Human SNPs Genotyping by Single Base Extension on PNA Microarray
Jae Yang Song, Hyun Gyu Park
Department of Chemical and Biomolecualr Engineering
Korea Advanced Institute of Science and Technology
373-1 Guseong-dong, Yuseong-gu, Daejeon 305-701
Republic of Korea
Abstract: Large scale human genetic studies require technologies for generating millions of genotypes with
relative ease but also at a reasonable cost and with high accuracy. We describe a novel system that allows
high-throughput genotyping of single nucleotide polymorphisms (SNPs) on PNA microarray by single base
extension (SBE) reaction. SBE reaction use bifunctional primers carrying a unique sequence tag in addition to a
locus specific sequence. SBE primers are extended with biotin-labeled ddNTPs and stained with
streptavidin-R-phycoerythrin after hybridization on PNA microarray. Seven SNPs related with diabetes disease
were detected successfully through single-tube-SBE reaction. Genotypes are deduced from the fluorescence
signals. Higher degrees of multiplexing would be possible with this method.
Key-Words: - PNA, SBE, Multiplex genotyping, Microarray,
1 Introduction
experiments such as DNA array, Northern or Southern
bolt, FISH, detection of single point mutations and
DNA mapping.
This paper describes a novel enzyme assisted method
that allows efficient high-throughput genotyping of
multiplex amplified genome SNPs in a microarray
format. The method is based on the single base
extension reaction that using chimeric primer with 3
complementarity to the specific SNP loci and 5
complementarity to specific probes, or tags,
synthesized on microarray.
Genomewide genetic analysis of gene-based single
nucleotide polymorphisms (SNPs) may be an efficient
paradigm for the discovery of genes important in
complex traits in humans (1). Methods to screen and
map genetic variability have, for more than two
decades, been used on restriction fragment length
polymorphism
and
microsatellite
markers.
Identification of complex disease genes will require
both linkage and association analysis of thousands of
individuals. To enable such large-scale polymorphism
analysis in human studies, parallel and efficient
genotyping methods are critically needed.
2 Materials and Methods
A wide variety of technologies have been used to
genotype SNPs, including single base extension,
2.1 DNA sample
TaqMan assay (2), oligonucleotide ligation assay (3),
Sample of known genotype analyzed in our study was
molecular beacon (4) and cleavage by a flab
provided by voluntary personal. The DNA was
endonuclease (5).
extracted from whole blood by a standard method.
We used PNA microarray in this experiment. Peptide
nucleic acid (PNA) is novel DNA mimic in which the
2.2 Primers
sugar-phosphate backbone has been replaced with a
A pair of PCR primers were designed to have a similar
backbone based on amino acid (6). PNA exhibit
Tm near 70 C, a G+C content of near 50%, and a
sequence-specific binding to DNA and RNA with
length of 42 mer and 37 mer with a product size 361 bp.
higher affinity and specificity than unmodified DNA.
Forward primer had a 5 tail of T7 sequence
PNA is resistant to nuclease and protease attack in
(TAATACGACTCACTATAGGG) and the reverse
serum and cellular extracts and, thus, appear very
promising as diagnostic and biomolecular probes, and
primer had a 5 tail of T3 sequence
possibly as antisense and antigene drugs. For instance,
(ATTAACCCTCACTAAA). SBE primers were
PNA labeled with biotin, fluorescent dyes or reporter
designed as bifunctional primers carrying a unique
enzymes are powerful probes in hybridization
Table 1. Oligonucleotide sequences for multiplex SBE genotyping for 7 SNPs.
* All sequences are written 5 to 3.
SNP
Allele
SNP1
SNP2
SNP3
SNP4
SNP5
SNP6
SNP7
G
G
G
C
C
C
C
Zip
Code
1
2
9
3
4
7
6
Capture Probe
Sequence
TGCGGGTAATCG
ATCGTGCGACTT
GGTAATCGACCT
ATCGACTTTGCG
CAGCACCTTGCG
ATCGGGTATGCG
TGCGACCTGGTA
SBE Primer Sequence
CGATTACCCGCAGCAGCACAACATCCCACAGC
AGGTCGCACGATCCCTAACTCATAGGT
AGGTCGATTACCAACACCTCAACAA
CGCAAGGTCGATACTCCCATGAAGACGCAGAAG
CGCAAGGTGCTGCACTGGCCTCAACCAGTCC
CGCATACCCGATAGCAGCACAACATCCCACAG
TACCAGGTCGCAGATACCACTGGCCTCAACCAGT
The microarrays were prepared on standard
microscope glass slide. PNA (Peptide nucleic acid) 12
mer oligonucleotide contained a 5 NH2 group spotted
on microarray. To reduce the spot variation, each
sequence has 9 (33) spots respectively.
The biotin labeled SBE reaction products were
denatured at 95 C for 5 minutes and snap cooled on
ice for 3-5 minutes, then hybridized with 30 l
hybridization solution (1X SSPET, 0.01 % Triton
X-100) at 37 C for 12 hours.
After hybridization, the arrays were rinsed with 6X
SSPET (0.005 % Triton X-100) for 10 minutes at
room temperature and then stained at 37 C for 2 hours
with 30 l staining solution (3 g/ml streptavidin
R-phycoerythrin in 1X SSPET 0.01% Triton X-100).
2.4 PCR Amplification
2.7 Array Scanning and Signal Quantiation
The amplifications were carried out using 100 ng of
DNA, 0.2 mM dNTPs, 100 M each primer, 10 mM
Tris HCl, 40 mM KCl, 1.5 mM MgCl2, and 2.5 U Taq
DNA polymerase (Bioneer) in 50 l of reaction buffer.
After initial activation of the polymerase at 94 C for 5
minutes, the thermocycling parameters were as
follows: 35 cycles of 94 C for 30 seconds, 55 C for
30 seconds, 72 C for 1 minutes, and final extension at
72 C for 7 minutes.
The microscope glass slides were scanned using the
fluorescence
scanner
GenePix4000B
(Axon
instrument). 16 bit TIFF images were analyzed using
GenePix Pro 3.0 software.
sequence tag in addition to a locus-specific sequence
(Table1).
2.3 Microarray Design
2.5 Multiplex SBE reaction
SBE reactions were carried out in 20 l reactions
using 8 l the template, 0.25 M each SBE primer, 2
U Thermosequenase (Amersham), 26 mM Tris-HCl.
6.5 mM MgCl2 25 M biotin-ddGTP, 25 M
biotin-ddCTP.
Single base extension reactions were carried out on a
thermocycler (AppliedBiosystems) with initial
polymerase activation at 96 C for 5 minutes, then 40
cycles of 96 C for 30 seconds, 50 C for seconds and
60 C for 2 minutes. After SBE reaction, the products
of SBE were purified using QIAquick Nucleotide
Removal Kit (Qiagen).
2.6 Hybridization on PNA Tag Array
3 Results and Discussion
3.5 Reaction Principle
Figure 1 shows the principle and procedure of the
novel single base extension method for genotyping
single nucleotide variation on microarray. Double
stranded PCR products serves as template for the SBE
reaction. Each SBE primer is chimeric with a 5 end
complementary to a unique tag synthesized on the
array a 3 end complementary to the genomic sequence
and terminating one base before a polymorphic SNP
site. Thus, each SBE primer is uniquely associated
with a specific tag on the array. SBE primers
corresponding to multiple markers are added to a
single reaction tube and extended in the presence of
biotin-labeled ddNTPs. The labeled multiplex SBE
reaction products are pooled and hybridized to the tag
array.
Figure 1. Schematic of SBE genotyping on PNA
microarray. Multiplex SBE reactions are performed in
single tube; Each SBE primer is chimeric with unique
sequence tag. Multiplex SBE reaction analyzed on
PNA microarray after hybridization. Probes on
microarray has complemetary sequences to each
chimeric SBE primer .
3.6 Genotype Discrimination
Single base extension involves extension of a primer
located adjacent to the position of a SNP, using DNA
polymerase in the presence of biotin-labeled ddNTPs.
We demonstrate the potential for accurate multiplex
genotyping by the single base extension by applying it
to three SNPs in single tube reaction. The result shows
high fidelity genotype discrimination for three SNPs
in one step single base extension reaction.(Figure 2B).
We also evaluated our single base extension method
with seven SNPs (Figure 2C). These reaction
conditions were identical to the optimized conditions
applied in this first assay.
Because of its accuracy, ease, and potential for high
throughput, our novel microarray-based method will
greatly benefit various large scale SNP genotyping or
mutation screening project.
(A)
(B)
( C)
Figure 2. (A) The design of an PNA microarray is
illustrated schematically. Twenty groups of spots have
been formed on microslide. Each group has nine spots
to reduce the fluorescence intensity variation. The
entire PNA microarray contains 20 unique tag
sequence of 12 mer probe. (B) Fluorescence image of
PNA microarray following hybridization of 3 SNPs
SBE primers. (C) Fluorescence image of seven SNPs
genotyping by multiplex SBE reactions on PNA
microarray.
References:
[1] Risch, N. & Merikangas, K., Science, 273,1996,pp
1516-1517.
[2] Livak, K. J., Marmaro, J. & Todd J. A., Nat.
Genet.,9, 1995, pp 341-342.
[3] Tobe, V. O., Taylor, S. L. & Nickerson, D. A.,
Nucleic Acids, 24, 1996, pp 3728-3732.
[4] Tyagi, S., Bratu, D. P. & Kramer, F. R., Nat.
Biotechnol. 16, 1998, pp 49-53.
[5] Mein, C. A., Barratt, B. J., Dunn, M. G., Siemund,
T., smith, A. N., Esposito, L., Nutland, S., Stevens,
H. E., Wilson, A. J., Phillips, M. S., et al., Genome
Res.,10,2000,pp330-343.
[6] Peter E. N., Acc. Chem. Res., 32, 1999, pp
624-630.