Supplementary Information.
Materials and Methods
Knock down of CGGBP1 transcript
Knock down of CGGBP1 transcript was carried out in WT, FXS and UFM fibroblasts using both
transient and stable approach. For transient method both semi-synthetic endogenous siRNAs
called MISSION esiRNAs (Sigma-Aldrich) and shRNA from MISSION® ShRNA libraries (SigmaAldrich) were employed. In accordance with the protocol of the manufacturer, 5 or 10 nM of
esiRNA were transfected by Lipofectamine RNAiMAX (Invitrogen) for a minimum of 48h up to 96h.
To check transfection efficiency was used esiRNA against HPRT transcript. Negative control to
check the efficiency of CGGBP1 depletion was performed using scramble siRNA (IDT).
ShRNAs against CGGBP1 mRNA (Sigma-Aldrich) are listed in Supplementary Table 1 and they were
used by both transient and stable approach. The MISSION® ShRNA libraries supply several clones
for the CGGBP1 transcript all with the hairpin sequences cloned into the pLKO.1 vector. For viral
production, packaging cells from 293LTV were plated in flasks until 70% of confluence was
achieved. Transfection of plasmids (pMD2.G and psPAX2) (Addgene, 12259 and 12260) for viral
proper production and the plasmids of interest (POI, Plasmid Of Interest) were set with a
DNA:transfectant agent ratio of 1:4. Polyethyleneimine (PEI) was used as transfecting agent. In 2
ml of OPTIMEM medium (Gibco Life technologies, 31985-062), 4.8 µg of pMD2.G plasmid, 14.3 µg
of psPAX2 plasmid and 19 µg of POI were incubated with 153 µl of PEI for 20 minutes at RT. The
mix, added to the cell culture medium was replaced after 16 hours and the virus collected 24 and
48h later. The collected virus was not titrated; therefore to ensure an adequate particle
concentration, a virus containing the reporter GFP gene (pLENTI-GFP, Cell Biolabs Inc) was used as
positive control and regularly checked (every 24h). Supernatant containing virus was precipitated
with PEG-it TM Virus precipitation solution 5X (SBI System Biosciences) overnight and added to
two identical series of 6-wells plates of WT, FXS and UFM fibroblasts, respectively. For the
transient transfections cells were collected 48 hours after infection to test the efficiency of the
treatment; conversely for the stable transfections fibroblast cultures underwent antibiotic
selection with Puromycin (Sigma-Aldrich) at 1.5 µM (final concentration) for 20 days after 48h
lentiviral infection, in order to isolate single clones. An empty pLKO.1-puro vector was used as
negative control, to determine whether the transfection itself could affect FMR1 transcription.
Bisulphite sequencing
Genomic DNA was isolated from treated and untreated cells by DNeasy Blood & Tissue kit
(Qiagen). The DNA concentration was checked both by absorbance measurements at 260 and 280
nm and on agarose gel. Bisulphite DNA transformation was performed as previously described. 27
Each transformed DNA was amplified in 7 independent PCR reactions, then pooled and recovered
from the agarose gel with the StrataPrep DNA Gel extraction kit (Stratagene). The purified PCR
products were cloned with the StrataClone PCR cloning kit (Stratagene), according to the
manufacturer’s instructions. After bacterial plating and overnight incubation at 37°C, white
colonies were picked and plasmid DNA was extracted. After a pre-screening of the clones with PCR
using specific plasmid primers (T3 and T7), amplification products were sequenced in both
directions with BigDye Terminator v3.1 Cycle Sequencing kit (Life technologies) on a 3130 Genetic
Analyzer (Life technologies). The modified primers to sequence the CpG of the FMR1 promoter
region are those described in Pietrobono et al. (2002). 24
Figure S1. CGG expansion and transcriptional data of FXS3 lymphoblastoid cell line. Southern blot
hybridized with radioactive Ox1.9 probe of a control female (lane 1) and FXS3 lymphoblastoid cell
line (lane 2) (A). Double digestion with HindIII and with the methylation-sensitive enzyme EagI of a
normal control female displays two normal of 2.5 and 5.2 kb bands corresponding to the active
and inactive X chromosomes, respectively. The single digestion with HindIII of FXS3 reveals the
presence of 0.2 kb fragment (around 96 CGGs, premutation range) and of a smear of fragments up
to 2.8 kb (around 963 CGGs, full mutation range). Relative quantification of FMR1 transcript by
fluorescent real-time PCR in WT (normal control male), FXS and FXS3 lymphoblastoid cell lines (B).
FXS3 has a transcription activity (around 20% respect to normal control male) of FMR1 gene due
to its premutation allele. The values represent mean of three independent quantifications (n=3)
with standard deviation.
Figure S2. Relative quantification of CGGBP1 transcripts by fluorescent real-time PCR. Results of
CGGBP1 transcript quantification in two different WT, two FXS, two PM and one UFM
lymphoblastoid cell lines (A). The levels of CGGBP1 transcript are essentially equal in all cell lines.
The difference in CGGBP1 transcription between WT1 and WT2 may be considered normal
fluctuations, already seen for other transcripts. Results of CGGBP1 transcript quantification in WT,
FXS and UFM fibroblasts (B). Also in fibroblasts CGGBP1 transcription is almost equal represented
in the three type of cell lines. The values represent mean of two independent quantifications (n=2)
with standard deviation.
Figure S3. Bisulphite analysis of the 52 CpGs of the FMR1 promoter region and FMR1
transcriptional reactivation before and after 8 days-treatment with 5-azadC of FXS1 (A) and FXS2
(B) lymphoblastyoid cell lines. Bisulphite sequencing analysis was performed as previously
reported.
24,27
Each line corresponds to a single sequenced clone; black square represents a
methylated cytosine, while white square a demethylated position. Note that FXS1 (around 250
CGGs) is more demethylated after 5-azadC treatment respect to FXS2 (around 350 CGGs),
corresponding with a higher FMR1 transcriptional reactivation quantified through real-time RTPCR.
Figure S4. Relative quantification of CGGBP1, FMR1 and HPRT transcripts by fluorescent real-time
RT-PCR after transient transfection with esiRNAs against CGGBP1-mRNA (and against HPRT-mRNA,
used as control of transfection efficiency) in WT (A) and UFM (B) fibroblasts. The silencing levels of
CGGBP1-mRNA (upper panels) are very high, reaching 85-90% of knock-down compared to the
untreated control both in WT and in UFM after 72 hours from esiRNA transfection. Levels of
FMR1-mRNA (middle panels) does not significantly changes after CGGBP1 silencing in both cell line
types. Levels of HPRT-mRNA were 10-20% respect to the untreated control (both WT and UFM)
after knock-down with esiRNA against HPRT-mRNA (bottom panels), demonstrating the efficiency
of transfection. Experiments with different end-point of the treatment (48h and 96h) produced
similar results (not shown).
Figure S5. Relative quantification of CGGBP1 and FMR1 transcripts by fluorescent real-time RT-PCR
after transient transfection with shRNAs against CGGBP1-mRNA in FXS fibroblasts. The silencing
levels of CGGBP1-mRNA (upper panel) are very high, reaching 95% of knock-down (shRNA4-5 in
combination) compared to the untreated control. Levels of FMR1-mRNA (bottom panel) does not
significantly changes after CGGBP1 silencing (note the levels of residual transcription near 0).
Table S1. List of shRNAs against CGGBP1 transcript used for transient and stable transfection of WT, FXS
and UFM fibroblasts with the corresponding catalog number, sequence and nucleotide position for each
clone.
Nucleotide
position
Name
Cat. Number
Sequence (Top strand)
CGGBP1-ShRNA-1
sh1
NM_003663.3-391
CCGGGAAACCGTTCTAAGACTGCCTCT
CGAGAGGCAGTCTTAGAACGGTTTCTT
TTTTG
NM_003663.3-
CGGBP1-ShRNA-2
sh2
NM_003663.3-455
CCGGGCTGCATGAAGATGGAGGAAAC
TCGAGTTTCCTCCATCTTCATGCAGCTT
TTTTG
NM_003663.3-
CGGBP1-ShRNA-3
sh3
NM_003663.3-487
CCGGCTTCTTGCAATGTGGTTCTGACTC NM_003663.3GAGTCAGAACCACATTGCAAGAAGTTT
c.541_561
TTTG
CGGBP1-ShRNA-4
sh4
NM_003663.3-610
CCGGCCCTAACTGCATCTCTTCAGTCTC NM_003663.3GAGACTGAAGAGATGCAGTTAGGGTTT
c.663_683
TTTG
CGGBP1-ShRNA-5
sh5
NM_003663.3-642
CCGGGCGCAAACAGAGAAAGTCAGTC
TCGAGACTGACTTTCTCTGTTTGCGCTT
TTTTG
c.445_464
c.509_527
NM_003663.3c.696_715