n g e n e s. Gene
74: 25 -3 2 .
L u ria, S. E., a n d S u it, J. L. (1987) C o lic in s a n d C o l p la s m id s . In E sch erich ia c o li and
S a lm o n e lla ty p h im u r iu m : Cellular and Molecular Biology. In g ra h a m , J., L o w , K. B.,
M a g a sa n ik , B., S ch a ech ter, M ., U m b a rg e r, H . E., a n d N e id h a r t, F. C. (ed s). W a sh in g to n :
A S M P re ss, p p . 1615-1624.
M a k o v e t s , S ., T it h e r a d g e , A . J. B ., a n d M u rra y , N . E. (1998) C lp X a n d C lp P are
e s s e n tia l fo r th e e f fic ie n t a c q u is itio n o f g e n e s s p e c ify in g ty p e IA a n d IB r e str ic tio n
s y s te m s . Mol Microbiol 28: 25-35.
M a n n in g , P. A ., M o r e lli, G ., a n d A c h tm a n , M . (1981) TraG p ro te in o f th e F se x factor o f
Escherichia coli K -12 a n d its role in co n ju g a tio n . Proc Natl Acad Sci USA 78: 7487-7491.
M a r sh , J. L., E r fle , M ., a n d W y k e s, E. J. (1984) T he pIC p la s m id a n d p h a g e v e c to r s w ith
v e r s a tile sites for r e co m b in a n t s e le c tio n b y in se rtio n a l in a c tiv a tio n . Gene 32: 481-485.
M a s a i, H ., a n d A r a i, K . (1997) F rpo: a n o v e l s in g le -s tr a n d e d D N A p r o m o t e r fo r
tra n scrip tio n a n d for p rim er R N A s y n th e s is o f D N A re p lica tio n . Cell 89: 897-907.
M a th e w s , D . H ., S a b in a , J., Z u k e r , M ., a n d T u rn er, D . H . (1999) E x p a n d e d s e q u e n c e
d e p e n d e n c e o f th e r m o d y n a m ic p a r a m e te r s im p r o v e s p r e d ic tio n o f R N A s e c o n d a r y
structure. / M ol Biol 288: 911-940.
M a th e w s , C . K ., a n d v a n H o ld e , K . E. (1990) In B iochem istry. R e d w o o d C ity : T h e
Benjam in / C u m m in g s P u b lish in g C om p an y.
M a tic , I., T a d d e i, F., a n d R a d m a n , M . (1996) G en etic b arriers a m o n g b a cteria . Trends
Microbiol 4: 69-73.
M a ts o n , S. W ., a n d M o r to n , B. S. (1991) Escherichia coli D N A h e lic a s e I c a ta ly s e s a site
a n d str a n d -sp e c ific n ic k in g reaction at th e F p la sm id oriT. J Biol Chem 266: 109-114.
M a z o d ie r , P ., a n d D a v is , J. (1991) G e n e tra n sfer b e tw e e n d is ta n tly r e la te d b a c te r ia .
Annu Rev Genet 25: 147-171.
M c C la r in , J. A ., F r e d e r ic k , C. A ., W a n g , B. C ., G ree n e , P ., B o y er, H . W ., G r a b le , J., a n d
R o s e n b e r g , J. M . (1986) T he stru ctu re o f th e D N A -E coR I e n d o n u c le a s e c o m p le x at 3 A
r e so lu tio n . Science 234: 1526-1541.
M e r r y w e a th e r , A ., R e e s , C. E. D ., S m ith , N . M ., an d W ilk in s , B. M . (1986) R o le o f sog
p o ly p e p t id e s s p e c if ie d b y p la s m id C o lIb -P 9 a n d th eir tra n sfer b e t w e e n c o n ju g a tin g
b a cteria . EMBO J 5: 3 0 07-3012.
M e y e r , R ., a n d L a in e , P. S. (1 9 9 0 ) T h e s in g le -s tr a n d e d D N A b in d in g p r o t e in o f
Escherichia coli. Microbiol Rev 54: 342-380.
M e y n e ll, E., a n d D a tta , N . (1967) M u ta n t d r u g resistan t factors o f h ig h tr a n sm issib ility .
N ature 259: 4 5 5 -4 5 8 .
M ilk m a n , R . (1997) R e c o m b in a tio n a n d p o p u la tio n stru ctu re in Escherichia coli. Genetics
1 46: 7 4 5 -7 5 0 .
M i n k l e y , E. G ., a n d W ille t t s , N . S. (1 9 8 4 ) O v e r p r o d u c t io n ,
c h a ra c ter isa tio n o f th e F traT p ro tein . Mol Gen Genet 196: 225-235.
p u r if ic a t io n
and
M u r a i, N ., K a m a ta , H ., N a g a s h im a , Y., Y a g isa w a , H ., a n d H ira ta , H . (1995) A n o v e l
in s e r tio n s e q u e n c e (IS )-lik e e le m e n t o f th e th e r m o p h ilic b a c te r iu m PS3 p r o m o t e s
e x p r e s s io n o f th e a la n in e carrier p r o te in -e n c o d in g gen e. Gene 1 6 3:103-107.
N a i t o , T ., K u s a n o , K ., a n d K o b a y a s h i, I. (1995) S e lfis h b e h a v io u r o f r e s tr ic t io n m o d ific a tio n s y s te m s . Science 267: 897-899.
N e w m a n , A . K ., R u b in , R. A ., K im , S. H ., a n d M o d r ic h , P. (1981) D N A s e q u e n c e s o f
str u ctu ra l g e n e s for EcoRI D N A re strictio n an d m o d ific a tio n e n z y m e s . J Biol Chem 256:
2 1 3 1 -2 1 3 9 .
N is h ig a k i, K ., K a n e k o , Y., W a k u d a , H ., H u s im i, Y., a n d T a n a k a , T. (1985) T y p e II
r e strictio n e n d o n u c le a s e s c le a v e s in g le -s tr a n d e d D N A s in g en er a l. Nucl Acids Res 13:
5 7 4 7 -5 7 6 0 .
N o m u r a , N ., M a s a i, H ., I n u z u k a , M ., M iy a z a k i, C ., O h t s u b o , E., Ito h , T ., S a s a m o to ,
S., M a ts u i, M ., I s h iz a k i, R ., a n d A r a i, K . (1991) Id e n tifica tio n o f e le v e n sin g le -str a n d e d
in itia tio n s e q u e n c e s (ssi ) for p r im in g o f D N A re p lica tio n in th e F, R6K, R100 a n d C olE 2
p la s m id s . Gene 108: 15-22.
O c h m a n , H ., a n d L a w r e n c e , J. G . (1996) P h y lo g e n e tic s a n d th e a m elio ra tio n o f bacterial
g e n o m e s. In E sch erich ia co li and S a lm o n e lla ty p h im u r iu m . Cellular and Molecular Biology.
2 nd e d n .
N e id h a r d t , F.C . ( e d .- in - c h ie f ) . W a s h in g to n , D C : A m e r ic a n S o c ie ty for
M icr o b io lo g y P r e ss, p p . 2627-2637.
O 'N e ill, M ., C h e n , A ., a n d M u rra y , N . E. (1997) T h e r e str ic tio n -m o d ific a tio n g e n e s o f
Escherichia coli K -12 m a y n o t b e selfish : T h e y d o n o t re sist lo s s a n d are re a d ily rep la ced
b y a lle le s c o n fe r r in g d iffer en t s p e c ific itie s . Proc Natl Acad Sci USA 94: 14596-14601.
O u , J. T ., a n d A n d e r s o n , T. F. (1970) R o le o f p ili in b acterial co n ju g a tio n . / Bacteriol 102:
6 4 8 -6 5 4 .
P a n ic k e r , M . M ., a n d M in k le y , E. G . Jr. (1985) D N A tr a n sfe r o cc u r s d u r in g a cell
su rfa ce co n ta ct s ta g e o f F s e x fa c to r -m e d ia te d b acterial co n ju g a tio n . J Bacteriol 162: 584590.
P a n seg ra u , W ., Z ie g e lin , G ., a n d L a n k a , E. (1990a) C o v a le n t a sso cia tio n o f th e tral g en e
p r o d u c t o f p la s m id R P4 w ith th e 5 '-te r m in a l n u c le o tid e at th e relaxation N ic k site. / Biol
Chem 265: 1 0 6 3 7 -1 0 6 4 4 .
P a n se g r a u , W ., B a lz e r , D ., K ru ft, V ., L u r z, R ., a n d L a n k a , E. (1990b) In vitro a ss e m b ly
o f r e la x o s o m e s a t th e tra n sfer o r ig in o f p la s m id RP4. Proc Natl Acad Sci USA 87: 65556559.
P a n s e g r a u , W ., L a n k a , E ., B a rth , P. T ., F ig u r s k i, D . H ., G u in e y , D . G ., H a a s, D .,
H e lin s k i, D . R ., S c h w a b , H ., S ta n is ic h , V . A ., an d T h o m a s , C. M . (1994a) C o m p le te
n u c le o tid e s e q u e n c e o f B ir m in g h a m I n c P a p la sm id s: c o m p ila tio n a n d c o m p a r a tiv e
a n a ly sis o f s e q u e n c e d ata. / Mol Biol 239: 623-663.
P a n se g r a u , W ., S c h r o d e r , W ., a n d L a n k a , E. (1994b) C o n ce rted a ctio n o f th re e d istin ct
d o m a in s in th e D N A c le a v in g -jo in in g re a ctio n ca ta ly zed b y rela x a se (Tral) o f co n ju g a tiv e
p la s m id RP4. J Biol Chem 269: 2782 -2 7 8 9 .
P a n s e g r a u , W ., a n d L a n k a , E. (1991) C o m m o n se q u e n c e m o tifs in D N A re la x a se s and
n ic k re g io n s fr o m a v a r ie ty o f D N A tran sfer sy stem s. Nucl Acids Res 19: 3455.
P a n s e g r a u , W ., a n d L a n k a , E. (1996) M e c h a n ism o f in itia tio n a n d term in a tio n rea ctio n s
in c o n ju g a tiv e D N A p r o c e s s in g - In d e p e n d e n c e o f tig h t su b str a te b in d in g a n d catalytic
a c tiv ity o f r e la x a se (Tral) o f IncP a lp h a p la s m id RP4. / Biol Chem 271: 13068-13076.
P e a r s o n , W . R ., a n d L ip m a n , D . J. (1 9 8 8 ) I m p r o v e d to o ls fo r b io lo g ic a l s e q u e n c e
c o m p a r iso n . Proc Natl Acad Sci USA 85: 2444-2448.
P r a k a s h -C h e n g , A ., C h u n g , S. S., a n d R y u , J. (1993) T he e x p r e ss io n a n d r e g u la tio n o f
hsdk g e n e s after co n ju g a l transfer. Mol Gen Genet 241: 491-496.
P r a k a s h -C h e n g , A ., an d R y u , J. (1993) D e la y e d e x p r e ss io n o f in vivo re strictio n a c tiv ity
f o llo w in g c o n ju g a l tra n sfer o f Escherichia coli hsdK (r e str ic tio n -m o d ific a tio n ) g e n e s . /
Bacteriol 175: 4 9 0 5 -4 9 0 6 .
P r e n tk i, P ., a n d K r isc h , H . M . (1984) In vitro in sertio n a l m u ta g e n e sis w ith a s e le c ta b le
D N A fr a g m en t. Gene 19: 303-313
R a s h tc h ia n , A ., C r o o k s, J. H ., a n d L e v y , S. B. (1983) Tra] in d e p e n d e n c e in e x p r e s s io n o f
traT o n F. / Bacteriol 154: 1009-1012.
R a s to r g u e v , S. M ., Z a v ilg e ls k y , G . B ., a n d T c h u r ik o v , N . A . (1998) I n c ll p la s m id R64
e n c o d e s th e A r sR p r o te in th at a lle v ia te s ty p e I restriction. FEBS Letters 426: 21-23.
R e a d , T. D . (1 9 9 3 ) E v a sio n o f re str ic tio n s y s te m s b y p la s m id C olIb -P 9 d u r in g b a cteria l
co n ju g a tio n . P h .D th e sis, U n iv e r sity o f L eicester, L eicester U K .
R e a d , T. D ., T h o m a s , A . T ., a n d W ilk in s , B. M . (1992) E v a sio n o f ty p e I a n d ty p e II
re strictio n s y s t e m s b y I n c ll p la s m id C olIb -P 9 d u r in g tra n sfer b y b acterial co n ju g a tio n .
Mol Microbiol 6: 1933-1941.
R e d a s c h i, N ., a n d B ic k le , T. A . (1996) D N A r e strictio n a n d m o d ific a tio n s y s te m s . In
E sh erich ia c o li and S a lm o n e lla ty p h im u r iu m . Cellular and Molecular Biology. 2nd ed n .
N e id h a r d t, F. C. (e d .-in -c h ie f). W a s h in g to n , DC: A m e r ic a n S o c ie ty for M ic r o b io lo g y
P re ss, p p . 7 7 3 -7 8 1 .
R e e s , C. E. D . (1986) A g e n e tic a n a ly sis o f th e transfer g e n e s o f th e I n c ll p la s m id C o llb P9. P h .D th e s is , U n iv e r s ity o f L eicester, L eicester UK.
R e e s , C. E. D ., B r a d le y , D . E., a n d W ilk in s , B. M . (1987) O rg a n isa tio n an d r e g u la tio n o f
th e c o n ju g a tio n g e n e s o f I n c ll p la s m id C olIb-P9. Plasmid 18: 223-236.
R e e s , C. E. D ., a n d W ilk in s , B. M . (1989) T ransfer o f tra p r o te in s in to the r e c ip ie n t ce ll
d u r in g b a cte ria l c o n ju g a tio n m e d ia te d b y p la sm id C olIb-P9. J Bacteriol 171: 3152-3157.
R e e s , C. E. D ., a n d W ilk in s , B. M . (1990) P ro tein transfer in to th e re cip ie n t c e ll d u r in g
b a cteria l co n ju g a tio n : s tu d ie s w ith F a n d RP4. Mol Microbiol 4: 1199-1205.
R o b e r ts , R . J., a n d M a c e lis , D . (1994) REBASE - restrictio n e n z y m e s an d m e th y la s e s .
Nucl Acids Res 22: 3628-3639.
R o o n g ta , V . A ., J o n e s , C. R ., an d G o r e n s te in , D . G. (1990) E ffect o f d is to r tio n s in th e
d e o x y r ib o s e p h o s p h a t e b a c k b o n e c o n fo r m a tio n o f d u p le x o lig o d e o x y r ib o - n u c le o t id e
d o d e c a m e r s c o n ta in in g G T, GG, G A , A C a n d G U b a se-p a ir m ism a tc h e s o n P -31 N M R
sp ectra . Biochemistry 29: 5245-5258.
R o s c o e , R. A . (1996) R e g u la tio n o f le a d in g re g io n g en es o n I n c ll p la s m id C olIb -P 9. P h .D .
th e sis. U n iv e r s ity o f L eicester, L eicester, U K .
R u s s e ll, C. B ., T h a le r , D . S ., an d D a h lq u is t, F. W. (1989) C h ro m o so m a l tr a n sfo r m a tio n
o f Escherichia coli recD strain s w ith lin e a r ise d p la sm id s. J Bacteriol 171: 2609- 2613.
S a a d i, S ., M a a s , W . K ., H ill, D . F., a n d B e r g q u ist, P. L. (1987) N u c le o t id e s e q u e n c e
a n a ly s is o f R epF IC , a b a sic re p lico n p r e se n t in IncFI p la sm id s P307 a n d F, an d its re la tio n
to th e R e p A r e p lic o n o f IncFII p la s m id s. J Bacteriol 169: 1836-1846.
S a ik i, R. K . (1989) T h e d e s ig n an d o p tim isa tio n of th e PCR. In PCR Technology: Principles
and Applications for D NA Amplification. E rlich, H . A . (ed). N e w York / L o n d o n / T o k y o /
M e lb o u r n e / H o n g K ong: M S tock ton P ress, p p . 7-16.
S a m b r o o k , J., F ritc h , E. F., an d M a n ia tis , T. M . (1989) Molecular Cloning: A Laboratory
M anual- 2 nd e d itio n . C o ld S p rin g H a rb o r, N e w York: C o ld S p rin g H arb or L a b o r a to ry
P re ss.
S c h a n d e l, K . A ., M u lle r , M . M ., a n d W e b s te r , R. E. (1992) L o c a liz a tio n o f T raC , a
p ro te in in v o lv e d in a sse m b ly o f th e F c o n ju g a tiv e p ilu s. J Bacteriol 174: 3800-3806.
S h e n , P., a n d H u a n g , H . V . (1986) H o m o lo g o u s r e c o m b in a tio n in Escherichia coli:
d e p e n d e n c e o n su b stra te le n g th an d h o m o lo g y . Genetics 112: 441-457.
S ia , E. A ., K u e h n e r , D . M ., a n d F ig u r s k i, D . H . (1996) M e c h a n is m o f retro tra n sfer in
co n ju g a tio n - p rio r tran sfer o f th e p la s m id is req u ired . / Bacteriol 178: 1457-1464.
S ilv e r m a n , P. M . (1987) T he stru c tu r a l b a s is o f p ro k a r y o tic D N A transfer. In Bacterial
outer membranes as model systems. I n o u y e , M . (ed ). N e w York: Joh n W ile y a n d S o n s, p p .
2 7 7 -3 0 9 .
S im o n s e n , L. (1990) D y n a m ic s o f p la s m id tra n sfer o n s u r fa c e s. / Gen Microbiol 136:
1 0 0 1 -1 0 0 7 .
S kurray, R. A ., a n d R e e v e s , P. (1973) C h a ra c terisa tio n o f le th a l z y g o s is a ss o c ia te d w ith
con ju g a tio n in Escherichia coli K-12. J Bacteriol 113: 58-70.
S m ith , H . R ., H u m p h r e y s , G . O ., W i ls h a w , G . A ., a n d A n d e r s o n , E. S . ( 1 9 7 6 )
C h aracterisation o f p la sm id s co d in g for th e restriction e n d o n u c le a s e EcoRl. M ol Gen Genet
143: 319 -3 2 5 .
S o b e r o n , X., C o v a r r u b ia s, L., a n d B o liv a r , F. (1980) C o n str u c tio n a n d c h a r a c te r isa tio n
o f n e w c lo n in g v e h ic le s .IV. D e le tio n d e r iv a tiv e s o f pBR 322 a n d pB R 325. Gene 9: 287-305.
S ta h l, F. W ., K o b a y a s h i, I., T h a le r, D ., a n d S ta h l, M . M . (1986) D ire ctio n o f tr a v e l o f
RecBC r e c o m b in a se th r o u g h b a c te r io p h a g e la m b d a D N A . Genetics 113: 215-227.
S tu d ier , F. W ., a n d B a n d y o p a d h y a y , F. W . (1988) M o d e l for h o w ty p e I e n z y m e s s e le c t
c lea v a g e s ite s in D N A . Proc Natl Acad Sci USA 85: 4677-4681.
S u m m e r s, D . K. (1996) P la sm id d is s e m in a tio n . In The Biology of Plasmids. S u m m e r s, D .
K. (ed). O xford : B la c k w e ll S cien ce L td , p p . 92-110.
S u r i, B ., a n d B ic k le , T . A . (1985) EcoA: th e first m e m b e r o f a n e w fa m ily o f ty p e I
restrictio n m o d ific a tio n s y s te m s - g e n e o r g a n isa tio n a n d e n z y m a tic a ctiv itie s. / Mol Biol
186: 77-85.
S z y b a ls k i, W ., K im , S. C ., H a sa n , N ., a n d P o d h a jsk a , A . J. (1991) C lass-IIS re str ic tio n
e n z y m e s - a r e v ie w . Gene 100: 13-26.
T a o , T ., P a te l, J., F ir m a n , K ., a n d K n e a le , G . (1991) A fa m ily o f r e g u la to r y g e n e s
a sso cia te d w ith ty p e II r e str ic tio n -m o d ific a tio n sy ste m s. J Bacteriol 173: 1367-1375.
T a r d if, G ., a n d G ra n t, R . B . (1983) T ra n sfer o f p la s m id s fr o m Escherichia coli t o
Pseudomonas aeruginosa - c h a r a c te r isa tio n o f a Pseudomonas aeruginosa m u ta n t w it h
e n h a n c e d r e c ip ie n t a b ility for e n te ro b a cte ria l p la s m id s . Antimicrobiol Agents Chemo 24:
2 0 1 -2 0 8 .
T h o r s te d , P . B ., M a c C a r tn e y , D . P ., A k h ta r , P., H a in e s , A . S ., A li, N ., D a v id s o n , P .,
S ta ffo r d , T ., P o c k lin g t o n , M . J., P a n s e g r a u , W ., W ilk in s , B . M ., L a n k a , E ., a n d
T h o m a s , C. M . (1998) C o m p le te s e q u e n c e o f th e IncPfJ p la s m id R751: im p lic a tio n s for
e v o lu tio n a n d o r g a n isa tio n o f th e In cP b a ck b o n e. / Mol Biol 282: 969-990.
T ith e r a d g e , A . J. B ., T e r n e n t, D ., a n d M u rra y , N . E. (1996) A th ird fa m ily o f a lle lic hsd
g e n e s in Salmonella enterica: s e q u e n c e c o m p a r is o n s w it h r e la te d p r o te in s id e n t if y
c o n s e r v e d re g io n s im p lic a te d in re strictio n o f D N A . Mol Microbiol 22: 437-447.
T ra x ler, B. A ., a n d M in k le y , E. G . Jr. (1987) R e v ise d g en etic m a p o f th e d ista l e n d o f th e
F tran sfer o p e r o n : im p lic a tio n s for D N A h e lic a s e I, n ic k in g a t oriT , an d c o n ju g a l D N A
tra n sp o rt. / B acteriol 169: 3251-3259.
U e m u r a , H ., a n d M iz o b u c h i, K. (1 9 8 2 ) G e n e tic a n d p h y s ic a l ch a ra c ter isa tio n o f th e
C o llb p la s m id u s in g C olIb-R 222 h y b r id s. M ol Gen Genet 185: 1-12.
V a p n e k , D ., a n d R u p p , W . D . (1 9 7 1 ) I d e n tific a tio n o f in d iv id u a l se x -fa c to r D N A
str a n d s a n d th e ir r e p lic a tio n d u r in g c o n ju g a tio n in th e r m o s e n s itiv e D N A m u ta n ts o f
Escherichia coli. J M o l Biol 60: 413-424.
V ie r a , J., a n d M e s s in g , J. (1982) T h e p U C p la s m id s , a n d M 1 3 m p & -d e r iv e d s y s te m for
in sertio n m u ta g e n e s is a n d se q u e n c in g w it h sy n th etic u n iv er sa l p rim ers. Gene 19: 259-268.
W a lia , S. K ., a n d D u c k w o r t h , D . H . (1986) T h e r e la tio n s h ip o f th e d e lta fa c to r a n d
K co llb to th e C o llb p la sm id . / Gen M icrobiol 132: 3261-3268.
W a lk er, G . (1987) T h e SO S re sp o n se o f Escherichia coli. In E sch erich ia coli and S a lm o n e lla
ty p h im u r iu m . C ellu lar an d M olecu lar B iology. 2nd e d n . N e id h a r d t, F.C. (e d .-in -c h ie f).
W a sh in g to n , D C : A m e r ic a n S ociety for M ic r o b io lo g y P ress, p p . 1346-1357.
W a n g , J. Y ., a n d S y v a n e n , M . (1 9 9 2 ) D N A tw is t as a tr a n s c r ip tio n a l s e n s o r for
e n v ir o n m e n ta l c h a n g e s. M o l M icrobiol 6: 1861-1866.
W a ters, V . L ., a n d G u in e y , D . G. (1993) P ro c esses at th e n ick r e g io n lin k c o n ju g a tio n , TD N A tra n sfer a n d r o llin g circle re p lica tio n . M ol M icrobiol 9: 1123-1130.
W ic k n e r , S ., a n d M a u r iz i, M . R. (1999) H ere 's th e h ook: sim ila r su b strate b in d in g site s
in th e c h a p e r o n e d o m a in s o f C lp a n d L on . Proc N a tl A cad Sci U S A 96: 8318-8320.
W ille t t s , N . S , a n d S k u r r a y , R. A . (1987) S tru ctu re an d fu n c tio n o f th e F fa c to r a n d
m e c h a n is m o f co n ju g a tio n . In E sch erich ia coli and S a lm o n ella ty p h im u r iu m . N e id h a r d t,
F.C. (e d .-in -c h ie f). W a sh in g to n , DC: A m e r ic a n S o c ie ty for M ic r o b io lo g y P ress, p p . 692696.
W ille tts , N ., a n d W ilk in s , B. M . (1 9 8 4 ) P r o c e s sin g o f p la s m id D N A d u r in g b a cte ria l
c o n ju g a tio n . M icrobiol R ev 48: 24-41.
W illia m s , K . R ., S p ic e r , E. K. A . L. R ., a n d G u g g e n h e im e r , R. A . (1 9 8 3 ) L im ite d
p r o te o ly s is s tu d ie s o n th e Escherichia coli sin g le -stra n d ed b in d in g p rotein . / Biol Chem 258:
3 3 4 6 -3 3 5 5 .
W ilk in s , B . M . (1975) P artial su p p r e s s io n o f th e p h e n o ty p e o f Escherichia coli K -12 dnaG
m u ta n ts b y s o m e I-lik e c o n ju g a tiv e p la sm id s. J Bacteriol 122: 899-904.
W ilk in s , B. M . (1995) G e n e transfer b y b acterial con ju gation : d iv e r sity o f s y s te m s a n d
fu n c tio n a l sp e c ia liz a tio n s. In Population Genetics o f Bacteria. B au m b erg, S., Y o u n g , J. P. W .,
S a u n d e r s, S. R., a n d W e llin g to n , E. M . H . (eds) C am bridge: C a m b rid g e U n iv e r sity P ress,
p p . 5 9 -8 8 .
W i l k i n s , B . M ., a n d B a te s , S. (1 9 9 7 ) G e n e tr a n sfe r b y b a c te r ia l c o n ju g a tio n :
E s ta b lis h m e n t o f th e im m ig r a n t p la s m id in th e recip ien t cell. In M olecular M icrobiology.
N A T O A S I se r ie s V o l. H 103. B u sb y , S. J. W ., T h om as, C. M ., a n d B row n , N . L. (e d s).
B erlin H e id en b e rg : S prin ger-V erlag, p p . 43-64.
W ilk in s , B. M ., a n d L a n k a , E. (1993) D N A p r o c e ssin g a n d re p lic a tio n d u r in g p la s m id
tran sfer b e tw e e n G ra m -n e g a tiv e b acteria. In Bacterial Conjugation. C lew ell, D .B. (ed ). N e w
York: P le n u m P re ss, p p . 105-136.
W ilk in s , B . M ., C h i ll e y , P. M ., T h o m a s , A . T ., a n d P o c k lin g t o n , M . J. ( 1 9 9 6 )
D istr ib u tio n o f r e str ic tio n e n z y m e r e c o g n itio n se q u e n c e s o n b r o a d h o st r a n g e p la sm id
RP4: m o lec u la r a n d e v o lu tio n a r y im p lic a tio n s. J Mol Biol 258: 447-456.
W ils o n , G . G . (1991) O rg a n isa tio n o f r e strictio n -m o d ifica tio n s y s te m s. Nucl Acids Res 19:
2 5 3 9 -2 5 6 6 .
W ils o n , G . G ., a n d M u rra y , N . E. (1991) R estrictio n a n d m o d ific a tio n sy ste m s. Ann Rev
Genet 25: 5 8 5 -6 2 7 .
W in a n s, S. C ., a n d W a lk e r , G . C. (1983) G e n e tic lo c a lis a tio n a n d ch a ra c ter isa tio n o f a
p K M lO l-c o d e d e n d o n u c le a s e . / Bacteriol 154: 1117-1125.
W in a n s , S. C ., E lle d g e , S. J., K r u e g e r , J. H ., a n d W a lk e r , G . C. (1985) S ite -d ir e c te d
in sertion a n d d e le tio n m u ta g e n e sis w ith c lo n e d fra g m en ts in Escherichia coli. J Bacteriol 161:
1 2 1 9 -1 2 2 1 .
Y a n isc h -P e r r o n , C ., V ie ir a , J., a n d M e s s in g , J. (1985) I m p r o v e d M 13 p h a g e c lo n in g
v ecto rs a n d h o s t strains: n u c le o tid e se q u e n c e s o f th e M 1 3 m p l8 a n d p U C 19 v e c to r s. Gene
33: 103-119.
Y u a n , R ., a n d H a m ilt o n , D . L. (1 9 8 4 ) T y p e I a n d ty p e III r e s tr ic tio n -m o d ific a tio n
e n z y m e s . In D N A methylation. R a z in , A ., C edar, H ., a n d R ig g s, A . D . (ed s). N e w York:
S p rin g er-V erlag, p p . 11-37.
Z e c h n e r , E. L., d e la C r u z , F., E ise n b r a n d t, R ., G ra h n , A . M ., K o r a im a n n , G ., L a n k a ,
E., M u th , G ., P a n s e g r a u , W ., T h o m a s , C. M ., W ilk in s , B. M ., a n d Z a ty k a , M . (1 9 9 9 )
C o n ju g a tiv e D N A tran sfer p r o c e sse s. In T he H o rizo n ta l G en e P ool: Bacterial Plasmids and
Gene Spread. T h o m a s, C. M . (ed). A m sterd a m : H a r w o o d A c a d e m ic P u b lish ers, C h ap ter 3.