PCR amplification, TA cloning, sequencing and sequence analysis of the carnation gene
CG12230 from Drosophila melanogaster
Ehsan Fadaei, MBB 308, (Thursday group 2C) Simon Fraser University, August 8, 2007
Abstract: The experiment utilizes the PCR method for amplification and isolation of
specific Drosophila Melanogaster gene sequence. The specific gene that is amplified by
the reverse and forward primers which codes for specific 500 base pair fragment and
isolated by the blue and white selection method, is then sequenced and analyzed by the
BigDye Terminator v1.1 Cycle Sequencing Kit (ABI) and ABI 3730 xl automated
sequencer. Cycle sequencing is similar to the Sanger chain termination method due to the
use of different fluorescently dyed chain terminators (ddNTPs) and it is important for
characterization of the specific Drosophila Melanogaster gene sequence which identified
the gene sequence as carnation gene. The carnation gene (CG12230) identified, is located
between the gamma-tubulin ring protein 84 (grip84) and Tao-1.
Introduction: PCR amplification method is the first step of isolating a specific
Drosophila Melanogaster gene sequence with the use of specific reverse and forward
primers that can amplify 500 base pair of the specific gene. The primer pairs have special
restriction site such as BamHI for the forward primer and EcoRI for the reverse primer,
which is served for the purpose of directional cloning of the amplified gene sequence into
the pBluescript (pBS) vector which also has the BamHI and EcoRI restriction sites. For
the ease and optimization of cloning the PCR product, the pGEM – T easy T-vector
cloning system was used instead. One of the advantages of T-vectors over the pBS
vectors is the fact that the T-vectors can accommodate PCR products that have the
unpaired 3’-Adenine overhang, since T-vectors contain 3’ terminal Thymidine at both
ends. The 3’ terminal Thymidines greatly improves the efficiency of ligation of PCR
products into plasmid by preventing re-circularization of the vector. The pGEM – T easy
vectors also have multiple restriction sites within the multiple cloning region that is
flanked by the recognition sites for EcoRI, BstZI and Not I, which can allow for the
release of insert with single restriction enzyme such as EcoRI (1).
In the experiment, Drosophila Melanogaster genomic DNA was re-quantified in
order to obtain the specific amount of template DNA (400 ng) for the PCR reaction. The
amount of DNA is vital to amplification of specific DNA sequences, since too much
DNA template produces higher concentration of related but undesired DNA sequence or
junk product, while small amount of DNA template may not produce optimal amount of
desired product. The protocol also includes two reactions, which are experimental
reaction and negative control. The purpose of the negative control which contains all of
the reagents used in the experimental control but lacks the DNA template, is to check for
any reagent contamination via gel electrophoresis, since no DNA should be produced.
Some of the advantages of PCR amplification are the fact that any amount of DNA
template can be used and thermostable Taq DNA polymerase allows for specific DNA
amplification, since higher temperature synthesis prevents the amplification of any nonspecific sequences.
After PCR amplification and gel electrophoresis that isolates the specific 500 base
pair sequence on the gel, the QIAquick Gel Extraction Kit which is a gel purification
method, is used to purify the PCR product. Some other methods of isolating DNA
fragment include the use of commercial kits to extract DNA and the electroelution
method which is based on the concept of using an electric field to move DNA out of a gel
slice that is in a dialysis bag (2). The QIAquick Gel Extraction Kit contains QG, PE and
EB buffers. QG buffer is used in the first step of QIAquick Spin purification procedure,
2
solubilizes agarose gel and provides optimal condition for binding of DNA to the silica
membrane. QG buffer contains guanidine thiocyanate and a pH indicator. The purpose of
the pH indicator is to determine if the pH is less than or greater than 7.5, since a pH of
less than 7.5 provides the optimal condition for efficient DNA adsorption to the
QIAquick membrane. Buffer PE contains ethanol and is used as a wash buffer in the
second, in order to wash away any salts and impurities from the silica membrane. EB
buffer contains 10mM Tris-Cl and provides pH of 8.5 for the elution of DNA off the QIA
membrane. In this experiment, ddH2O was used instead of the EB buffer for the elution
of the DNA.
To optimize intermolecular ligation of the PCR product into the pGEM – T Easy
vector, a 3:1 insert to vector molar ratio was used. The positive control reaction includes
a control insert DNA with a 1:1 insert to vector molar ratio. The positive control is used
to demonstrate that the experimental design is not flawed and confirms that the basic
conditions of the experiment were able to produce positive results (3).
JM109 competent cells are used as hosts for the ligation products. One of the
most important steps in the procedure for the transformation of the competent cells is the
heat shock step, which is the incubation of cells in a 42º C water bath for 45-50 second
period. Heat shock creates pores in the cell wall and allows the DNA to inoculate or get
into the cell. The SOC medium applied to the cells after heat shock and carried out before
the 90 minute incubation, ensures bacterial growth and allows for the cell to survive.
For blue / white selection method, the transformed cells are spread on to plates
containing Luria Broth (LB), ampicillin (amp), IPTG and X-Gal. Luria Broth is a
nutritionally rich medium used for bacterial growth on the plate. Ampicillin on the plate
3
selects against empty cells that don’t contain the T-vector, which has an ampicillin
resistant region. X-Gal is an enzyme that promotes lactose utilization and it is used in
conjunction with IPTG. Induction of lacZ gene with IPTG leads to hydrolysis of X-Gal
and development of blue colonies that don’t contain the insert. X-Gal is cleaved by βgalactosidase yielding galactose and 5-bromo-4-chloro-3-hydroxyindole which is
oxidized into into 5,5'-dibromo-4,4'-dichloro-indigo, an insoluble blue product (4). IPTG
is an inducer for β-galactosidase and doesn’t get cleaved by it, which allows for the
transcription of the lacZ gene.
Another method that can be incorporated into the protocol for the selection of
positive colonies that have the desired insert is the use of PCR. Since there are T3 and T7
primers on T-vector, PCR reaction can be carried out to isolate the recombinant DNA by
gel electrophoresis. Since empty T-vectors have smaller PCR products in terms of size,
they would run off the gel and thus the larger PCR products that contain the insert would
be isolated.
QIAprep Spin Miniprep protocol kit allows for the rapid purification of the DNA
from the positive colony cells by the use of microcentrifuge. The QIAprep Miniprep
system is designed for isolation of up to 20 µg high purity plasmid or cosmid for use in
routine molecular biology applications such as fluorescent and radioactive sequencing
and cloning. Some advantages to the QIAprep Miniprep system is that it eliminates time
consuming phenol–chloroform extraction and alcohol precipitation, as well as the
problems and inconvenience associated with loose resins and slurries (5). After DNA
purification, EcoRI restriction digest is applied on the plasmid DNA samples to ensure
quality and quantity of the plasmid prep and to make sure that the right clones is purified.
4
The EcoRI digest liberates the 500 base pair insert from pGEM – T Easy vector and its
size is confirmed by gel electrophoresis. One clone is chosen for cycle sequencing which
is based on the Sanger chain termination method.
BigDye Terminator v1.1 Cycle sequencing kit from Applied Biosystems (ABI)
applies similar concept of Sanger method sequencing, since both methods use chain
termination by labeled ddNTPs in order to sequence a specific DNA fragment. Sanger
enzymatic dideoxy sequencing is based on the enzymatic synthesis of complementary
strand that terminates at specific nucleotides and it uses DNA polymerase, primer and
dNTPs with small proportion of radioactively labeled ddNTPs in four different reaction
tubes. Since ddNTPs lack 3’ OH, it prevents strand extension at the 3’ end of the strand.
The reaction is then run on the acrylamide sequencing gel and its 5’ to 3’ sequence read
from bottom of gel upwards. The difference between the ABI automated sequencing and
Sanger sequencing is the fact that the automated sequencing requires less amount of
template (100ng or less) due to repeated rounds of synthesis and much larger DNA
fragments could also be sequenced due to the higher temperature used to reduce
secondary structures. Another advantage in sequencing with the ABI automated system is
that it uses four fluorescently labeled ddNTPs, which is safer than radioactive labels, and
thus its intensity is measured at four wavelengths of DNA products on gel (6).
Materials & methods:
PCR amplification: Nanodrop spectrophotometer is used to requantify Drosophila
melanogaster genomic DNA which shouldn’t be below 40 ng/µl, and the amount of DNA
added to the experimental reaction is 400 ng. Experimental reaction tube contains 2µl of
template genomic DNA (400 ng), 67.8µl ddH2O, 10µl 10X PCR buffer, 3µl MgCl2, 8µl
5
dNTPs, 4µl primer A, 4µl primer B and 1.2µl Taq DNA polymerase to give a 100µl
overall volume. Negative control tube contains all of the reagents in the experimental
tube except the DNA template and the PCR reaction proceeds as shown in the protocol.
Recovery of PCR fragments: After gel electrophoresis of the PCR products on a 1%
agarose-SYBR safe gel, the 500 base pair PCR products are purified by QIAquick Gel
Extraction kit and the standard protocol is followed. The elution step for the gel
purification uses 30µl of ddH2O to elute the desired DNA, instead of the EB elution
buffer which contains 10mM Tris Cl. After gel purification, concentration of the PCR
DNA product is measured by the Nanodrop spectrophotometer and the volume of 25ng
needed for the ligation reaction is calculated. Since the concentration of PCR product
measured was105.4 ng/µl, a 10X dilution is applied and only 2.37µl of the diluted PCR
product is used in the ligation sample. Thus, the ligation sample contains 5µl of 2X
ligation buffer, 1µl of pGEM-T Easy vector (50 ng), 2.37µl PCR product (25 ng), 1µl T4
DNA ligase and 1µl of ddH2O to give an overall volume of 10.37µl. The positive control
is similar to the ligation sample but contains 2µl of control insert instead of PCR product
and has an overall volume of 10µl. The sample is then incubated at 4ºC as shown in the
protocol.
Transformation of competent cells: The centrifugation of the ligation reaction is carried
out in the first step. Only one 1.5 ml tubes of pre-aliquotted JM109 competent cells
(50µl/tube) is placed on ice. 2µl of the ligation sample is put into the 1.5 ml tubes
containing the cells and incubated on ice for 20 minutes. After the heat shock procedure,
the incubation steps are followed from the PCR cloning protocol. Two plates containing
LB/amp/IPTG/X-Gal is prepared and 100µl of the transformed cells or 1/10th of the
6
ligation is spread on to sample one plate. The remaining transformed cells or 9/10th of the
ligation is spread on to the second plate. The incubation and inoculation steps are
followed from the protocol.
Plasmid miniprep, agarose gel analysis & automated sequencing prep: The four
overnight cultures from the sample plates are purified using the QIAprep Spin Miniprep
kit except the DNA elution step which uses 30µl buffer EB. The EcoRI restriction digest
step ensures the quality and quantity of the plasmid preps. Four tubes prepared for the
digest contain 5µl plasmid DNA, 2µl 10X React 3, 11µl ddH2O and 2.5µl of EcoRI for
an overall volume of 20.5µl/tube. The gel electrophoresis of the digested sample is
performed with 20.5µl of each four samples in lanes 2-5 with lane 6 containing the same
sample as in lane 5. The 1% SYBR safe agarose gel is run at 110V for 45 minutes. The
gel image is taken after electrophoresis to confirm the size of insert and the plasmid DNA
concentration of all the samples are measured by the Nanodrop spectrophotometer. One
of the clones is sent to Macrogen for automated sequencing. Macrogen uses the BigDye
Terminator v1.1 Cycle sequencing kit from the Applied Biosystems (ABI) and the
standard protocol for cycle sequencing is followed.
Results/ Discussions:
The PCR amplification of the specific Drosophila melanogaster gene sequence
produced no DNA product due to some errors in the preparation of the experimental
reaction sample before the PCR reaction. The negative control displays no band in the gel
image shown in fig. 1 which dismisses any contaminations regarding the reagents used in
the experimental reaction tube, since the negative control and the experimental reaction
sample both contain the same reagents. The problem may have arisen from the fact that
7
not enough Taq DNA polymerase was added to the experimental sample in order to get
sufficient PCR DNA product. Since only a miniscule volume of 1.2µl Taq DNA
polymerase (5U/µl) was needed in the experimental sample, improper pippeting to draw
and release the Taq DNA polymerase into the experimental sample accounts for a major
error in PCR amplifying the specific gene sequence.
Lanes:
1
2
3
4
5
6
7
8
Fig. 1. The gel image above contains 8 lanes. Lane 1 contains 10µl of 1kb DNA ladder.
Lane 2 contains 25µl of negative control sample which contains all the reagents used in
the experimental sample. The negative control shows no bands which indicates that
there was no reagent contamination. Lanes 4-8 contains the 25µl/well of the
experimental sample. The experimental sample contains 400 ng of DNA template, but
the gel shows no PCR product due to problems in the PCR procedure.
The purpose of applying gel electrophoresis on the PCR amplified gene sequence
is to confirm the size of the insert or the desired sequence that has been amplified. Gel
electrophoresis is also used to isolate the desired specific 500 base pair gene sequence
measured by the 1kb DNA ladder in the first lane and subsequently extracted by the
8
method of QIAquick gel extraction. Due to errors in the preparation of the experimental
sample that yielded no PCR DNA product, the amplified gene sequence of group 4C that
had been recovered from the agarose gel by the method of QIAquick gel extraction was
used for the ligation reaction.
The DNA concentration of group 4C gel extracted and purified PCR DNA
product determined by the Nanodrop spectrophotometer is 105.4ng/µl. For the
preparation of the ligation reaction, only 25ng of the purified PCR product is needed as
an insert and in order to optimize the intermolecular ligation between the insert and the
pGEM-T Easy vector. The insert to vector molar ratio of 3:1 provides the optimal
intermolecular ligation condition and thus the formula used for calculating the insert size,
( 50 ng vector x 0.5 kb inert x 3
3.0 kb vector
1
=
25ng insert
), proves why 25ng of the purified
PCR product is needed for the ligation reaction. Since only 0.237µl of the DNA product
yields 25ng DNA product (
25ng .
105.4ng/µl
=
0.237µl ), the sample was diluted 10x in
order to allow proper pippeting of the DNA product (2.37µl) into the ligation sample.
The method of heat shock and multiple incubation procedures at different
temperatures allowed for transformation of JM109 competent cells with the ligation
products. Only two sample plates were prepared for the blue/white selection of the
colonies, while the positive control sample was prepared independently (fig. 2). The two
sample plates contained different amount of transformed cells. The first sample plate
contained 1/10th of the ligation product and the second plate contained 9/10th of the
ligation product. An overnight incubation at 37ºC resulted in 12 positive (white) colonies
and 5 negative (blue) colonies for the first sample plate which gives a positive to negative
ratio of 2.4. The second sample plate displayed 76 positive (white) colonies and 13
9
negative (blue) colonies or a positive to negative ratio of 5.8. The positive control sample
plate which has the control insert DNA instead of the PCR product insert yielded 94
positives and 5 negatives to give an exact positive to negative ratio of 18.8 as shown in
figure 2. The positive control plate has a significantly higher positive to negative ratio,
since it shows the best case scenario of how many positive colonies could be obtained
under the same experimental design as the two experimental sample plates. The first
sample plate has lower ratio of white to blue colonies due to the fact that less transformed
cells (17 cells) were plated in comparison to the second plate (89 cells) and thus, it would
give a lower ratio of positive cells.
Panel A
Panel B
Fig. 2. Panel A shows the blue/white selection method applied to the culture medium of the positive control ligation
product. The positive control sample contains the control insert DNA and the pGEM-T Easy vector and it is used for
the purpose of determining if the experimental condition and design allows for a positive result. The positive control
produced 94 white positive colonies and 5 blue negative colonies which gives a white to blue ratio of 100:5. Panel B
displays the enhanced image with the inverted colors of panel A to clearly show the positive and negative colonies of
the positive control ligation.
10
The plasmid mini preps for the automated DNA cycle sequencing involved
purification procedures of the DNA from the four positive clone samples using the
QIAprep Spin Miniprep Kit. EcoRI digestion was used afterwards to liberate the 500 base
pair of the amplified DNA insert from the pGEM-T Easy vector. Then, the four samples
were run on the agarose gel @110V for 45 minutes. The fourth sample was divided for
two lanes (lanes 5 & 6) in order to check for any errors involving the fourth sample. The
results of gel electrophoresis, shown in figure 3, displays only two bands in lanes 5 and 6
and no bands in lanes 2-4. There are no bands in lanes 2-4 due to the fact that no P2
buffer (lysis buffer) was added to the first three positive clone samples during the DNA
purification by the QIAprep Spin Miniprep kit. P1 buffer, which is a re-suspension
buffer, was used twice by mistake for the first three samples and thus no lysis of the cells
occurred and no DNA was purified from the positive cells.
Both bands
are from
the same
sample
Fig. 3. The gel image displays 6 lanes. The first lane contains the 1kb DNA ladder
and lanes 2-6 contain four samples of positive clone plasmid DNA that are digested
with EcoRI restriction enzyme. Lanes 5 and 6 contain the same sample of positive
clone. Lanes 2-4 show no bands due to errors in the QIAprep Spin Miniprep protocol,
which is discussed further.
11
The fourth positive clone sample was prepared again with the use of P2 buffer for
the QIAprep Spin Miniprep protocol and was divided into two lanes which resulted in
two bands in each lane (fig 3). The plasmid DNA concentration of the four mini prep
samples was measured by the Nanodrop spectrophotometer. The plasmid DNA
concentration of the four samples is shown in table 1.
Mini prep samples:
Lanes on gel
Plasmid DNA concentration
Sample 1
2
20.4 ng/µl
Sample 2
3
6.9 ng/µl
Sample 3
4
46.2 ng/µl
Sample 4
5&6
181.7 ng/µl
Table. 1. The following table displays the plasmid DNA concentration of the four plasmid mini prep samples after
DNA purification by the QIAprep Spin Miniprep kit. Samples 1-3 have no P2 buffer input in DNA purification
procedure. Sample 4 has P2 buffer input in the DNA purification procedure and it is divided into two lanes for control
of any errors or contamination on the gel.
Further evidence that shows no input of P2 buffer during DNA purification is the
fact that the plasmid DNA concentration for the samples 1-3 were significantly lower
than the plasmid DNA concentration for sample 4 (table 1). Since the plasmid DNA
concentration for the three samples is less than 100ng/µl, it can not be detected by the
agarose gel electrophoresis. The size of the bands in lane 5 and 6 were estimated by the
1kb DNA ladder to be 1.6 kb.
Sample four was sent to Macrogen Co., which use the BigDye Terminator v1.1
from Applied Biosystems (ABI) for the cycle sequencing of the sample. Cycle
sequencing is based on the Sanger chain termination method, but it allows stronger signal
due to the repeated cycles of thermal denaturation, primer annealing and polymerization.
12
Thus the amount of product increases linearly with the number of cycles (7). The result of
the sample 4 sequencing is shown below:
>070716-01_A11_2C4-T7.ab1 1433 0 1433 ABI
GGGAAATAAGATCATCCAGCTCCGGCCGCCTGGCGGCCGCGGGAATTCGATTCAGGATCCATGTTCCCCCACTTGAAGGGCC
ATGGTCAGCGGGTCAACCTGCAGTTGCTGCAGGAGGCCGCCTGCCGCGAGCTGCTGCAGCAGCTGGACCGCATTGAGGGTTC
CAAGGTTATTGTGCTGGACGAGACCATGATCGGACCGCTGGACTTGGTTACCCGGCCAAAGTTATTCGCTGATCGAGGCATC
CGTCTGCTGGCCCTCAAGCCGGAGCTTCATTTGCCGCGCGAGGTGGCCAATGTGGTGTACGTGATGCGCCCACGCGTGGCGC
TGATGGAGCAGCTGGCCGCCCACGTGAAGGCAGGCGGAAGAGCGGCCGCTGGACGGCAGTACCACATCCTGTTCGCCCCGA
GGCGGTCATGTCTGTGCGTCAGCCAACTGGAGGTCAGCGGCGTGTTGGGCAGCTTCGGAAACATCGAGGAACTGGCCTGGAA
CTATCTGCCGCTGGATGTCGACCTGGTATCGATGGAGATGCCCAATGCCTTCCGCGATGTGAGTGTGGAAATTCGAAATCACT
AGTGAATTCGCGGCCGCCTGCAGGTCGACCATATGGGAGAGCTCCCAACGCGTTGGATGCATAGCTTGAGTATTCTATAGTG
TCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATAC
GAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGC
TTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGC
TCTTCCGCTTCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTATAC
GGTTATCCCCGAATCAGGGGATACGCAGAAAGACATGTGAGCAAAGGCAGCAAAGGCCAGAACGTAAAAAGGCGCGTTGC
GGCGTTTTCATAGCCTCGCCCCTGACAACTCCAAAAACGACCTCAGTCAAAGGGCGACCCGACGGATAAAAATACAGCGTCC
CCTGAAACCCTCTGCCTTCTGTCAACGGCGTACGAACAGCGCTTCTCTCGGAGGGGCTTCAACACCTGAGATCATGGTGGTGT
TCAGGGGGGGCACCCTTCCCCGCCTTCGATTTTTCCCAAACTCCTCCCCGNNNNNNGNGGNNNNNGGCCNNNNNNNNGCCCC
TNAATGTCAGGTCTCAAATTTCATTATAATCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGNNNNNNANNNNNNNNNN
Flybase Report Synopsis:
From the FlyBase web site, the above sequence contains 1433 bases and the gene is
identified as the D. Melanogaster Carnation gene (CG12230-RB) with its restriction map
identified in appendix A and the best sequencing scaffold match from the Blast search in
appendix B. Table 2 shows other information about the gene sequence identified by the
FlyBase (8).
Symbol:
Dmel\car
Species:
D. melanogaster
Name:
carnation
Annotation symbol:
CG12230
Feature type:
protein_coding_gene
FlyBase ID:
FBgn0000257
Created / Updated:
2003-12-01/2003-12-01
Table. 2. Information about the D. melanogaster carnation gene (Dmel\car) is shown above. The general information about
the gene was obtained from the FlyBase web site.
13
The gene carnation is referred to in FlyBase by the symbol car (CG12230,
FBgn0000257). It has the cytological map location 18D1. Its sequence location is
X:19460052..19463440. The FlyBase identifies its molecular function as: protein
binding; SNARE binding (9), (10). It is involved in the biological processes described
with 11 unique terms, many of which group under: localization; transport; cellular
physiological process; organelle organization and biogenesis; eye pigmentation; cellular
localization; establishment of protein localization; eye pigmentation (sensu
Endopterygota); endosome organization and biogenesis; exocytosis. The FlyBase has
identified eight alleles corresponding to the carnation gene with the there associated
phenotypes indicated in table 3.
Lethality
Allele
viable
car1, carEY09656
semi-lethal | recessive
carG0447
Other Phenotypes
wild-type
carGMR.PS
visible | recessive
car1, car2, car26-48
eye color defective
car1, car2, car26-48, carunspecified
Sterility
fertile
carEY09656
Phenotype manifest in
late endosome
car1
eye
car1
pigment cell
car1, car2, car26-48, carunspecified
Malpighian tubule
car1
larval brain
car1
Table. 3. The summary of seven allele phenotypes for D. melanogaster is shown in the table. The 8th allele known as
carΔ146 is associated with the loss of function class and it is part of the seven classical alleles. The allele, carGMR.PS is
carried on transgenic constructs.
14
Information regarding the location and the amino acid sequence of the carnation gene is
shown in appendix C and D respectively. The gene product and expression for the
transcript data is shown in table 4. The mRNA, car-RA (CG12230-RA) has 3086
nucleotides and strong support of evidence, while car-RB (CG12230-RB) mRNA has
3179 nucleotides and is moderately supported in terms of evidence.
Name
FlyBase ID
Length (nt)
Associated CDS(aa)
Car- RA
FBtr0074728
3086
617
Car-RB
FBtr0074727
3179
617
Table. 4. Transcript data of the carnation gene (CG12230) shown above from the FlyBase data, lists two types of mRNA
which are car-RA and car-RB.
Other transcriptional data of the car gene includes the two polypeptides which are carPA and car-PB. The polypeptide car-PA (CG12230-PA) corresponds to car-RA mRNA
and is about 617 amino acids long, while car-PB (CG12230-PB) corresponds to car-RB
and it is also 617 amino acids long (table 5). Although car-PA and car-PB are similar in
their physical property, they differ in protein sequence.
Name
FlyBase ID
Predicted MW
Length (aa)
Theoretical PI
GenBank Protein
Car- PA FBpp0074497
68767.0
617
6.74
AAF48972
Car- PB FBpp0074496
68767.0
617
6.74
AAN09503
Table. 5. The annotated polypeptides of the D. melanogaster carnation gene, car-PA and car-PB are similar in terms of
molecular weight, amino acid length and theoretical PI, but only differ in protein sequence.
The advantages of identifying the mRNA sequences of the D. melanogaster
carnation gene; car-RA and car-RB, is the fact that it can be used for northern analysis in
identifying gene expression in specific tissues of D. melanogaster. The mRNA sequences
15
can also reveal alternate RNA processing or it can be used to identify the effects of
specific gene mutants on transcripts or translation. Alteration of the carnation transcript
through northern analysis, can allow us to observe how the Sec1-like molecule will be
affected and in turn, how it will impact the eukaryotic vesicle transport processes and
neurotransmitter release by exocytosis. Sec-1 like molecules regulate vesicle transport by
binding to a t-SNARE from the syntaxin family. This process prevents SNARE complex
formation, which is a protein complex that is required for membrane fusion. Sec1
molecules are essential for neurotransmitter release and other secretory events, and their
interaction with syntaxin molecules seems to represent a negative regulatory step in
secretion (11) Therefore, non functional Sec 1 molecules can adversely affect the eye
color of D. melanogaster, since Sec-1 molecules regulate vesicle transport. This would
also prove that Carnation is a homolog of Sec1p-like regulators of membrane fusion (12).
Conversely, this provides evidence that eye color mutations of the granule group also
disrupt vesicular trafficking to lysosomes. Other information that would be useful in the
northern analysis is included in appendix E.
There is no perfect human homologue of the D. melanogaster carnation gene
(CG12230-RB) since there is no real homology between the carnation gene and any of
the human genes. Utilizing the NCBI Blastp search with the input of the amino acid
sequence of the carnation gene yielded the vacuolar protein sorting 33A [Homo sapiens]
as the highest match, with only a 43% identity match and an expected value of 8e-127 as
shown in appendix F (13). Since the expected (E) value is not zero, the vacuolar protein
sorting 33A is not the best homologue of the D. melanogaster carnation gene.
16
References:
1. pGEM-T and pGEM-T Easy Vector Systems. Product manual. No. 42. Promega
Corporation, 1998
2. McDonnell et. al. 1977. Electroelution into dialysis bags. J. Mol.Biol. 110:119
3. Sinclair, D. 2007. Recovery of PCR fragments from agarose gel. MBB 308 week 8
protocol. 8: 1-3
4. Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J.
Mol. Biol. 166: 557-580
5. Hilbert, H. 2000. Automated sample-preparation technologies in genome sequencing
projects. The Journal of DNA Sequencing and Mapping. 11:193-197
6. Sinclair, D. 2007. Initial characterization of a piece of cloned DNA. MBB 308 Lecture.
7: 17-29
7. Sinclair, D. 2007. Plasmid mini-preps on positives/restriction digests and agarose gel
analysis and preparation of templates for automated sequencing. MBB 308 week
10 protocol. 10: 1-2
8. FlyBase Gene report: Gene Dmel\car. FlyBase.org. 7, August, 2007.
< http://www.flybase.org/reports/FBgn0000257.html >
9. Littleton, J.T. 2000. A genomic analysis of membrane trafficking and neurotransmitter
release in Drosophila. J. Cell Biol. 150: 77-81
10. Sevrioukov, E.A. et. al. 1999. A role for the deep orange and carnation eye color
genes in lysosomal delivery in Drosophila. Molec. Cell. 4: 479-486.
11. Bracher A. et. al. 2000. The X-ray crystal structure of neuronal Sec1 from squid sheds
new light on the role of this protein in exocytosis. Structure. 8: 685-694
17
12. Sunio A. et. al.1999. A role for the deep orange and carnation eye color genes in
lysosomal delivery in Drosophila. Mol. Cell. 4: 479-486
13. Altschul, Stephen F. et. al. 1997. Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs. Nucleic Acids Res. 25:33893402.
18