Table 1. Primers used in semi-quantitative RT

advertisement
Supplement Data
Analysis
of
Arabidopsis
genes
encoding
putative class III lipases
Wei Lia, Hua Lingb, Fei Zhangb, Hongyan Yaob, Xiaofen Suna, and Kexuan Tanga,b,*
a
State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Sciences,
Fudan-SJTU-Nottingham Plant Biotechnology R&D Center, Morgan-Tan International Center for
Life Sciences, Fudan-Manchester Bioinformatics Center, Fudan University, Shanghai 200433,
People’s Republic of China
b
Plant Biotechnology Research Center, Fudan-SJTU-Nottingham Plant Biotechnology R&D
Center, School of Agriculture and Biology, School of Life Science and Technology, Institute of
Systems Biology, Shanghai Jiao Tong University, Shanghai 200030, People’s Republic of China
*
Corresponding Author: Professor Kexuan Tang, State Key Laboratory of Genetic Engineering, School
of Life Sciences, Fudan University, Shanghai 200433, People’s Republic of China. Tel:
+86-21-65643552, Fax: +86-21-65643552, Email: [email protected]
Tables
Table 1. Primers used in semi-quantitative RT-PCR analysis.
Length
AGI No.
Forward Primer (5'-3')
Reverse Primer (5'-3')
(bp)
At3g14360 CTTATGGATTTGTGTGTGATGGCGT
TCCAAACGTGTAAACTCCAAGCAGC
594
At5g18640 CATTTCGGGGAACTCAAGAACACAG
CTCACCCATCAACTCCACTCCAAAG
614
At4g16820 GGCGGTGTGTGATGATCCGAGAGAG
ATGCGAGTAAGCCCATGGATTGTTC
604
At1g30370 GGATGGGCTTTGTAGCTGTGAGTGG
TTTAAGCTGCGTTCCGACATGCCTG
611
At4g18550 TAACAGACGACCAAGGCACGG
TTGTTCGTTCCTTGAGTCC
664
At3g07400 AGACCAGAGGGCAAGGTTCTTACGG
CGTTTCTTTTTCTGAGCAAGCCTAT
642
At4g16070 ATCTGGAAGGAGGAGGATTGTTAGG
TGAAACTAGGATTCTCATCAAGGGC
629
At5g37710 GGTAGAGAGTATGATTTGGTTTTTG
TGTGGGATATTAAGACTCACGGCTC
653
At1g05790 TCTTAGATGTGTTGTAATTGCTGTT
GGTATATTTGATCGTGTTGGCTTTC
680
At3g61680 TTAGCGATTCGTGGCTTGAACTTAG
CTTCTCTCTCAATATCTGCAATGCC
711
At5g09816 CAATCTACGAGGGGTATGCTCTTCC
AAGACTTCTTGACACAACCATAAGG
788
The expression profiles of ten selected genes were analyzed by using the
semi-quantative RT-PCR method. Actin encoded by At5g09816) served
internal control.
as an
Figure Legends
Figure 1. The locus distribution of 38 putative class III lipase genes in A. thaniala
chromosomes
by
using
Chromosome
(http://www.arabidopsis.org/jsp/Chromosome- Map/tool.jsp).
Map
Tool
Figure 1
Download