KAROLINSKA INSTITUTET
February 2001
The Microbiology & Tumor Biology Center
Joakim Dillner, M.D., Ph.D.
Associate professor of Virology
POPULATION-BASED TYPE-SPECIFIC PREVALENCE OF HIGH RISK HUMAN
PAPILLOMAVIRUS INFECTION IN MIDDLE-AGED SWEDISH WOMEN
Ola Forslund,1* Annika Antonsson,1 Karin Edlund,3 Adrian J. C. van den Brule, 2 Bengt-Göran
Hansson,1 C.J.L.M. Meijer, 2 Walter Ryd,6 Eva Rylander,5 Anders Strand,4 Göran Wadell,3 Joakim
Dillner,1 and Bo Johansson7.
Department of Medical Microbiology, Lund University, University
Hospital, Malmö,1 Department of Pathology, Section of Molecular Pathology, University Hospital
Vrije Universeit, Amsterdam, The Netherlands,2 Department of Virology, University of Northern
Sweden, Umeå,3 Department of Medicine, Dermatology, and Venereology, University Hospital,
Uppsala,4 Dept of Obstetrics and Gynecology, Karolinska Institute, Danderyd Hospital,5 Department
of Dermato-Venereology, Sahlgrenska University Hospital, Göteborg,6 Division of Clinical
Virology, Karolinska Institute, Huddinge University Hospital, Sweden.7
Running title: HR HPV among middle-aged Swedish women
Mailing address
171 77 STOCKHOLM
Sweden
Visiting Address
Fogdevreten 2
SOLNA
Phones
+ 46 8 728 6299
Fax
+ 46 8 304276
E-Mail
joakim.dillner@mtc.ki.se
KAROLINSKA INSTITUTET
February 2001
2
ABSTRACT
Objective
To determine the prevalence and spectrum of high risk (HR) human papillomavirus (HPV) types in a
large real-life population-based cervical screening setting of middle-aged Swedish women, since HPV
might be used as a marker for identification of women at risk for development of cervical cancer.
Method
Cervical brush samples from 6,125 women, 32- 38 years of age, in a multicenter study were analysed
using a general HPV primer (GP5+/6+) PCR-enzyme immunoassay (EIA) combined with reverse dot
blot hybridization (RDBH) for confirmation and HPV typing in a single assay.
Results
Altogether, 6.6% (402/6,125) were confirmed HR HPV positive. Infections with 13 different HR HPV
types were detected of which HPV 16 was the most prevalent type (2.0%; 123/6,125), followed by
HPV 31 (1.0%; 63/6,125). Any one of the HPV types 18, 33, 35, 39, 45, 51, 52, 56, 58, 59 or 66 was
detected in 3.5% (217/6,125) of the women. Infection with two, three and five types simultaneously
was identified in 32, five and one women, respectively.
Conclusion
The combination of PCR-EIA as a screening test and RDBH as a confirmatory test, was found to be
readily applicable to a real-life population-based cervical screening setting. The women were infected
with a heterogeneous group of HPV types of which HPV 16 and 31 were the most frequent types. The
HR HPV prevalence of 6.6% suggests that HPV screening may be a favorable strategy to identify
middle-aged women at risk for developing cervical cancer.
KAROLINSKA INSTITUTET
February 2001
3
INTRODUCTION
Cancer of the cervix uteri is the second leading cause of mortality among women worldwide and the
incidence has been estimated to about 500,000 new cases each year (1). The human papillomavirus
(HPV) has been identified as the major causal agent of the disease (2) and up to 99.7% of cervical
cancers have been found to carry the HPV genome (3). HPV types frequently detected in cervical
cancers are classified as ‘high-risk’ (HR) viruses, while those rarely or never found in cancer are called
‘low risk’ (LR) types (4). HPV infections are also detected among cytologically healthy women, with a
peak prevalence of about 20 – 25% at 20 – 24 years of age, correlating with the onset of sexual
activity. However, the infection is transient in most women (5). A decline in HPV prevalence is
observed with increasing age and at around 35 years of age the prevalence of HPV infection among
cytologically normal women has been reported to be around 5% (6, 7). Persistence of HPV infection is
associated with HR HPV types and is more frequent in women older than 30 years of age than among
those under 24, indicating that HPV positive older women may represent a subset of women with
difficulty to clear the infection (8).
Screening for cervical intraepithelial neoplasia (CIN) has been shown to be an effective method to
reduce both incidence and mortality of invasive cervical cancer (9-11). Despite the success of
screening using the Papanicolau (Pap) smear the cytological examination manifests a sensitivity of
only about 75% (11, 12). Furthermore, the Pap smear screening has shown low sensitivity for
adenocarcinomas (13) and large variations of cytological false negative and false positive rates
between laboratories (14, 15). These limitations and the fact that almost all cervical cancers are
positive for HPV (3) and is preceded by persistent HPV infections (16-19) argue for evaluation of
HPV testing in cervical cancer screening programs. The most appropriate group for HPV screening is
women aged 30 years or more, since younger age groups have high HPV prevalences and low cervical
cancer incidences (7, 20). Recently, a standardized PCR-EIA test for HR HPV DNA in crude cell
suspension has been developed and validated to be reproducible and extremely sensitive for HPV
KAROLINSKA INSTITUTET
February 2001
4
detection (21, 22). The PCR-EIA could be applicable for cervical cancer screening. However, to
identify the exact HPV genotype of a positive PCR-EIA additional analyses have to be performed. The
reverse dot blot hybridization (RDBH) assay (23) could be a method of choice for HPV genotyping
and confirmation of samples positive in the PCR-EIA.
The aims of this study is to determine the prevalence and spectrum of HR HPV types of cervical
samples in a large real-life population-based cervical screening setting of middle-aged Swedish women
by the PCR-EIA method combined with the RDBH assay.
KAROLINSKA INSTITUTET
February 2001
5
MATERIALS AND METHODS
Study group
In the organized program, all women belonging to the age groups eligible for screening are invited for
screening by letter at 3-year intervals. Women who have had a Pap smear taken within the previous 3
years are not invited. For the present study, eligible women were defined as women in the age group
32 – 38 years participating in the population-based cervical screening program in five different
cities/regions in Sweden (Malmö, Göteborg, Stockholm, Uppsala and Umeå). In total, 12,522 women
were enrolled. Of these, 6,320 women were randomized to the testing group, and 6,125 cervical
scrapes were positive in the PCR adequacy test.
Polymerase chain reaction
From each woman two cervical scrapes were obtained by the use of a cytobrush. The first sample was
used for routine cytological screening, and cells from the second sample were placed in 1 mL 0.9%
NaCl and stored at -20C. Samples from the cities of Malmö, Stockholm and Umeå were analyzed for
HPV at the regional laboratory, respectively, whereas samples from Uppsala and Göteborg were sent
frozen to Malmö for analysis. Samples were analyzed by a general HPV primer GP5+/6+ mediated
PCR enzyme immunoassay EIA (21). Prior to analysis the cells were thawed and centrifuged for 10
min at 3,000 x g. The cell pellet was resuspended in 1 mL 10 mM TRIS-HCl (pH 7.5) and frozen at 20C. Then the samples were thawed and aliquots of 100 uL were boiled for 10 min, and 10 uL was
used in a 50 uL reaction mixture containing 200 uM of each dNTP, 3.5 mM MgCl2, 1 U AmpliTaq
DNA polymerase and reaction buffer (Perkin Elmer, Foster City, Ca), 0.5 uM biotinylated GP6+
primer and 0.5 uM GP5+ primer (24). The quality of the sample DNA for amplification was analyzed
in separate tubes by using a -globin PCR with biotinylated-BGPC03 and BGPC05 primers (25).
KAROLINSKA INSTITUTET
February 2001
6
For the PCR, the laboratory of Malmö used a Hybaid OmniGene (Hybaid, Middlesex, UK) automated
thermal cycler programmed for block temperature and Umeå used a PTC-200 (MJ Research) with
’calculated control’ mode. For PCR with GP+ primers a denaturation step at 94C for 4 min was
followed by 40 cycles of amplification with segments at 94C for 1.5 min, 40C for 1.5 min, 72C for
2 min, and a final step at 72C for 4 min. The laboratory of Stockholm used a GeneAmp 9700 (Perkin
Elmer) with a denaturation step at 94C for 4 min followed by 40 cycles at 94C for 1 min, 38C for 1
min, 71C for 2 min, and a final step at 71C for 4 min. The -globin PCR was performed under the
same conditions but the annealing temperature was at 45C.
As positive controls of -globin, input of 1 ng and 10 ng human placental DNA (Sigma) were used. As
positive controls of the HPV PCR, ten-fold dilutions of purified DNA from SiHa cells were used,
ranging from 10 ng to 100 pg of input DNA in a background of 100 ng human placental DNA (Sigma).
As negative control 10 uL of water was added to the PCR and processed as the samples.
Enzyme immunoassay (EIA)
Amplified DNA was detected by enzyme immunoassay (21). Five uL of biotinylated HPV PCR
products were captured on streptavidin coated microtitre plates (Boehringer Mannheim, Mannheim,
Germany) after adding 50 uL hybridization buffer (1 x SSC, 0.5 % Tween 20). The plates were
incubated at 37C for 1h. After 3 washings with 200 uL hybridization buffer per well, amplicons were
denatured with 100 uL 0.2 M NaOH for 15 min at room temperature. Then the plates were washed 3
times with hybridization buffer, and 50 uL of hybridization buffer containing 10 uM of each HPV
specific digoxigenin-11-ddUTP labeled probe was added per well. The probe solution contained a
cocktail of 14 oligo probes for the HPV types 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66 and 68.
After hybridization at 37C for 1h, the plates were washed twice and 50 uL alkaline phosphatase
conjugated anti-DIG (75 mU/mL hybridization buffer, Boehringer Mannheim) was added per well.
KAROLINSKA INSTITUTET
February 2001
7
The plates were incubated at 37C for another 1h, and then washed five times, and 100 uL of pNPP
substrate (SIGMA) was added per well. Plates were incubated overnight at 37C and ODs were
measured at 405 nM. By using a digoxigenin labeled probe (5’AAGAGTCAGGTGCACCATGGTGTCTGTTTG) the same procedure was used for analyzing the
amplified DNA from the -globin PCR.
For interpretation of results, cut off was set to three times of the mean OD-value of two negative
controls. For each plate, the EIA was approved only if the positive control of 10 pg SiHa DNA was
above cut off. The plate for -globin test was approved if the controls with 10 ng human DNA were
above cut off, after overnight incubation.
Typing of HPV
Aliquots (20 uL) of PCR solutions from positive EIA samples were sent frozen for typing at a single
laboratory (Malmö). HPV types were determined by the use of a non-radioactive reverse dot blot
hybridization (RDBH) (23). The membranes for use in the RDBH were prepared as follows.
Recombinant HPV plasmids (100 ng DNA/dot), corresponding to the different HPV types tested for in
the EIA were denatured at high pH (0.8 M NaOH, 0.5 mM EDTA) for 20 min and transferred by use
of a manifold (Schleicher & Schuell, Dassel, Germany) to a prewetted (6 x SSC) nylon membrane
(Hybond N+, Amersham, Buckinghamshire, England). The membrane was neutralized with 200 uL 20
x SSPE, dried for 30 min at room temperature and baked at 120C for 20 min. Prehybridization of
membranes was done for 1h at 46C in 5 mL solution containing 50% deionized formamide, 1% SDS,
10% dextran sulphate, 1 M NaCl and 100 ug/mL of herring sperm DNA in a hybridization oven
KAROLINSKA INSTITUTET
February 2001
8
(Hybaid). Five uL of PCR solution was added to 50 uL of prehybridization solution, denaturated at
94C for 5 min and transferred to the prehybridization solution. After hybridization overnight, the
membrane was rinsed once and then for 3 x 15 min with 2 x SSPE plus 0.1% SDS at 65C and
incubated with 5 mL blocking solution at 65C for 1h [3% bovine serum albumin in TBS-Tween (100
mM Tris-HCl, 150 mM NaCl, 0.05% v/v Tween 20, pH 7.5), filtered through a sterile 0.45 uM
membrane, (Acrodisc, Gelman Sciences, Ann Arbor, MI)]. Blocking solution was removed and the
membrane was incubated at room temperature for 10 min with 5 mL of streptavidin-alkaline
phosphatase [Gibco-BRL, diluted 1/3300 in TBS-Tween and filtered through a sterile 0.22 uM
membrane (Millipore S. A., Molsheim, France)]. The membrane was washed at room temperature for
2 x 10 min with TBS-Tween and finally with 5 mL washing buffer (100 mM Tris-HCl, 100 mM NaCl,
50 mM MgCl2, pH 9.5) for 1 h. Thereafter, the membrane was dried briefly on a filter paper to remove
excess buffer, dipped in detection reagent (Lumi-Phos 530, Lumigen Inc, Southfield, MI) and placed
in a transparent folder and incubated for 1.5 h at room temperature. The membrane was exposed to Xray film (Kodak X-AR, Kodak Rochester, NY) in a cassette with intensifying screens (Du Pont,
Cronex lightning plus, NEN, Boston, MA) for 10 min. An HPV type was considered identified when
clear-cut spot of darkening of the film could be distinguished from the background.
The project was approved by the Institutional Review Board of the Karolinska Institute, decision
number 96:305.
KAROLINSKA INSTITUTET
February 2001
9
RESULTS
HPV screening
Totally, 6.6% (401/6,125) of the women were found positive for HR HPV DNA after confirmation by
RDBH. The range of positivity for the different regions in Sweden was between 5.3 and 8.0% (Table
1). The -globin quality test revealed that 3.1% (195/6,320) of the samples were not amplifiable and
that the proportion of -globin negative samples varied between 0.7% and 13% between different
regions (Table 2).
For 27 of the EIA positive samples no HPV type could be identified by RDBH, but DNA sequencing
revealed that two of these samples harbored HPV type 6, two contained HPV 42 and one sample
contained HPV 67. Another sample was found to harbor both HPV 42 and 43 by a RDBH for LR HPV
types. These four HPV types were not included in the HR HPV probe mix and were therefore not
included in the ordinary RDBH either. Of the remaining 21 non-typed samples, 19 samples from
Stockholm showed a mean OD-value of 1.6 (SD=0.97) above cut off and two samples from Umeå had
values close to cut off (0.010 and 0.019).
HPV type distribution
In total, 13 different HR HPV types were identified among the women (HPV 68 was not identified)
(Table 1). HPV 16 was the most prevalent type, found in 2.0% (123/6,125) followed by HPV 31 found
in 1.0% (63/6,125), and anyone of the HPV types 18, 33, 35, 39, 45, 51, 52, 56, 58, 59 or 66 were
detected in 3.5% (217/6,125) of the women (Figure 1). Infection with two, three and five types
simultaneously was identified in 32, five and one women, respectively. By RDBH, HPV was
successfully typed in 94% (402/429) of the EIA positive samples. Figure 2 is a representative example
of an RDBH analysis of four samples.
KAROLINSKA INSTITUTET
February 2001
10
DISCUSSION
To the best of our knowledge, this is the largest population based HPV study of middle-aged
women showing a HR HPV prevalence of 6.6%. By the confirmatory RDBH method, 13 HR
HPV types were identified of which HPV 16 was the most frequent type followed by HPV 31.
Out of the remaining HPV types 18, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66 and 68 contained in
the HR probe mixture, HPV 68 was the only type not found in the present material.
The combination of PCR-EIA as a screening test and RDBH as a confirmatory test, that also
provides the exact HPV types present in the sample, was found to be readily applicable to a
real-life population-based cervical screening setting. Regional HPV screening laboratories sent
aliquots of PCR solutions from positive PCR-EIA samples for independent verification and
HPV typing at a national reference laboratory that performed the RDBH analysis. By this
approach, most of the EIA positive samples (94%) were confirmed and the HPV type
identified.
By using a reverse line blot assay (containing fixed oligonucleotide probes on a strip),
allowing identification of 27 HPV types a sensitivity of 88% has been reported for typing of
HPV DNA generated by PCR with MY09 and MY11 primers (26). Also, oligonucleotide
based reverse blotting for 37 HPV types has been developed and is currently being evaluated
(Van den Brule et al., unpublished observation).
Our RDBH can easily be combined with the MY09/MY11 PCR system by using a
hybridization temperature of 56C in the RDBH (23). However, for 6 of the EIA positive
samples that could not be confirmed by RDBH, LR HPV types (HPV types 6, 42, 43 and 67)
were identified. In accordance with this finding we have recently found, from another series of
KAROLINSKA INSTITUTET
February 2001
11
samples, that some samples with high copy numbers of LR HPV types cross-hybridized with
the HR probe in the EIA. This cross-hybridization in a few samples can be avoided if
hybridization is performed at 55C instead of 37C.
By the -globin sample adequacy test, 3% of the samples showed values below cut-off. In a HPV
screening study of Dutch women, using the same technique for sample accuracy (except that
visualization was performed by gel electrophoresis), 5% (184/3,489) of the samples were negative for
human DNA (7). In our study, the proportion of -globin negative samples varied between 0.7% and
13%. Although the same sampling procedures and the same systems for collection, storage and
transportation of samples were used in all regions, it appears that there may have been regional
differences in how the samples actually were taken and processed. The nature of these differences is
not clear. However, about 1,500 cells (calculated from the used cut-off at 10 ng human placental DNA
and that one diploid cell contains about 6 x 109 base pairs) were required for a positive -globin test in
the PCR-EIA. This rather low sensitivity of the sample adequacy test is appropriate, since a sample
adequacy test should never be more sensitive than the diagnostic test itself.
The prevalence of HR HPV is known to decrease with increasing age, from about 20% among women
of 20-30 years to about 5% in women over 30 years of age (25, 27, 28). However, only few population
based studies of HR HPV prevalence have been performed of women above 30 years of age. In
addition, to our large population based study showing 6.6% HR HPV among women 32-38 years,
Rozendaal et al., report 5.4% (121/2250) HR HPV of women aged 34-54 years of age by PCR-EIA
(29), and Ratnam et al., found 5.0% (27/536) HR HPV of women in the 35-44 age group by Hybrid
Capture assay (30).
Infection with multiple types of HPV has been related to persistency of HPV for more than 6 months
(31) and may therefore be a risk factor for CIN. Only 0.6% (38/6,125) and 0.7% (24/3,351) of our
KAROLINSKA INSTITUTET
February 2001
12
Swedish and Dutch women 30-39 of age with normal cytology (7), respectively, have been found
positive for multiple HR HPV types simultaneously. It is possible that selective amplification of the
PCR reaction of only some of the types present in a sample may have underestimated the true
proportion of multiple infections.
In several studies of women with normal cytology or with different grades of CIN, HPV 16 has been
found to be the most prevalent HPV type followed by HPV 31 (7, 28, 32). Also in our study HPV 16
and HPV 31 predominated, indicating that the type distribution of HPV infection is rather similar in
several different populations. A spectrum of different HPV types was present in Sweden, with 13/14
HR HPV types tested for being found. In a similar Dutch HPV prevalence survey of women with
normal cytology, all of the 14 HR types that we tested for were detected. In addition HPV 34 and 70
were detected. Their probe cocktail was extended to contain 19 HR HPV types based on the
phylogenetic relatedness (also HPV 26, 34, 53, 70 and 73 apart from the types tested for by us) (7).
There were no HPV 53 isolates in the Dutch study, in spite of the fact that this type was the most
prevalent one among American women developing atypical squamous cells of undetermined
significance (ASCUS) when another general primer PCR system was used (MY09/MY11) (33). The
GP+ primer system has been reported to have a lower sensitivity for HPV53 (about 3-log) compared to
the MY09/11 system (34). Difference in prevalence of HPV 53 might also be due to geographical
differences.
The issue of which oncogenic HPV types that should be tested for in primary HPV screening programs
is debated. The cost-efficiency of HPV screening will decrease when infections that are very rare or
only rarely progress to cancer are screened for, and we therefore decided to evaluate screening only for
the 14 major oncogenic HPV types.
In conclusion, a sensitive and simple HPV screening test (PCR-EIA) in combination with an
independent confirmatory HPV typing test (RDBH) is useful for field trials of screening for high risk
KAROLINSKA INSTITUTET
February 2001
13
HPV infection. The HPV prevalences and type distribution in Sweden in this age group are similar to
the figures that have been used in the mathematical modeling studies which indicated that HPV
screening could substantially improve cervical screening programs (35) and thus suggest that HPV
screening may be a favorable strategy for cervical cancer prevention. We are therefore currently
conducting a large population based study of middle aged aged Swedish women to test if HR HPV
detection might improve cervical screening.
ACKNOWLEDGMENT
We are grateful to staff involved in the population-based cervical screening program in Sweden for
enrolling the women and taking the cervical brush samples.
This work was supported by the Swedish Cancer Society and by Europe against Cancer contract
number 96 201748 05 F01 for the enrollment period 1997-01-01 to 1998-06-30 and by contract
number 99/CAN/36731; SI2.168540 (2000CVF2-002) for the time period 1999-08-30 to 2000-12-15.
KAROLINSKA INSTITUTET
February 2001
14
REFERENCES
1.
Schoell, W. M., Janicek, M. F., and Mirhashemi, R. Epidemiology and biology of cervical
cancer. Semin Surg Oncol, 16: 203-11, 1999.
2.
zur Hausen, H. Papillomavirus infections-a major cause of human cancers. Biochim Biophys
Acta, 1288: F55-78, 1996.
3.
Walboomers, J. M., Jacobs, M. V., Manos, M. M., Bosch, F. X., Kummer, J. A., Shah, K. V.,
Snijders, P. J., Peto, J., Meijer, C. J., and Muñoz, N. Human papillomavirus is a necessary cause of
invasive cervical cancer worldwide. J Pathol, 189: 12-19, 1999.
4.
Lörincz, A. T., Reid, R., Jenson, A. B., Greenberg, M. D., Lancaster, W., and Kurman, R. J.
Human papillomavirus infection of the cervix: relative risk associations of 15 common anogenital
types. Obstet Gynecol, 79: 328-37, 1992.
5.
Evander, M., Edlund, K., Gustafsson, A., Jonsson, M., Karlsson, R., Rylander, E., and Wadell,
G. Human papillomavirus infection is transient in young women: a population-based cohort study. J
Infect Dis, 171: 1026-30, 1995.
6.
de Villiers, E. M., Wagner, D., Schneider, A., Wesch, H., Munz, F., Miklaw, H., and zur
Hausen, H. Human papillomavirus DNA in women without and with cytological abnormalities: results
of a 5-year follow-up study. Gynecol Oncol, 44: 33-9, 1992.
7.
Jacobs, M. V., Walboomers, J. M., Snijders, P. J., Voorhorst, F. J., Verheijen, R. H., Fransen-
Daalmeijer, N., and Meijer, C. J. Distribution of 37 mucosotropic HPV types in women with
cytologically normal cervical smears: the age-related patterns for high-risk and low- risk types. Int J
Cancer, 87: 221-7, 2000.
8.
Hildesheim, A., Schiffman, M. H., Gravitt, P. E., Glass, A. G., Greer, C. E., Zhang, T., Scott,
D. R., Rush, B. B., Lawler, P., Sherman, M. E., and et al. Persistence of type-specific human
papillomavirus infection among cytologically normal women. J Infect Dis, 169: 235-40, 1994.
KAROLINSKA INSTITUTET
9.
February 2001
15
Läärä, E., Day, N. E., and Hakama, M. Trends in mortality from cervical cancer in the Nordic
countries: association with organised screening programmes. Lancet, 1: 1247-9, 1987.
10.
Mahlck, C. G., Jonsson, H., and Lenner, P. Pap smear screening and changes in cervical cancer
mortality in Sweden. Int J Gynaecol Obstet, 44: 267-72, 1994.
11.
Pontén, J., Adami, H. O., Bergstrom, R., Dillner, J., Friberg, L. G., Gustafsson, L., Miller, A.
B., Parkin, D. M., Sparen, P., and Trichopoulos, D. Strategies for global control of cervical cancer. Int
J Cancer, 60: 1-26, 1995.
12.
Boyes, D. A., Morrison, B., Knox, E. G., Draper, G. J., and Miller, A. B. A cohort study of
cervical cancer screening in British Columbia. Clin Invest Med, 5: 1-29, 1982.
13.
Chamberlain, J. Reasons that some screening programmes fail to control cervical cancer. In: M.
Hakama, A. Miller, and N. Day (eds.), Screening for cancer of the uterine cervix. 76, pp. 161-8: IARC,
1986.
14.
Yobs, A. R., Swanson, R. A., and Lamotte, L. C., Jr. Laboratory reliability of the Papanicolaou
smear. Obstet Gynecol, 65: 235-44, 1985.
15.
Falcone, T., and Ferenczy, A. Cervical intraepithelial neoplasia and condyloma: an analysis of
diagnostic accuracy of posttreatment follow-up methods. Am J Obstet Gynecol, 154: 260-4, 1986.
16.
Remmink, A. J., Walboomers, J. M., Helmerhorst, T. J., Voorhorst, F. J., Rozendaal, L., Risse,
E. K., Meijer, C. J., and Kenemans, P. The presence of persistent high-risk HPV genotypes in
dysplastic cervical lesions is associated with progressive disease: natural history up to 36 months. Int J
Cancer, 61: 306-11, 1995.
17.
Schiffman, M. H., and Brinton, L. A. The epidemiology of cervical carcinogenesis. Cancer, 76:
1888-901., 1995.
KAROLINSKA INSTITUTET
18.
February 2001
16
Ho, G. Y., Burk, R. D., Klein, S., Kadish, A. S., Chang, C. J., Palan, P., Basu, J., Tachezy, R.,
Lewis, R., and Romney, S. Persistent genital human papillomavirus infection as a risk factor for
persistent cervical dysplasia. J Natl Cancer Inst, 87: 1365-71., 1995.
19.
Nobbenhuis, M. A., Walboomers, J. M., Helmerhorst, T. J., Rozendaal, L., Remmink, A. J.,
Risse, E. K., van der Linden, H. C., Voorhorst, F. J., Kenemans, P., and Meijer, C. J. Relation of
human papillomavirus status to cervical lesions and consequences for cervical-cancer screening: a
prospective study. Lancet, 354: 20-5., 1999.
20.
Cuzick, J., Sasieni, P., Davies, P., Adams, J., Normand, C., Frater, A., van Ballegooijen, M.,
and van Den Akker, E. A systematic review of the role of human papillomavirus testing within a
cervical screening programme. Health Technol Assess, 3: 1-204, 1999.
21.
Jacobs, M. V., Snijders, P. J., van den Brule, A. J., Helmerhorst, T. J., Meijer, C. J., and
Walboomers, J. M. A general primer GP5+/GP6(+)-mediated PCR-enzyme immunoassay method for
rapid detection of 14 high-risk and 6 low-risk human papillomavirus genotypes in cervical scrapings. J
Clin Microbiol, 35: 791-5, 1997.
22.
Jacobs, M. V., Snijders, P. J., Voorhorst, F. J., Dillner, J., Forslund, O., Johansson, B., von
Knebel Doeberitz, M., Meijer, C. J., Meyer, T., Nindl, I., Pfister, H., Stockfleth, E., Strand, A., Wadell,
G., and Walboomers, J. M. Reliable high risk HPV DNA testing by polymerase chain reaction: an
intermethod and intramethod comparison [published erratum appears in J Clin Pathol 1999
Oct;52(10):790]. J Clin Pathol, 52: 498-503, 1999.
23.
Forslund, O., Hansson, B. G., and Bjerre, B. Typing of human papillomaviruses by consensus
polymerase chain reaction and a non-radioactive reverse dot blot hybridization. J Virol Methods, 49:
129-39, 1994.
24.
de Roda Husman, A. M., Walboomers, J. M., van den Brule, A. J., Meijer, C. J., and Snijders,
P. J. The use of general primers GP5 and GP6 elongated at their 3' ends with adjacent highly conserved
sequences improves human papillomavirus detection by PCR. J Gen Virol, 76: 1057-62, 1995.
KAROLINSKA INSTITUTET
25.
February 2001
17
de Roda Husman, A. M., Walboomers, J. M., Hopman, E., Bleker, O. P., Helmerhorst, T. M.,
Rozendaal, L., Voorhorst, F. J., and Meijer, C. J. HPV prevalence in cytomorphologically normal
cervical scrapes of pregnant women as determined by PCR: the age-related pattern. J Med Virol, 46:
97-102, 1995.
26.
Coutlee, F., Gravitt, P., Richardson, H., Hankins, C., Franco, E., Lapointe, N., and Voyer, H.
Nonisotopic detection and typing of human papillomavirus DNA in genital samples by the line blot
assay. The Canadian Women's HIV study group. J Clin Microbiol, 37: 1852-7, 1999.
27.
Melkert, P. W., Hopman, E., van den Brule, A. J., Risse, E. K., van Diest, P. J., Bleker, O. P.,
Helmerhorst, T., Schipper, M. E., Meijer, C. J., and Walboomers, J. M. Prevalence of HPV in
cytomorphologically normal cervical smears, as determined by the polymerase chain reaction, is agedependent. Int J Cancer, 53: 919-23, 1993.
28.
Hansson, B. G., Forslund, O., Bjerre, B., Lindholm, K., and Nordenfelt, E. Human papilloma
virus types in routine cytological screening and at colposcopic examinations. Eur J Obstet Gynecol
Reprod Biol, 52: 49-55, 1993.
29.
Rozendaal, L., Westerga, J., van der Linden, J. C., Walboomers, J. M., Voorhorst, F. J., Risse,
E. K., Boon, M. E., and Meijer, C. J. PCR based high risk HPV testing is superior to neural network
based screening for predicting incident CIN III in women with normal cytology and borderline
changes. J Clin Pathol, 53: 606-11., 2000.
30.
Ratnam, S., Franco, E. L., and Ferenczy, A. Human papillomavirus testing for primary
screening of cervical cancer precursors. Cancer Epidemiol Biomarkers Prev, 9: 945-51., 2000.
31.
Ho, G. Y., Bierman, R., Beardsley, L., Chang, C. J., and Burk, R. D. Natural history of
cervicovaginal papillomavirus infection in young women. N Engl J Med, 338: 423-8, 1998.
32.
Nindl, I., Lotz, B., Kuhne-Heid, R., Endisch, U., and Schneider, A. Distribution of 14 high risk
HPV types in cervical intraepithelial neoplasia detected by a non-radioactive general primer PCR
mediated enzyme immunoassay. J Clin Pathol, 52: 17-22, 1999.
KAROLINSKA INSTITUTET
33.
February 2001
18
Liaw, K. L., Glass, A. G., Manos, M. M., Greer, C. E., Scott, D. R., Sherman, M., Burk, R. D.,
Kurman, R. J., Wacholder, S., Rush, B. B., Cadell, D. M., Lawler, P., Tabor, D., and Schiffman, M.
Detection of human papillomavirus DNA in cytologically normal women and subsequent cervical
squamous intraepithelial lesions. J Natl Cancer Inst, 91: 954-60, 1999.
34.
Qu, W., Jiang, G., Cruz, Y., Chang, C. J., Ho, G. Y., Klein, R. S., and Burk, R. D. PCR
detection of human papillomavirus: comparison between MY09/MY11 and GP5+/GP6+ primer
systems. J Clin Microbiol, 35: 1304-10, 1997.
35. van Ballegooijen, M., van den Akker-van Marle, M. E., Warmerdam, P. G., Meijer, C. J.,
Walboomers, J. M., and Habbema, J. D. Present evidence on the value of HPV testing for cervical
cancer screening: a model-based exploration of the (cost-)effectiveness. Br J Cancer, 76: 651-7, 1997.
KAROLINSKA INSTITUTET
February 2001
19
Legends to figures.
Figure 1. Prevalence of high risk HPV types within population-based cervical screening of Swedish
women, 32 to 38 years of age, as determined by PCR-EIA and typing by reverse dot blot hybridization
(RDBH).
Figure 2. Reverse dot blot hybridization (RDBH) of biotinylated amplimers from PCR-EIA with
GP5+/6+ primers: a) Positions of immobilized HPV types. b) Identification of HPV types. Sample 1,
%
HPV 16; sample 2, HPV 31, 35 and 66; sample 3, HPV 31; sample 4, HPV 51.
2.0
1.5
1.0
0.5
0.0
2.0
1.0
0.6
0.7
0.4 0.3
0.4 0.3 0.5 0.3
0.2
0.3
0.2
16 18 31 33 35 39 45 51 52 56 58 59 66 68
HPV types