Genes
Day 4: 7.14C SWBAT recognize that inherited traits of individuals are governed
in the genetic material found in the genes within chromosomes in the nucleus.
BY using a Rubberband model to illustrate the levels of organization of
inheritance, answering question sets assessing genetic level of
organization, which includes the exit ticket.
Simple Sentence: DNA is made up of basic units called genes, which are the MOST
basic unit of inheritance..
Input
Output
Do 1st: What is important about
organization? (1 sentence) Where have you
seen organization in Science so far? (2
sentences)
Notes:
In our previous notes we learned how
traits-characteristics that you were born
with-are passed down from generation to
generation, from parent to offspring.
You also learned that traits can be
inherited-like natural eye color and blood
type, or acquired, like bigger muscles or
body weight.
Inherited traits are passed from
generation to generation through DNA,
which are located in the nucleus of a cell.
So guess what, we have more to add to our
levels of organization!!
What we know so far is that genetic
information is located inside of a nucleus,
so that genetic information is smaller than
a nucleus!
We know that bundles of DNA are inside
the nucleus. They are known as
chromosomes (X or Y shaped). If
someone had to unravel chromosomes, you
would have DNA!
X or Y = chromosomes
/
= DNA
__________________________________
__________________________________
__________________________________
__________________________________
What are the most basic units of life?
_________
List the levels of organization from the
most basic unit of life to the most complex
learned so far.
_____, __________, _________,
_________________, ________________.
Traits that can change because of your
environment are known as
______________ traits.
Traits that are passed down from
generation to generation are known as
____________ traits.
Give an example of an acquired trait.
_______________________________
Give an example of an inherited trait.
_______________________________
What two letter-like shapes do
chromosomes form? _______ and ______
If one were to split a chromosome in half,
what type of genetic material would you
have? _______
Genes
So we known that DNA are smaller than
chromosomes and chromosomes are
smaller than a nucleus. A nucleus is
smaller than a cell.
If one were to take a piece of DNA apart,
what type of genetic material would you
have? ________
So is there anything smaller than DNA?
YES!!! Sections of DNA are known as
genes! Genes are the most basic unit of
inheritance or heredity!
Define genes: ______________________
Define DNA: _______________________
__________________________________
So, our new levels of organization from
smallest to largest are:
Smallest: Gene, DNA, Chromosome,
Nucleus, Cell, Tissue, Organ, Organ
System, Organism: Largest
Simple Definitions:
Gene—the most basic unit of inheritance
DNA—genetic material made out of
protein that tells us what traits we inherit.
Chromosome—bundles of DNA (genetic
instructions) that are stored and X or Y
shaped. Chromosomes specify what type of
traits offspring will have..
Nucleus- Contains chromosomes and are
found in eukaryotic cells.
Chromosomes are made out of proteins, so
genes code for proteins. Genes are like a
translator for the DNA, so that the DNA
won’t be super long. The longer
chromosomes are the more likely it is to
make an error and develop a disease inside
the organism.
Chromosomes dictate what gender we are.
Remember, in reproduction, we receive one
set of chromosomes from our father and
one from our mother. If you were lucky to
receive and XX pair, you are female! If
you were lucky to receive and XY pair,
you are male!! Cool, huh?
Define a chromosome: ________________
___________________________________
Define a nucleus:
__________________________________
__________________________________
Re-write the levels of organization found in
eukaryotic organisms beginning with the
most basic unit of heredity and ending with
the most complex level of organization.
________, ________, ________________,
_______________, _______,
_____________, _____________,
__________________,
________________.
ATGGGAAGCCGAAGCTTTGGCTAG
The above series of letters are known as a
genetic sequence. Every 3 letters are
known as a codon. ATG means “to start.”
TAG means “to stop.” Underline these two
sequences in the above series.
<Critical Thinking>
Q1: What do you think the sequences are
made out of? (Hint-not letters!)
_____________
Q2: What do you think translates TAG to
mean, “to stop?” _______________
Can a mother donate a “Y” chromosome to
her offspring? Why or why not?
Genes
Exit Ticket: Genes
Score In Class:
_______ / 3
X = chromosome
1. The section of a chromosome that
controls inherited traits is called a:
a. nucleus
b. gene
c. variation
d. mutation
e. sex cell
---------------------------------------------------2. Which best represents the levels of
organization among these structures?
a. cell, nucleus, DNA, chromosome
b. nucleus, cell, gene, chromosome
c. gene, chromosome, nucleus, cell
d. cell, nucleus, chromosome, gene
---------------------------------------------------3. Which of the following BEST
describes the purpose of chromosomes in
the nucleus of a cell?
a. to store genetic instructions needed to
specify traits
b. to release energy by breaking down food
molecules
c. to describe how offspring’s acquired
traits would look like in the future.
d. to create offspring and continue the
species.
Homework:
1. Re –do exit ticket
2. Create a cartoon rubber band model and identify each genetic level of
organization and define it within your cartoon.
3. Below your cartoon , rewrite each genetic level of organization (NOT entire
level of organization) from basic to most complex.