Supplementary material.
Transcriptional organization and regulation of the Escherichia coli K30 group 1
capsule cluster.
Andrea Rahn and Chris Whitfield.
The following supplementary material describes:
a) the construction of plasmids used for mutation by allelic exchange.
b) plasmids used in complementation analyses.
c) plasmids containing fragments of the cps promoter region.
d) sequences and features of primers used for PCR amplification.
1. Suicide-delivery vector pWQ173. In pWQ173, the sacB gene of pKO3 (Link et al.,
1997) was replaced with a different counterselectable marker, pheS (a site-directed
mutant of the phenylalanine tRNA synthetase) (Kast and Henneke, 1991; Kast, 1994).
Unlike the wildtype PheS, the mutant derivative is promiscuous and allows the
incorporation of phenylalanine analogs, such as p-chloro-phenylalanine, into cellular
proteins, leading to cell death. To construct pWQ173, the site-directed mutant pheS was
PCR-amplified from pKSS (Kast, 1994) using primers SD1 and SD2. The 1 kb fragment
was digested with EcoRI and HindIII and ligated to the corresponding sites in pKK223-3
(Amersham Pharmacia Biotech, Inc., Baie d’Urfé, QC). The pheS gene, along with the
tac promoter, was removed from this plasmid using BamHI and HindIII and the ends
were made blunt using the Klenow fragment of DNA polymerase. This fragment was
then ligated to the 3.2 kb HincII fragment from pKO3, effectively replacing sacB.
2. lac::aphA-3 suicide vector, pWQ174. In order to use cps::lacZ fusions, the
chromosomal lacZ was first deleted from E. coli isolate B44. The lac operon was PCR-
amplified from the chromosome of E. coli strain W3100 using primers lacF and lacR.
The 7958 bp PCR fragment was digested with PstI and PinAI and the resulting 5839 bp
fragment was cloned into the vector pBAD24 (Guzman et al., 1995), previously cut with
PstI and XmaI. An internal 3281 bp fragment containing lacZ was removed from the
construct using PvuII and replaced with the kanamycin-resistance cassette (aphA-3) from
pYA3265 (Menard et al., 1993). The disrupted lacZ gene was then subcloned into
pMAK705 (Hamilton et al., 1989) using PstI and KpnI, creating the suicide plasmid,
pWQ174. The construct was used to transform E. coli isolate B44 and allelic exchange
was performed as described elsewhere (Hamilton et al., 1989), yielding strain CWG465.
E. coli CWG465 was used as the parent strain for many of the other knockout strains
described in this work.
3. wbaP::lacZ-aacC1 suicide vectors, pWQ175 and pWQ176. These vectors were
constructed using pWQ192, a plasmid derived from the shotgun cloning and sequencing
of the K30 cluster. Plasmid pWQ192 includes wbaP, together with ~1.5 kb of flanking
sequence. A 1152 bp ScaI/HindIII fragment was subcloned into the HincII/HindIII sites
of pMAK705. The lacZ-aacC1 fusion cassette from pAB2002 (Becker et al., 1995) was
digested with PstI and ligated into the PstI site within wbaP. This cassette contains a
promoterless lacZ, as well as a gentamicin resistance gene, aacC1, which facilitates
tracking of the insertion into the chromosome. Two versions of the suicide vector were
generated; one with the promoterless lacZ orientated in the direction of cps transcription
(pWQ175) and the other in the reverse direction (pWQ176). This allowed for the creation
of a wbaP::lacZ fusion strain (CWG466) as well as a strain with the cassette in the
reverse orientation on the chromosome (CWG467).
4. wzc::lacZ-aacC1 suicide vector, pWQ177. This construct was based on plasmid
pWQ196 (Drummelsmith and Whitfield, unpublished), which contains a 1.7 kb fragment
from within the wzc open reading frame. A 375 bp HincII fragment was removed from
within wzc and replaced with a SmaI-digested lacZ-aacC1 fusion cassette from pAB2002
(Becker et al., 1995), generating pWQ177. This vector was used to make a wzc::lacZaacC1 fusion strain, CWG468.
5. wzc::aadA suicide vector, pWQ180. This construct was made using the same
approach as the vector made for creating the wzc::lacZ fusion vector (pWQ177). Briefly,
a 375 bp HincII fragment was removed from pWQ196 and replaced with a polar
spectinomycin-resistance cassette (Fellay et al., 1987).
6. rcsB::aadA suicide vector, pWQ178. rcsB was amplified from the B44 chromosome
using primers RcsBF and RcsBR, which overlap the open reading frame start and stop
codons, respectively. The PCR product was digested with BamHI and HindIII and ligated
to the corresponding sites in pMAK705. Following digestion of this plasmid with PstI,
the ends were made blunt using T4 DNA polymerase, and then ligated to a SmaI-cut
spectinomycin-resistance cassette from pHP45Ω (Fellay et al., 1987). The mutated gene
was then removed from the vector as a PvuII fragment and finally ligated into the SmaI
site of pWQ173. The final construct was designated pWQ178.
7. galF::lacZ-aacC1 suicide vector, pWQ179. The galF gene was PCR-amplified from
the chromosome of strain B44 using the primers AR109 and AR110. The1026 bp
fragment was digested with BamHI and cloned into the BamHI site of pWQ173. A 264
bp internal portion of the gene was removed using EcoRV and replaced with the reporter
cassette from pAB2002 (Becker et al., 1995). This plasmid, termed pWQ179, was used to
make the galF::lacZ fusion strain CWG472.
8. pWQ181 - insertion of a polar cassette downstream of JUMPstart. The B44 cps
promoter region was PCR-amplified using primers GalF1 and JD99 yielding a 2.8 kb
product. Following digestion with PvuII, the 511 bp fragment carrying the JUMPstart
element plus flanking DNA was cleaned and ligated to pWQ173 digested with SmaI. The
resultant plasmid was digested with EcoRV, which cuts 82 bp downstream of the
JUMPstart element and 145 bp upstream of the first open reading frame of the K30 cps
cluster (orfX). The linearized plasmid was ligated to the SmaI-cut spectinomycinresistance cassette (Fellay et al., 1987).
9. rfaH::aadA knock-out vector, pWQ182. The rfaH gene was PCR-amplified from the
B44 chromosome using primers AR121 and AR122. The 500 bp product was digested
with BamHI and KpnI and ligated to the same sites in pWQ173. This plasmid was then
digested with SstII for insertion of the spectinomycin-resistance cassette (Fellay et al.,
1987) on a SmaI fragment within rfaH.
10. RcsB overexpression vector, pWQ190. A 662 bp PCR product containing rcsB was
amplified using primers RcsBF and RcsBR, digested with BamHI/HindIII and cloned into
the same sites in pMALc2x.
11. rfaH expression vector. pWQ191. The rfaH gene was amplified using primers
AR126 and AR127 and ligated into the EcoRI and XbaI sites of pBAD24, giving
pWQ191.
12. Cloned DNA fragments from the cps promoter region. Smaller fragments in
promoter-probe constructs were created by PCR-amplification from a pWQ189 template,
using the following primer sets: pWQ242 (primers AR113 and AR135); pWQ243
(AR137 and AR135); pWQ244 (AR137 and AR139); pWQ245 (AR137 and AR141);
pWQ246 (AR138 and AR135); pWQ247 (AR140 and AR139). The PCR products were
ligated to the SmaI site of pKK232-8 and confirmed using restriction analysis.
13. Sequence analyses. The upstream region of the B44 cps cluster was PCR amplified
using primers JD60 and AR110, as well as AR109 and JD98. PCR products of
approximately 5.8 kb and 3.9 kb were obtained and sequenced.
References:
Becker, A., Schmidt, M., Jager, W., and Puhler, A. (1995) New gentamycin-resistance
and lacZ promoter-probe cassettes suitable for insertion mutagenesis and generation of
transcriptional fusions. Gene 162: 37-39.
Fellay, R., Frey, J., and Krisch, H. (1987) Interposon mutagenesis of soil and water
bacteria: a family of DNA fragments designed for in vitro insertional mutagenesis of
gram-negative bacteria. Gene 52: 147-154.
Guzman, L.-M., Belin, D., Carson, M.J., and Beckwith, J. (1995) Tight regulation,
modulation, and high-level expression by vectors containing the arabinose PBAD promoter.
J. Bacteriol. 177: 4121-4130.
Hamilton, C.A., Aldea, M., Washburn, B.K., Babtizke, P., and Kushner, S.R. (1989) New
method of generating deletions and gene replacements in Escherichia coli. J. Bacteriol.
171: 4617-4622.
Kast, P. (1994) pKSS - A second-generation general purpose cloning vector for efficient
positive selection of recombinant clones. Gene 138: 109-114.
Kast, P., and Henneke, H. (1991) Amino acid substrate specificity of Escherichia coli
phenylalanyl-tRNA synthetase altered by distinct mutations. J. Mol. Biol. 222: 99-124.
Link, A.J., Phillips, D., and Church, G.M. (1997) Methods for generating precise
deletions and insertions in the genome of wild-type Escherichia coli: application to open
reading frame characterization. J. Bacteriol. 179: 6228-6237.
Menard, R., Sansonetti, P.J., and Parsot, C. (1993) Nonpolar mutagenesis of the ipa genes
defines IpaB, IpaC, and IpaD as effectors of Shigella flexneri entry into epithelial cells. J.
Bacteriol. 175: 5899-5906.
Primers used for PCR amplification and sequencing.
Restriction sites introduced to facilitate cloning are underlined. Lower case letters
indicate non-chromosomal sequence.
Primer
AR103
Sequence
AGCGGTTTGAGCTcAGTGGTG
Use/Features
amplification of stem-loop
structure, SstI site; pWQ184
construction.
AR104
TTTCCTCtagAATACGCGTCAA
amplification of stem-loop
structure, XbaI site;
pWQ184 construction.
AR109
TTGgAtCCAAACAGGTGAAGATG
galF amplification, BamHI
site; pWQ179 construction.
AR110
CCGgAtCCATACGTTTCTTACAATC
galF amplification, BamHI
site; pWQ179 construction.
AR113
GAAATGGAAttCACTGGAGCAC
amplification of cps
promoter region; forward
primer for pWQ242
construction.
AR121
GCGCCCgGATcCAACGGATAAG
rfaH amplification, BamHI
site; pWQ182 construction.
AR122
TTGCGGtACcCGGTGTTCTTCA
rfaH amplification, KpnI
site; pWQ182 construction.
AR126
CGGATAgaAtTCATTATGCAATCCTG
rfaH amplification, EcoRI
site; pWQ191 construction.
AR127
AAATGTCtAgACACTGTTTGGGATTG
rfaH amplification, XbaI
site; pWQ191 construction.
AR135
CAGCCGTTGAAGAGAAACCTC
amplification of cps
promoter region; reverse
primer for pWQ242,
pWQ243 and pWQ246
construction.
AR137
CTCCgAATTcTGACCGAAATT
amplification of cps
promoter region; forward
primer for pWQ243,
pWQ244, and pWQ245
construction.
AR138
TCAGGaAtTCAGTGCGCTGGT
amplification of cps
promoter region; forward
primer for pWQ246
construction.
AR139
ACCAGCGCACTGACTACCTG
amplification of cps
promoter region; reverse
primer for pWQ244 and
pWQ247 construction.
AR140
TAATGGCCTGACgAATTcTTC
amplification of cps
promoter region; forward
primer for pWQ247
construction.
AR141
TATCGACCTGTGGATGAATAATT
amplification of cps
promoter region; reverse
primer for pWQ245
construction.
GalF1
GGGCGATCTCTCCGAATACTC
amplification of galF-orfX
intergenic region.
JD60
TTACAACCGCCGTGAAGATG
amplification of promoter
region.
JD62A
CTATGAGACGGATGCGCTAATT
amplification of wzc internal
fragment; pWQ183
construction.
JD89
ACGGGCAATAACAGGAAAATA
amplification of wzc internal
fragment; pWQ183
construction.
JD98
GCGGAACCTGACCAAAAGAG
amplification of cps
promoter region.
JD99
GAAAGCAAGCCCAATGTCAC
amplification of galF-orfX
intergenic region; pWQ181
construction.
lacF
ACGCCCTGGTTAGTTCAACA
amplification of lac operon;
pWQ174 construction.
lacR
ACCCGCGGTCTAATGTTATT
amplification of lac operon;
pWQ174 construction
RcsBF
CCggaTcCATGAACAATATGAACGTAATTA
rcsB amplification, BamHI
TTGC
site; construction of
pWQ190 and pWQ178.
RcsBR
AGAaGcTTAGTCTTTATCTGCGGGACTTAA
rcsB amplification, HindIII
GG
site; construction of
pWQ190 and pWQ178.
SD1
GGAAttCCATGTCACATCTCGC
pheS cloning, EcoR1 site;
pWQ173 construction.
SD2
CATaaGCtTAACCACAGTTCAC
pheS cloning, HindIII site;
pWQ173 construction.