Supplemental Information
Supplemental Methods
The B-luciferase reporter plasmidHA-IB- SR that is expressed from a CMV
promoter have been previously described.1 The p3TP-Lux reporter was kindly provided
by Dr. J. Massagué,2 and the GFP-RelA construct was kindly provided by Dr. Rainer de
Martin.3 pRK-Myc-IKK-1 and pRK-Myc-IKK-2 were obtained from Tularik.4 The Rous
sarcoma virus (RSV) expression plasmids containing the p65 cDNA and IB- have
been previously described.5 The following primer pairs were used to generate His-tagged
IB- and its deletions. IB- (FL): 5’ primer:
(GAAGGATCCATTCCAGGCGGCCGAGCGCCCCCA) and 3’ primer:
(GAAGAATTCTGATAACGTCAGACGCTGGCCT); IB- (SRD): 5’ primer
(GAAGGATCCAGACGGGGACTCGTTCCTGCA) and 3’ primer:
(GAAGAATTCTGATAACGTCAGACGCTGGCCT); IB- (PEST): 5’ primer:
(GAAGGATCCATTCCAGGCGGCCGAGCGCCCCCA) and 3’ primer:
(GAAGAATTCTCACTGCTGTATCCGGGTGCTG); IB- (ankyrin): 5’ primer:
(GAAGGATCCAGACGGGGACTCGTTCCTGCA) and 3’ primer:
(GAAGAATTCTCACTGCTGTATCCGGGTGCTG); IB- (ankyrin): 5’ primer:
(GAAGGATCCATTCCAGGCGGCCGAGCGCCCCCA) and 3’ primer:
(GAATCTAGACTCGGTGAGCTGCTGCTTCCA) for the PCR of signal recognition
domain and 5' primer: (GAATCTAGAGGCCAGCTGACACTAGAAAACC) and 3’
primer: (GAATTCTGATAACGTCAGACGCTGGCCT) for PCR of PEST domain.
RSV-IB- was used as a template for the PCR reactions. The PCR products from all
the reactions except IB- (ankyrin) were digested with BamHI and EcoRI and cloned
directionally into pcDNA3.1 His (Invitrogen). For IB- (ankyrin) the signal
recognition domain PCR products were digested with BamHI and XbaI while the PEST
domain PCR product was digested with XbaI and EcoRI and ligated directionally into
BamHI and EcoRI digested pcDNA3.1 His (Invitrogen).
HA-Murr1 was subcloned from pCMV HA-Murr1 into pEBB, a mammalian
expression vector that utilizes the EF-1a promoter, and pVR1012, that utilizes a CMV
promoter. pMurr1-DsRed2 was cloned by insertion of Murr1 coding sequences into
the BglII and ApaI sites of pDsRed2-N1. Mutagenesis of pEBB-HA Murr1 was
performed using a Stratagene QuickchangeTM Site-Directed Mutagenesis kit, according to
the manufacturer’s directions. To introduce a stop codon to generate the Murr1 (1-80)
mutant the following primer was used: 5’GGCATTCTTGACTGCTCAAATCTAGATAAGCAAGGTGGGATCACA-3’.
Murr1 (1-160) was created using the following primer: 5’CAGGAATCTGAATTTCTGTCTAGAAATTTGATGAGGTCA-3’. Only the sense
strand sequence of the mutagenesis primers are shown. Plasmid HA-Murr1 mut-1 that
has a mutated siRNA Murr1-1 binding region was also made by site-directed mutagenesis
using the following primer: 5’- CTATTGCGTCTGCAGACATGGATTTC
AATCAATTAGAAGCTTTTCTCACTGCTCAAACCAAAAAGCAAGGTGG.
Murr1 siRNA duplexes siRNA Murr1-1 (5’-AACCAGCUGGAGGCAUUCUU
G- 3’), siRNA Murr1-2 (5’-AAGUCUAUUGCGUCUGCAGAC- 3’), siRNA Murr-1
mut-1 (5’-AACCAGUUAGAGGCAUUCCUG- 3’), control siRNAs, Lamin A/C, Cy3
Luciferase and GFP were manufactured by Dharmacon Inc.
Cells and transfections. 293 and 293T cells were cultured in DMEM
supplemented with 10% FBS and antibiotics (penicillin and streptomycin). Jurkat Tleukemia cells were cultured in RPMI with 10% FBS and antibiotics (penicillin and
streptomycin). 293 and 293T cells were transfected using calcium phosphate
(Invitrogen), and Jurkat cells were transfected using Superfect (Qiagen). 20 ng of the
reporter plasmids (HIV-LTR-Luc, HIV-LTR-B-Luc, B-luciferase) and 20 ng of
pEGFPN3 were used for all reporter experiments in 293 and 293T cells. For reporter
experiments in Jurkat cells 250 ng of reporter plasmid and 250 ng of pEGFP-N3
(Clontech) were used. pEGFP-N3 served as a control for transfection efficiency and the
efficiency of transfection was assessed by flow cytometry. TNF- (10-20 ng/mL)
(Peprotech), IL1- (10 ng/mL) (Peprotech) or PMA (10 ng/mL) (Sigma) and ionomycin
(0.5 M) (Sigma) were added to the cells 24 hrs after transfection. HepG2 cells were
transfected using LipofectAMINE reagents (Life Technologies, Inc.). Following
transfection, the medium was changed to EMEM with 10% FBS, and cells were
incubated for 16 h. The medium was then changed to EMEM + 0.2% FBS with or
without 5 ng/ml TGF-and allowed to incubate for another 24 h. Luciferase activity was
analyzed 24 hrs after stimulation by Luciferase Reporter Assay System (Promega).
siRNA duplexes along with other plasmids were transfected in 293T cells using
oligofectamine (Invitrogen) as described previously.6
Confocal microscopy. Cells were transfected as indicated in each experiment.
Images for Rel-GFP and MURR1-DsRed2 colocalization experiments were obtained with
a Zeiss Axiovert 100M confocal microscope.
Supplemental References
1. Baeuerle, P. A. & Baltimore, D. NF-kB: ten years after. Cell 87, 13-20 (1996).
2. Carcamo, J., Zentella, A. & Massague, J. Disruption of transforming growth factor
beta signaling by a mutation that prevents transphosphorylation within the receptor
complex. Mol. Cell Biol. 15, 1573-1581 (1995).
3. Schmid, J. A. et al. Dynamics of NF kappa B and Ikappa Balpha studied with green
fluorescent protein (GFP) fusion proteins. Investigation of GFP-p65 binding to DNa
by fluorescence resonance energy transfer. J. Biol. Chem. 275, 17035-17042
(2000).
4. Woronicz, J. D., Gao, X., Cao, Z., Rothe, M. & Goeddel, D. V. IB kinase-: NFB activation and complex formation with IB kinase- and NIK. Science 278,
866-870 (1997).
5. Duckett, C. S. et al. Dimerization of NF-KB2 with RelA(p65) regulates DNA
binding, transcriptional activation, and inhibition by an IB- (MAD-3). Mol. Cell.
Biol. 13, 1315-1322 (1993).
6. Elbashir, S. M. et al. Duplexes of 21-nucleotide RNAs mediate RNA interference in
cultured mammalian cells. Nature 411, 494-498 (2001).
Supplementary Figures
Supplementary Figure 1. Murr1 association with IB- but not IKK-1 or IKK-2.
a. Mapping the region of IB- and Murr1 interaction. Schematic representation
of His-tagged IB- deletions (top left panel) and HA-tagged Murr1 deletions (top right
panel); signal recognition domain (SRD) is shown in black, ankyrin repeats are shown in
red and PEST domain is shown in yellow (top left panel). To map IB- domains that
interacted with Murr1, 293 cells were transfected with HA-tagged Murr1 (top right panel)
and His-tagged derivatives of the indicated IB- expression vectors (top left panel) or a
His-tagged control vector as indicated. 24 hrs later cells were harvested in cell lysis
buffer and cell lysates were immunoprecipitated with agarose-conjugated antibody to His
(IB-) (lanes 9-14) and HA (Murr1) (lanes 15-20), fractionated by SDS-PAGE and
analyzed by immunoblotting with antibody to HA (Murr1; lanes 9-20, middle and lower
panel). To map the region of Murr1 that interacted with IB-, 293 cells were
transfected with His-tagged IB- (top left panel) and HA-tagged Murr1 (top right panel)
derivatives or an HA-tagged control vector as indicated. Cells were harvested 24 hrs
after transfection in cell lysis buffer, immunoprecipitated with agarose-conjugated
antibody to His (IB-) (lanes 21-28), fractionated by SDS-PAGE and analyzed by
immunoblotting with antibody to HA (Murr1; lanes 21-24) or His (IB-; lanes 25-28).
b. Co-localization of Murr1 and RelA. Murr1-dsRed and RelA-eGFP were
transfected into 293 cells plated onto coverglass chamber slides (0.5 µg each). After 2436 hrs, images were obtained with a Zeiss Axiovert 100M confocal microscope.
Supplementary Figure 2. Specificity of siRNA for Murr1.
293T cells were transfected with indicated siRNAs along with wild-type HAMurr1 or HA-Murr1 cDNA mutated at the binding site for Murr1-1 (Murr1-mut1)
siRNA. After 48 hrs, cell lysates were analyzed by immunoblotting with antibody to HA
(middle panel). Film images were digitized using a scanner and the bands were
quantified using Bio-Rad Quantity One software (top panel).