Supplementary Information:
Bacterial strains and growth conditions.
Escherichia coli XL1-blue (Stratagene) was used for routine bacterial cloning
procedures and grown in 2xYT medium containing 150 µg/ml spectinomycin, 50 µg/ml
kanamycin, or 150 μg/ml erythromycin when appropriate. Enterococcus faecalis strains
FA2-2 and OG1 were grown in brain heart infusion (BHI) supplemented with 500
µg/ml spectinomycin, 1000 µg/ml kanamycin, or 50 μg/ml erythromycin.
Cloning and DNA manipulations.
Enzymes and reagents were obtained from Promega (Madison, WI) or Life
Technologies (Rockwell, MD), and used according to the manufacturers instructions.
Platinum PCR SuperMix (Life Technologies, Rockwell, MD) was used for routine PCR
reactions. Primers were purchased from Integrated DNA Technologies (Coralville, IA).
Plasmid pXMA9AT16 contained most of the cytolysin gene cluster except for the
recently described cylI gene8. The missing fragment was amplified by PCR using
primers P1XhoI (TACCTCGAGAGTCTAGCTGGTTTCTTATCTC) and P2BamHI
(CGAGTTAAAAAATGATTGGATCCACGGGC), digested with XhoI and BamHI,
and ligated into the BamHI/SalI digested pXMA9AT vector. The resulting plasmid,
containing the entire cytolysin gene cluster, was termed pCGC. Mutations in cylLL or
cylLS were generated with the QuikChange site directed mutagenesis kit (Stratagene, La
Jolla, CA) using pCGC as a template. Primers cylLL-QCK-F
(GGGTAAGAATTATGGAAAATTAAAGTGTATAACCTAGTTTTGAAGAACT)
and cylLL-QCK-R
(AGTTCTTCAAAACTAGGTTATACACTTTAATTTTCCATAATTCTTACCC) were
designed to create premature stop-codons in cylLL, while primers cylLS-QCK-F
(AGTGAGGTGAAGCACAGTGTAAAATAAGTAAAATCAAGAAAAC) and cylLSQCK-R (GTTTTCTTGATTTTACTTATTTTACACTGTGCTTCACCTCACT)
generated stop-codons in cylLS. The two modified plasmids were designated pWH617
and pWH851, respectively. Strain FA2-2 (pWH705) was deficient for CylLL, nonhemolytic, and the source of CylLS” for Miller assays. Plasmid pWH705 was generated
by PinAI digestion of pCGC, treatment with Mung Bean Nuclease, and religation,
resulting in a frame-shift mutation in cylLL.
Transcriptional fusions to a promoter-less lacZ gene were made in the shuttle vector
pTCV-lac9. DNA was amplified by polymerase chain reaction which generated BamHI
and EcoRI restriction sites for cloning in front of the lacZ gene. The following PCR
primers were used: pLX100: CF493F-E (TTGAATTCCTCCTTTTTGTCAAG) and
CF614R-B (CCATAATTCTTAGGATCCATCATAAAATTGTTG), pLX110:
CFV1829R-E (AGAATTCGTTAGAAATGAAAGGC) and CF614R-B, pLX200:
CF493F-B (TTTGGATCCTCCTTTTTGTCAAG) and CF614R-E
(CCAGAATTCTTACCCTCCATCATA). A mutation in cylR1, pLX111, was generated
by partial PCR amplification of the cylR1 gene in pLX110. Primer pair CFV1829R-E
and ORF1-1072R-S (TTACTAGTTTTTTATTGGATATCATTTCTGTA) amplified
2
cylR2 and part of cylR1, while the two primers ORF1-1065F-S
(AAACTAGTTAGCCATTTTGGTTCCTCC) and lacZ79R
(GATTAAGTTGGGTAACGCC) amplified the remainder of cylR1, the PL promoter
and part of lacZ. The two PCR products were digested with SpeI, ligated, digested with
BamHI and EcoRI, and cloned into pTCV-lac. This procedure introduced not only a
SpeI site near the start codon of cylR1, but also a frame shift mutation and a stop codon.
A similar approach, using primers CFV1829R-E, ORF2-1395R-S
(AAATGATAATCAAACTAGTAAAATTAATTAGAGAG), ORF2-1376F-S
(TAACTAGTTGATTATCATTTATGAAGTCCTC) and lacZ79R, was used to
generate pLX112, containing a mutation in cylR2. Plasmid pLX113 was the result of a
spontaneous frame shift mutation in pLX111 that occurred in the cylR2 gene. All
transcriptional lacZ fusions and mutants were verified by DNA sequencing.
Reporter Gene Assay.
Βeta-galactosidase reporter gene expression was measured according to Miller23 with
modifications. E. faecalis FA2-2 cells containing transcriptional fusions to the lacZ
gene in pTCV-lac were grown in 25 ml BHI containing 1,000 μg/ml kanamycin and 50
μg/ml erythromycin. After 13 hours at 37C the cultures were divided into two 10 ml
aliquots A and B. Aliquot A was induced by adding 2.5 ml of sterile filtered culture
supernatant from an overnight culture of the CylLS” producing strain FA2-2 (pWH705).
Sterile culture supernatant (2.5 ml) from strain FA2-2 (pAT28) was added to aliquot B
as negative, uninduced, control. Cultures were incubated for 3 hours at 37C, washed in
2 ml Z-buffer (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4, 50
3
mM -mercaptoethanol) and resuspended in 1.8 ml Z-buffer. Cells were disrupted for
60 sec at 5000 RPM in the presence of 0.5 ml zirconia beads (0.1 mm diameter) in a
Mini-Beadbeater (Biospec Products, Bartlesville, OK). Five hundred μl of cleared cell
lysate, diluted 1:10 or 1:50 in Z-buffer when necessary, was incubated with 100 μl ONitrophenyl-B-D-Galactopyranoside (Amresco, Solon, Ohio) substrate (4 mg/ml ONPG
in 0.1M phosphate buffer, pH7.0). The reaction was stopped after 30 min at room
temperature by adding 250 μl of 1M Na2CO3. The OD405 of 200 μl sample was read in
a Thermomax microplate reader (Molecular Devices, Sunnyvale, CA). The protein
concentration of 10 μl cleared cell lysate was determined with 200 μl Coomassie Plus
Protein Assay Reagent (Pierce, Rockford, IL) according to the manufacturers
instructions. The OD405 per mg protein was multiplied by ten and designated Miller
units. Assays were repeated in four independent experiments.
RNA quantitation.
A culture of E. faecalis FA2-2 (pWH851) was grown to an OD562 of 0.5 and divided
into twelve 30 ml aliquots. Ten, 1, 0.1 or 0 ml of sterile filtered culture supernatant from
the CylLS” producing strain FA2-2 (pWH617) were added and the volume adjusted to
40 ml by adding the appropriate amount of FA2-2 (pAT28) sterile culture supernatant.
RNA was isolated24 after incubation for 1 hour at 37C and quantitated as follows:
Real-time quantitative PCR was used for transcriptional analysis of cylLS, cylLL, cylR1,
and cylR2. Amplification, detection, and analysis were performed using the ABI Prism
7700 Sequence Detection System (SDS) (PE Biosystems, Foster City, CA). For
4
detection of amplified product, the SYBR Green I dye chemistry (PE Biosystems) was
used. Specific primers for product amplification were designed based on the available
sequence data for pAD121. Primers were designed to produce amplicons of equivalent
length (100 base pairs).
For each experimental reaction, cDNA synthesis and PCR amplification were
performed separately on the SDS. Samples used in comparisons were normalized to
one another using amplified product derived from the 23S rRNA of E. faecalis as an
internal control, amplified in parallel. In each reverse transcription reaction, 10 ng was
used to generate cDNA with the appropriate specific reverse primer and the TaqMan
Reverse Transcription Reagents kit (PE Biosystems) according to the manufacturer's
recommendations without further modifications. Five microliters from each reaction
was used in subsequent PCR amplification with the appropriate forward and reverse
primers and the SYBR Green PCR Master Mix kit (PE Biosystems) according to the
manufacturer's recommendations. The following primer pairs (forward and reverse)
were used: cylLS: GTAAAATAAGTAAAATCAAGAAAACTATTACTC and
CAAAAGAAGGACCAACAAGTTCTAATT; cylLL: CTGTTGCGGCGACAGCT and
CCACCAACCCAGCCACAA; cylR2: CCAAAGTGAATTAGCTGCTTTATTAGAA
and TTAATGCTAACTGTAAAGAAGGGTTATATTTATT; cylR1:
TTTATTTTTTTATTGGATATCATTTCTGTAGTC and
TTCGCTCATCTTTTTTTGAATCAG; 23S rRNA: CCTATCGGCCTCGGCTTAG
and AGCGAAAGACAGGTGAGAATCC. Additional controls were provided for each
primer pair and each RNA sample by performing a cDNA synthesis reaction without
5
reverse transcriptase, followed by PCR amplification, to determine contamination of
RNA samples by residual genomic DNA.
The value used for comparison and quantitation among the samples was the threshold
cycle (CT) determined by the SDS based on the incorporation of the SYBR Green I dye
in the amplified product, subsequent fluorescence upon excitation, and normalization to
a passive reference dye (ROX) included in each reaction. The CT value is defined as the
cycle number at which the fluorescence exceeds a threshold identified by the SDS
software. The threshold is set in the exponential phase of the PCR amplification during
which there is a linear correlation between the log in the change of fluorescence and
cycle number. Thus, the higher the initial amount of specific template in each reaction,
the earlier accumulated product is detected by dye incorporation and fluorescence
emission, and the lower the CT value. For each product, CT values from the different
treatment groups were used to determine the levels of induction. Because each cycle of
difference represents a doubling during the linear phase of amplification, the amount of
induction relative to the sample with the lowest amount of template was calculated by
the formula y=2X, where x is the difference in CT values and y is the relative change in
gene expression. For each gene for which expression was investigated, real-time
quantitative PCR analysis was performed using three independent RNA preparations
from each of the treatment groups. Thus, expression data for each gene in each group is
presented as the mean and standard deviation calculated from three independent
amplifications with each primer pair.
6