Jillian Burrows
Dr. Joshua Smith
BMS 110
10 October 2008
Cloning of Saccharomyces RAD23 Homolog Gene in Tetrahymena
Jillian Burrows & Meghan Perry – Fall Semester 2008
Abstract
The RAD23 gene is thought to be useful in the damage recognition step or
nucleotide excision repair (NER), though the exact function is not clear. The purpose of
NER is to remove lesions from the DNA.1 Through the labs, we are trying to isolate and
clone our RAD23 homolog genes from the Tetrahymena in order to study them. In the
lab, we separated our target gene and duplicated it through the use of polymerase chain
reactions (PCR). Once this was done, it was then stored in a plasmid, which is a circular
piece of DNA. Ultimately, this will allow scientists in the future to use this gene for
future research in order to better understand its purpose. Possible future implications
regarding the studying of the RAD23 gene could involve its role in cancer research and
treatment, and could also involve its role in stabilizing the XPC protein.
Introduction
PCR is a method that is used in order to amplify and make numerous copies of
our target gene, the RAD23 Tetrahymena homolog. There are four steps to the PCR
process, the first of which is the denaturation of the DNA. During the denaturation stage,
the DNA separates. Next comes the annealing of the primer to the DNA. This annealing
must occur at a certain temperature in order to work properly. After the annealing stage,
the DNA is extended or synthesized. Finally, this cycle is repeated as many times as
necessary, which in our case was 34 times. This gave us numerous copies of our RAD23
gene for lab use. Though the exact function of RAD23 is not known, it is thought to be
involved in nucleotide excision repair and in stabilizing the XPC gene. NER is important
to the cell because it is a process that removes lesions from DNA that may be caused by
the environment.1 This repair of the DNA is essential for the survival of the cell because
it protects the integrity of the genomic DNA.2 Without the ability to remove these
lesions, this increases the cell’s susceptibility to mutations.1 Such mutations could prove
to be as serious as producing cancerous cells. Our intent with these labs is to use PCR in
order to isolate and duplicate our genes. This will be done for the purpose of using this
gene in order to conduct future research.
Methods & Procedures
Bioinformatics
This lab marked the beginning of our work in cloning the Tetrahymena gene. The
purpose of this lab was to find a homolog of our Saccharomyces RAD23 gene in the
Tetrahymena in order to use this for our research. We used the website
http://www.ncbi.nlm.nih.gov/ to search for the human protein, and then used
http://www.ciliate.org to search for the Tetrahymena homolog in order to find all of this
information. First, we found the amino acid sequence of our protein. Once we found the
sequence of our protein, we used this in order to conclude whether or not there was a
homolog in the Tetrahymena. We then found the protein sequence of this homolog.
From here on, all the information obtained had to do with the homolog in the
Tetrahymena. Next, we gathered the nucleotide sequence of our homolog. And lastly,
we compared our original protein sequence to that of our homolog to see how they match
up. (See complete procedure in BMS 110 Honors Lab 3: Bioinformatics, Fall 2008)
Genomic DNA Isolation
The goal of this lab was to isolate the genomic DNA in the Tetrahymena in order
to use as a template later on in lab. First, we pipetted about 1.4 microliters of the culture
from the Tetrahymena to a tube in order to centrifuge them. We spun them for one
minute and then removed the excess liquid. Next, a urea lysis buffer was mixed in with
the culture. After mixing in the lysis buffer, we also added phenol:chloroform to the
solution and centrifuged this for five minutes at maximum speed. Once this was
completed, we removed the aqueous layer with a pipet and put it into a new tube. The
previous step was then repeated. Both of these steps were done in order to extract the
majority of the proteins out of the sample. We then added 150 microliters of 5M NaCl.
This helped to remove the carbohydrates from the solution. Isopropyl alcohol was then
added to the tube and the tube was inverted ten times and left to sit for ten minutes at
room temperature. A precipitate, a pellet, was then formed in the tube after we
centrifuged it for ten minutes at maximum speed. We then poured the excess liquid off
and added 500 microliters of 70% ethanol to the tube and centrifuged it again for only
three minutes. The ethanol was added to remove the salts from the DNA pellet. Once
the salt was removed and discarded from the tube, the pellet was allowed to dry. To the
pellet, 50 microliters of Tris-EDTA buffer was then added and left to sit for a few
minutes. The pellet was then suspended in the solution and left to sit on ice. One
microliter of RNase A was added and the tube was then left to incubate at 37º C for 10
minutes. What is left in this tube is our genomic DNA, which will be used later
throughout the labs. Once we had our DNA, we had to quantify it. We used an A260 and
an A280 reading from a spectrophotometer in order to find out the concentration of our
DNA. After we got these, we used to ratio of the two in order to figure out the purity of
our DNA. (See complete procedure in BMS 110 Honors Lab 4: Genomic DNA Isolation,
Fall Semester 2008.)
Polymerase Chain Reaction
This step was where we actually began setting up the PCR reactions. On the steps
that involved using cDNA, we did not actually use the cDNA. We instead replaced both
of these with another pair of genomic DNA. First, we determined the annealing
temperature that we were going to use for the separate reactions. To get these, we used
the help of the Oligonucleotide Specification Sheets. The annealing temperature we used
for the first reaction was an arithmetic mean of the temperatures given for the RAD23-TF
and the RAD23-TR, which turned out to be 56.25º C. The next two reaction temperatures
were those of the RAD23-TF and RAD23-TR, respectively. These were 58.6º C and 53.9º
C. Our annealing temperature for the last reaction was a set temperature of 50.0º C.
Once we determined these temperatures, we made the master mix to use in the reactions,
see Pre-Lab 5 (BMS 110 Honors Pre-Lab 5, Fall 2008). We figured out the amounts to
include in the master mix by taking our original calculations and multiplying them by
three. After completing the master mix, we split this up into four separate
microcentrifuge tubes, putting 50 microliters into each tube. We then put these tubes in
the thermocycler in order to denature and run through the 34 cycles needed to prepare
them. (See complete procedure in BMS 110 Honors Lab 5: Polymerase Chain Reaction,
Fall 2008).
Agarose Gel Electophoresis
At the beginning of this lab, we were provided with a gel in a stand, which had
already been set. We removed the ends from the gel. Then, we put enough of the 1xTAE
electrophoresis buffer in the stand to barely cover the gel. Once this was done, we
removed the comb. We were provided the 1 microliter portions of the sample dye before
the lab. Before loading each solution into the well, we mixed it with one of these dots of
the dye so it would show up in the gel. As the finishing step for our gel, we hooked it up
to a power supply and set it between 90V and 100V to run for an hour and fifteen
minutes. We then took two pictures of our gels. These pictures will be shown in the
results section of the paper. (See complete procedure in BMS 110 Honors Lab 6:
Agarose Gel Electrophoresis, Fall Semester 2008)
TOPO Cloning and E. coli Transformation
Next, into a microcentrifuge tube, we put one microliter of our PCR product, one
microliter of salt solution, three microliters of sterile water, and one microliter of the
TOPO vector. We mixed this by pipetting up and down gently. Then, we allowed the
tube to sit at room temperature for 10 minutes. During the time that the tube was sitting,
we were provided with a vial of E. coli and this was allowed to thaw on ice for about five
minutes. From the TOPO cloning reaction that we mixed, we took two microliters and
added it to the vial of E. coli and gently mixed this by stirring it with the tip of the pipet,
not by pipetting up and down. Once this was done, we allowed the mixture to sit on ice
for 10 minutes. Next, we heat-shocked the vial at 42º C in a water bath for 30 seconds,
then immediately put the vial back on ice. We then added 250 microliters of the SOC
Medium, which had been sitting at room temperature. Then, we put the cap tightly on the
tub and placed it in a shaking incubator. While in the shaking incubator, the tube was
horizontal. The incubator was set for 200 rotations per minute and made to be 37º C. We
left the vial in the shaking incubator for 50 minutes. During the shaking, we were given
two circular plates to place the sample in. Once we retrieved the sample, 200 microliters
went into one plate, and the leftover sample was placed in the other. We used roughly
25-30 glass beads to spread the sample around the plate. This was done by shaking it for
one minute. The plates were then placed in an incubator to sit overnight at 37º C. The
next day, we examined our samples to see how many colonies had formed in comparison
to the negative sample, which contained none of the PCR component. (See complete
procedure in BMS 110 Honors Lab 7: TOPO Cloning and E. Coli Transformation, Fall
Semester 2008)
Plasmid Construct Map
During this lab, we used a gene construction kit in order to form a plasmid
construct map. This map will help give other researchers knowledge of what is contained
in our plasmid. First, we entered the pENTR/TOPO-D sequence from our previous lab
and entered it into the program for our plasmid in order to create a circular plasmid.
Next, we identified where our gene was going to be inserted into this plasmid, which was
where the sequence was blue and read “CACC,” which matches the first 4 nucleotides of
our gene sequence. We highlighted the “CACC” nucleotides and inserted our
Tetrahymena gene sequence in its place. Then we highlighted “junction marker” and hit
delete. We then changed the color of our Tetrahymena gene sequence to green. After
that, we marked all our introns in the sequence by changing them to black. We used a
tool in the program to help us search for our introns on the sequence. Then, we adjusted
the width of the line representing our gene by choosing the widest line. We then saved
our plasmid. The next step was to determine our restriction enzyme. We marked the
sites of all the enzymes that were contained in our restriction enzyme handout and saved
our plasmid again. Our restriction enzyme was NheI. We then placed our bands into a
gel and changed the size of our gel to 500 base pairs and then saved the gel once again.
Finally, we placed our gel into a table and saved it. (See complete procedure in BMS 110
Honors Lab 8: Plasmid Construct Map, Fall Semester 2008)
Plasmid Isolation and Restriction Digest
This lab was used in order to determine whether or not the colonies that grew on
our plate contained the plasmid which contains our PCR product. The day before lab, we
grew our bacteria. First, we placed 6 mL of LB containing 50 μg/mL of Kanamycin in a
glass test tube. We did this for each colony that we wanted to purify the plasmid. On a
plate, we made a grid to place our colonies on and labeled it. Using a wooden stick, we
picked up the colony from the colony transformation plate and put it onto the
corresponding spot on the grid. The remaining material on the stick was then mixed in
the liquid LB/KAN test tube, and the stick was thrown away. This was done for each
colony placed on the plate. Once all this was done, the test tubes was placed in a 37°
shaking incubator set at 200 rpm in order to grow overnight. The next step was to purify
the plasmid. We labeled 18 tubes, 3 tubes for each plasmid we wanted to purify. The
tubes were labeled 1A, 1B, 1C, 2A, 2B, 2C, etc., all the way through 6C. Each “A”
microcentrifuge tube was filled with culture, each tube matching cultures 1-6. We spun
each of the “A” tubes in the centrifuge for 3 minutes at maximum speed, which formed a
pellet. Then we added 250 microliters of Buffer P1 and resuspended the pellet by
pipetting up and down. All of the “A” tubes were then transferred to the “B” tubes,
resuspended the pellets once again, and transferred all of the cultures to the “C” tubes.
Then, 250 microliters of Buffer P2 was added to all of the “C” tubes. We then inverted
the tubes until the solution turned completely blue and no white precipitate was present.
Next, 350 microliters of Buffer N3 was added and the tubes were inverted again. The
solution then turned clear. We kept inverting the tubes until the solution turned
completely clear. The cultures were then spun in the centrifuge for 10 minutes. The
supernatant from this spin was the applied to the QIAprep spin column and centrifuged
for 1 minute at maximum speed. Once finished, the flow-through was discarded. 500
microliters of Buffer PB was added to the column and centrifuged for another minute, the
flow-through once again being discarded. Next, 750 microliters of Buffer PE was added
to the column and spun for another minute, discarding the flow-through once finished.
The tubes were spun once again for another minute to remove any residual buffer. The
columns were place din 1.5 mL tubes. Now the columns were eluted by adding 50
microliters of an Elution Buffer and left to sit for 2 minutes, then to be centrifuged for a
minute at maximum speed. Once this was finished, the column was discarded. It was
then stored at -20° C. We next used the restriction enzyme that we chose from the
plasmid map, NheI, and determined the buffer that went along with it using the handouts
provided to us. We also determined whether or not our reaction required BSA. Ours
required Buffer 2 and we did need BSA. We then made a cocktail to divide evenly
among 7 microcentrifuge tubes, 18 microliters per tube. We labeled these accordingly
with our plasmid numbers. To each tube, we added 2 microliters of each plasmid to the
appropriate matching tube. Then we incubated the tubes at 37° C, which we did
according to the handout (BMS 110 Honors Restriction Enzyme Digest, Fall Semester
2008). (See complete procedure in BMS 110 Honors Lab 9: Plasmid Isolation and
Restriction Digest, Fall Semester 2008)
Results
Through the Bioinformatics, we found that there was a Tetrahymena
homolog for the RAD23 gene (Figure 1). This gave us the sequence of the homolog and
also the sequence of the primers, which helped us later on. When we quantified our
genomic DNA, many results were produced. We recorded the A260 and A280 numbers for
each of these (Table 1). The “A” stands for absorbance, while the subscript indicates the
wavelength of light. In our calculations, we used Dr. Smith’s A260 and A280 numbers.
We then calculated the concentration of our DNA, and then we figured the purity
(Calculation 1). We made a 1:100 dilution of our DNA and a 1:200 dilution. The
genomic DNA that we isolated was then used as a template to set up our PCR. The PCR
amplified and duplicated our genes so we could use them. We then ran the PCR
reactions in a 1% agarose gel (Figure 2). The gel allowed us to visually see our PCR
product. We used the reaction in the first lane as our sample. The RAD23 homolog gene
has 2020 base pairs, which is shown in the gel. We also determined that our band had an
intensity of four, which we used in calculations. Then we made our plates and counted
the number of colonies. Our 200 microliter plate contained 65 colonies while our “rest”
plate had 1. This may be compared to the negative control which was 16 colonies on the
200 microliter plate and 2 on the “rest” plate. Once this was completed, we made a
plasmid construct map (Figure 3). This plasmid is where we placed our gene in order to
store it there. We used this map to determine our restriction enzyme, which was NheI.
According to our NheI gel (Figure 4), we should have seen bands at 3558, 772, and 266.
When we ran our final gel (Figure 5), this did not happen. Since we did not have bands
in the appropriate spots, we established that our gene did not get inserted into the
plasmid.
T.t. RAD23 Genomic = 2020 bp or cDNA = 1195 bp
CACCGTCGAGAAGATCAACATTAAGACTTTAAAGGGCACTGATTTTTTTGATGTTAACC
TTGAAGAAACTGCTACAGTAAATTTATTAAAATGTTTTGTTTTAGGAGAGCTCGAATTC
TTGTTGACATTTTAAGAATTAGCTAGATAAATACTTGTTTTCAACATATTTTATAATCT
TGTTAGGTTGCTGAATTGAAGGAGAAGATTGCTACTGAAAAGTAAAAGGAAAAAGATAC
TATTAAGTTAGTTCATAAAGGTAAATAATTGACCGAAGACTCTAAGACTCTTGGCGAAC
TTGGTATTAAAGATAATGATTTTGTTATTCTCATGTTCTTTTAAAAGGTAATATTATCT
TAGTTTTAAGATTTCTTCAAAATGCGGCTATCTATTTATTTCTCTTTCTATGTGTGCTT
TCTTTTAATCATGATTAAATTAGAAAAATTCTTCAAAAAATGAAGTAAAATCAATATTT
TCTTTGTCGAATTGTACACAATTTAATGTGACATGACACTGAAATCATCTTAGTGACTG
TTAAGCATTTTAATAGATGAATAATAGATAAAGTAGCATAGAAAGCAGAGAAAATTTTA
TGGCTAGCATTTAATGAAAGAAAGAAAGAAAGAATGAAATTGCAATTATAATTTAAAAA
ATAATAAACTAAATATAACATTATTATAGAAAGCAGAAAAAGAAGATGCTCCATAATAA
GCTTAATCTGATACCACTTCTACTACCTCCGCTGCCTCAACAACTGCTACTAACCCCAC
TACTGTTCCTAAGCCTGCTGTTTCCTAACCCGCTACAACATAATAAACAGGAAGTTAAG
GAACAGGTAGTGATCTCCTTTAAGGTCCTGAATTGGAAGCCAAAATTAAAGAAATTGAA
TCAATGGGTTTTGAAAGACCTAAGGTTCTTTAAGCTTTGAAGGCCGCTTATTACAATCC
TGAAAGAGCAGTTGATTATTTACTCAGTGGTAATATTCCTAAAGAACCTAGTTAATAAT
AGAGTCCTTTACAAGGCTTACAAGGTCCTGGTGTTGAATAATTAGCTTAATTAGCTTAA
AATCCTCAATTCCAACACATTGCTTAAGCTATTCGTTAAAACCCTGCTCTTCTCCAACC
TGTCATGTAATAATTAGCTTAAACTAACCCTGATGTTGCCAGACTTTTACAATAAAACC
CTCAAGCTTTCTTGCAACTCCTCCTTGCTGCCTCTGAAAACGAAGGTGGATAAAGTAAT
AATTTTAAATTGTTAATTTTTCATGGACTTTAAATGCTAAAATAATTGACAAAAGAAAG
TCTTTTACTTTTCCATTAAAGACAAAAAGAATATAAATTCTTGTATCTGTCTTTCTTTC
TTTCTATCTATTTATCTTTCTATTGATTGATTTAAATAATCTGATCTGATTAAAGAAAA
TAGAAAAGAGCAGAATTGATTAGTTAGCATATCTTCTTCGTTTTTCTATTTATTTTTTA
ATAAAAATTAATCTTTAAAATTAATTAGCCTTACCTCCAAATGCCATCCAAGTCACTCC
TGAAGAAAAAGCTGATATTGATGACATTATTTCTATGGGTTTTGATAAAAATGACGCCT
TAGAAGCATATATTACCTGCGACAAGAACAAAGAATTAGCAATTAACTATCTTTTCGAA
GCAAGGGAAAGCGGTACTCTTCTTTGTAAGAAATATTAACTTTTTTTTTTTTAATTCAA
GAAAGCAAGCAAGTTTAAAAAAGCAATTGTGTATATAAATAAATCATTAAATTAAAATA
AGAAATAGTTGAAAAAAAAGATATTCATTCATCCATTCACATAGTAAATATTCTAAATA
AATTTTTATTTAATTAAATAGCTGAACACATCCAAAAGGAAGAATTAGAAGCTGCATAA
TAATAATCATAAAACTAAAATTAATAACAATAAGGTAATAACCCAAATCAATAATAATA
ATAAGGTGGATAAGGTGAAGGTGGTGATAATGATGATGAAGATGACGATGATTTTATGT
ATTAATGACCTAGG
Figure 1: This indicates our genomic DNA sequence of the Tetrahymena RAD23.
There are three colors in our
sequence. The red represents the bases that are still present in the mature RNA of our gene. The black signifies the
introns that were removed in order to produce the mature RNA. The yellow corresponds to the primers that were used
during the PCR in order to amplify our gene.
1:100 Dilution
1:200 Dilution
Dr. Smith’s
Calculations (1:100)
A260
1.313
1.304
1.695
A280
0.671
0.639
0.829
Table 1: These numbers indicate the A260 and A280 numbers for each of the different dilutions of the genomic
DNA.
[DNA] = 50 x 1.695 (A260) x 100 = 8.475
1000 μL/mL
Purity of DNA = 1.695 (A260) = 2.04
0.829 (A280)
Calculation 1: These calculations show the concentration and purity of our DNA.
Kb
1
2
3
4
2000 bp
1000 bp
Figure 2:
This figure shows a 1% agarose gel of our samples. The purpose of this is to show the size of our
PCR product. Each line on the kb ladder represents 1000 base pair increments. The wells are as follows from left to
right: 1kb ladder, our first reaction at 56.25° C, the second reaction at 58.6° C, our third reaction at 53.9° C, and the last
reaction at 50.0 ° C (BMS 110 Honors Lab 5: Polymerase Chain Reaction, Fall Semester 2008). In lane 2, the extra
band at the bottom of the gel is a primer dimer.
Figure 3:
This figure shows our plasmid construct map.
Figure 4: This figure shows how our gel should have turned out once we chose our restriction enzyme of NheI.
It shows the bands we should have had at 3558, 772, and 266.
Figure 5: This is the actual gel that we ran at the end of our experiment to see if the plasmid was inserted or not.
Discussion / Conclusions
Since it has been suggested that the RAD23 protein is useful in that it stabilizes
the XPC protein, it could also help further research in that field. It is thought that RAD23
is utilized in NER in order to repair lesions at the cellular level. By making numerous
replications of the gene, researchers will hopefully be able to understand the exact
function of the gene in repairing the lesions on the DNA. Through these labs, we were
attempting to store our DNA in plasmids in order to send it to other researchers for future
use. Our labs were okay until we made it to the cloning stage, when our gene did not
produce clones. We are not exactly sure why this happened, but it could possibly be due
to contamination or maybe other factors that we were not aware of. By doing this lab, I
learned a numerous amount of information about the RAD23 protein, which I had never
even heard of before. This lab also gave me a chance to do procedures in a lab setting
that I had never had a chance to perform before. Overall, the lab went very well.
References
1. Zhongwen Xie, Shuqian Liu, Yanbin Zhang, and Zhigang Wang. “Roles of Rad23
Protein in yeast nucleotide excision repair.” Nucleic Acids Research.
Vol. 32, No. 20. (2004) 5981-5990.
2. Feng Gong, Deirdre Fahy, and Michael J. Smerdon. “Rad4-Rad23 interaction
with SWI/SNF links ATP-dependent chromatin remodeling with
nucleotide excision repair.” Nature Structural & Molecular Biology.
Vol. 13, No. 10. (2006) 902-907.
3. BMS 110 Honors Lab Protocols. Labs 3-9. Fall Semester 2008.
4. BMS 110 Honors Restriction Enzyme Digest. Fall Semester 2008.