BioSc 231
General Genetics
Exam 4
Name __________________________________
Multiple Choice. (1 point each)
_____ Polyploid plants found in nature usually have even numbers of chromosomes because organisms having odd numbers
A. exhibit altered mitosis
B. exhibit altered growth
C. have low fertility
D. are not viable
_____ Pollen from one species with a genome represented by (CC) germinates on the stigma of another related species with a genome
represented by (DD) and sexually fertilizes the ovule. Most of the resulting plants are sterile but some of the resulting offspring
undergo chromosome duplication resulting in fertile plants. The genomes of the fertile offspring are best represented by
A.CC
B. DD
C. CCDD
D. CDD
E. CCD
_____ In a mammal, no Barr bodies are observed. How many X chromosomes does the organism have?
A. 0
B. 1
C. 2
D. 3
E. 4
_____ Euploidy is
A. a chromosome number that is not an exact multiple of the haploid number
B. an example of aneuploidy
C. a chromosome number that is an exact multiple of the haploid number
D. the addition of an extra copy of a particular chromosome
E. the absence of a particular copy of a chromosome
_____ The basic diploid chromosome number in Rye Secale cereale is 14. A new species of rye is found that has 28 chromosome
species. This species is said to be
A. haploid
B. diploid
C. triploid
D. tetraploid
E. pentaploid
_____ When an allotetraploid (AABB) is backcrossed to one of its progenitor species (BB), a sterile progeny is produced. The
genomic composition of this sterile individual can be best represented by
A. AB
B. ABB
C. AA
D. BB
E. AAB
_____ When an organism gains one extra copy of a chromosome but not a complete haploid set, the conditions is known as
A. polyploidy
B. euploidy
C. aneuploidy
D. triploidy
_____ It was once thought that the ____ karyotype was related to criminal disposition because it led to aggressive behavior due to
excessive "maleness".
A. XO
B. XY
C. XXY
D. XYY
E. YY
_____ Consider a species with a diploid (2n) number of 12 chromosomes. How many chromosomes would be found in a trisomic
body cell?
A. 6
B. 7
C. 12
D. 13
E. 18
_____ A base change resulting in a codon specifying an amino acid which is different than in the wild-type polypeptide
A. Missense
B. Silent
C. Nonsense
D. Synonymous
E. Frameshift
_____ Mosaicism is due to
A. X-inactivation
B. chromosome duplication
C. chromosome deletion
D. somatic mutations
E. gametic mutations
_____ When a diploid organism undergoes one or more rounds of endoreduplication (resulting in a gain of more than one complete
haploid set of chromosomes), the resulting cells are best described as
A. polyploid
B. triploid
C. aneuploid
D. trisomic
_____ Type of mutation in which a purine is substituted for a purine
A. Transition
B. Transversion
C. Frameshift
D. Conversion
E. Inversion
_____ A type of microorganism that can exist on minimal medium
A. Conditional
B. Autotroph
C. Auxotroph
D. Prototroph
_____ A biochemical mutant that must be supplied with a particular nutrient for growth would be described as a(n)
A. Conditional
B. Lethal
C. Auxotroph
D. Prototroph
E. Autotroph
_____ A base change that changes a codon for an amino acid to a stop codon
A. Missense
B. Silent
C. Nonsense
D. Synonymous
E. Frameshift
_____ A bacterial histidine mutant was plated on minimal medium and a single colony grew. You decide to sequence the histidine
biosynthetic gene of the revertant and discover that the original mutation is still present. This colony must have been able grow
due to a
A. forward mutation
B. suppressor mutation
C. auxotrophic mutation
D. back mutation
E. back mutation OR suppressor mutation
_____ A cell is exposed to EMS (a mutagen that causes guanine to mispair with thymine) and allowed to undergo a few rounds of
DNA replication. The mutational event caused by this mutagen will be
A. AT to CG
B. GC to AT
C. AT to TA
D. AT to GC
E. GC to CG
_____ A new E. coli mutant was tested for auxotrophy. The mutant grows on:
minimal medium (M) + arginine (R) + histidine (H)
M + H + alanine (A)
M+R+H+A
but not on M
or on M + R + A. The mutant requires
A. Arginine
B. Histidine and alanine
C. Histidine
D. Arginine and alanine
E. Alanine
_____ The fluctuation test of Luria and Delbruck (studying resistance to bacteriophge T1 infection) established that
A. T1 phage was a mutagen.
B. Mutations could arise prior to the time they were selected
C. The mutation rate varies greatly from experiment to experiment.
D. In E. coli the number of mutants per clone was relatively constant.
_____ Himalayan rabbits have an appearance similar to Siamese cats, in which their body is primarily a light cream color but have
patches or black at their extremities. This coloration is due to a mutation within a black pigment gene. The type of mutation in this
gene is described as
A. Conditional
B. Lethal
C. Auxotroph
D. Autotroph
_____ How many different trisomics could be formed in a plant with a diploid number of 16?
A. 1
B. 8
C. 16
D. 24
E. 32
_____ E. coli cells were spread on an agar plate, producing 1000 colonies. The colonies are replica plated on three agar plates
containing the antibiotic kanamycin and one agar plate without antibiotics. All of the colonies are able to grow on the agar plate
without antibiotic but only 4 colonies are able to grow on each of the agar plates containing kanamycin. You notice that the four
colonies that grew on each of the kanamycin containing plates are in the exact same position. This demonstrates
A) how to screen for environmental mutagens
B) that mutations occur in prokaryotes as well as in eukaryotes
C) that in some cases mutations are caused by the selective agent itself
D) that mutations occur in the absence of the selective agent
E) a direct correlation between the amount of the selective agent used and the number of resistant mutants (one-hit relationship)
_____ Turner syndrome in humans is caused by which chromosomal conditions?
A. 47, XXY
B. 47, 21+
C. 45, X
D. 47, XYY
_____ Exposure to gamma radiation leads to severe damage to DNA. The bacterium Deinococcus radiodurans is able to survive
exposure to levels of gamma radiation that would kill any other known organism. This organism is able to survive because
A. it is covered with a very thick cell wall that blocks radiation
B. it produces its own mutagens that quickly revert mutations that result from radiation exposure
C. it has several very efficient DNA repair systems
D. it has hundreds of copies of its chromosome so it has a good chance of at least one surviving
_____ A hybrid allotetraploid species (2n = 40) was backcrossed to one of the suspected parents (2n = 20). When the F 1 underwent
meiosis, the prophase chromosome configuration was examined. If the guess about the suspected parent is correct, what would the
chromosome configuration look like?
A. 20 pairs
B. 20 pairs and 10 singles
C. 30 singles
D. 10 pairs and 10 singles
E. 30 singles
_____ Fragile X syndrome is caused by
A. Trinucleotide repeats
B. 5-Bromouracil
C. Free radicals
D. Depurination
E. Microdeletions
_____47,XXY is a condition known as
A. Klinefelter syndrome
B. Turner syndrome
C. Double-Y syndrome
D. Fragile-X syndrome
Short Answer (variable points each)
(2 pts) Name two places in and around a gene that can be changed to produce less of a gene product and briefly explain how they
result in less gene product.
(2 pts) Name two ways in which a mutant phenotype, resulting from a single mutation, can be reverted back to a wild-type phenotype.
(2 pts) Why do calico cats have patches of black and orange fur?
(Bonus) - Calico cats are almost always female. What would it take to have a calico male cat?
(2 pts) Briefly explain how a frame shift mutation can sometimes result in a polypeptide that is larger than the original polypeptide.
(2 pts) Briefly explain the purpose of the mouse liver extracts used in the Ames test.
(2 pts) A mutation in an enzyme that replaces a single, positively charged, amino acid at the carboxyl terminus into a negative amino
acid results in loss of enzyme activity. An investigator screens for revertants of the mutant phenotype and discovers several revertants
in which the original mutation remained but discovered a second mutation at the amino terminus of the protein. Briefly explain how
this might be possible.
(2 pts) A set of Drosophila deletions in chromosome 4 was assembled as follows (the lines indicate the region that has been deleted)
Regions
1
a
b
c
d
e
f
2
3
4
5
6
7
_________
_______________
___________________
______
___________
___________
red
white
white
red
white
red
A mutation leading to white eye color is mapped to chromosome 4. A geneticist crosses a strain with the white eye color allele to each
of the above deletion strains. The phenotype of the offspring of each cross is indicated to the right. In which region of the
chromosome is the white eye gene located?
(2 pts) What happens when monoploid plant cells are treated with colchicine?
(2 pts) Briefly explain why back mutations generated by a mutagen occur less frequently than forward mutations.
(2 pts) Why is polysomy more harmful than polyploidy?
(3 pts) Recessive alleles a, b, c, d, e, f and g are closely linked but their order is unknown. A set of 7 deletions are used to determine
the gene order as revealed by the genes exposed by each deletion. The genes exposed by each mutation are as follows:
deletion number
1
2
3
4
5
6
7
What is the order of the genes?
gene(s) exposed
b and d
b, d and a
f and d
f
g and e
g, e and c
e, c and a
(5 pts) Using the table below, determine the amino acid sequence of the polypeptide produced by the following messenger RNA:
ACGUAUGAUUUGUGAGCUGAUCAAGGAAUGCCACGAGGAGAGCGAAUGAAAA
(2 pts) A single base change in the above sequence results in a polypeptide that is only 8 amino acids in length. Which codon is
changed and what is the specific nucleotide change?
(2 pts) The protein produced by the above mRNA functions as a signal molecule and scientists predict that the Lysine (K) in this
protein is necessary for its function. What mutation(s) would you make to test this hypothesis? (Note, the typical strategy for
determining the function of a single amino acid residue in a protein is to replace that amino acid with an alanine (A) amino
acid residue)
(Bonus essay - 4 points). Two enrichment strategies were described in class that make it easier to find mutations in a large population
of cells. Describe one of those enrichment strategies.