Supplementary Method 2. Amplification conditions for array-MAPH probes
and target sequences.
a) Amplification of array-MAPH probe sequences from normal 46,XY source of
genomic DNA.
All amplifications were performed using 50ng of human genomic DNA from
cytogenetically controlled individual. Reaction volume was 20μl with 1.5mM MgCl 2,
10pmoles of each primer, 0.25mM of each dNTP and 1.5 U Taq DNA-Polymerase.
Thermocycling was 94oC for 5 minutes, followed by 25 cycles of denaturing at 94oC
for 1 minute, annealing at 67oC for 1 minute and extension at 72oC for 1 minute.
Following the recommendations of TOPO TA cloning protocol, a final 72oC 30minute extension step was added to ensure cloning efficiency. Amplification
efficiency, specificity and PCR product size were confirmed by 2% agarose gel
electrophoresis with the 100bp DNA ladder (New England Biolabs, Ipswich, MA,
USA).
b) Amplification of array-MAPH amplifiable probes from cloned glycerol stocks,
using the cloning vector universal primer set PZA and PZB.
Vector pCR2.1 specific primer sequences. The PZA/PZB and the UNI3/UNI5 are
sequences flanking the pCR2.1 vector cloning site.
Sequence 5’
Primer name
PZA
AGTAACGGCCGCCAGTGTGCTG
PZB
CGAGCGGCCGCCAGTGTGATG
UNI3
GAATTCGCCCTT
UNI5
GATATCTGCAGAATTCGCCCT
3’
Amplifications were carried-out using 0.5μl E.coli glycerol culture as template, in a
volume of 20μl, with 1.5mM MgCl2, 10pmoles of PZA and 10pmoles of PZB primers,
0.25mM each dNTP and 1U Taq DNA Polymerase. Thermocycling was 94oC for 10
minutes followed by 25 cycles of denaturing at 94oC for 1 minute, annealing at 60oC
for 1 minute and extension at 72oC for 1 minute. All amplified sequences were
confirmed for their expected size, amplification efficiency and specificity by 2%
agarose gel electrophoresis.
c) Amplification of array-MAPH target sequences from cloned glycerol stocks.
Each one of the cloned probes was amplified twice from the glycerol culture of the
selected and verified clones, using the probe specific primers. PCR reaction was
performed in a volume of 50μl, using 0.5 μl of E.coli glycerol culture as template, 1.5
mM MgCl2, 0.25mM each dNTP, 10pmoles of each primer and 1.5U Taq DNA
Polymerase. Thermocycling was 94oC for 10 minutes, followed by 30 cycles of
denaturing at 94oC for 1 minute, annealing at 67oC for 1 minute and extension at 72oC
for 1 minute. Amplified sequences were purified and concentrated by ethanol
precipitation. Individual concentrations were estimated by electrophoresis on 1.5%
agarose gel using Low Range DNA Mass Ruler (MBI Fermentas, Vilnius, Lithuania)
and Image ProPlus software (Media Cybernetics, Silver Spring, MD, USA).