Supplemental Materials and Methods
Reagents
Gefitinib and cisplatin were obtained from Sigma-Aldrich (St. Louis, MO). Antibodies against CXCR4 and
nanog were obtained from Calbiochem (La Jolla, CA) and eBioscience (San Diego, CA), respectively.
Antibodies against Oct3/4 and CD133 were purchased from Novus (Littleton, CO). Antibodies against CD44,
cytokeratin18, c-myc and β-actin, and Bmi-1 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA)
and Milipore (Billerica, MA), respectively. Antibodies against phospho-Akt (S473 and T308), pshospho-STAT3
(Y705 and S727), phosphor-mToR (S2448), SDF-1α, musashi, and PTEN were obtained from Cell Signaling
Biotechnology (Denvers, MA). Neutralizing antibodies against CXCR4 and SDF-1α were purchased from R&D
systems (Minneapolis, MN) and Peprotech (Rocky Hill, NJ), respectively. Specific inhibitors of ERK1/2
(PD98059), PI3K (LY294002), STAT3 inhibitor III (WP1066), and Rapamycin were purchased from
Calbiochem. EGF and bFGF were obtained from R&D systems. AMD3100 was from Sigma. Phycoerithrin
(PE)-conjugated IgG was from abcam (Cambridge, MA). PE-conjugated antibodies against CXCR4 and
CXCR7 were purchased from R&D systems. PE-conjugated antibodies against CD24 and CD44 were from
Bectorn Dickeinson (Franklin Lakes, NJ). PE-conjugated antibodies against CD133, EpCAM and CD34 were
obtained from Miltenyi Biotech (Bergisch Gladbach, Germany). Alexa Fluor 488 goat anti-rabbit and Alexa
Fluor 594 goat antimouse IgGs were from Invitrogen (Carlsbad, CA). Recombinant SDF-1α protein was from
Bio Research Product (Valcourt, Quebec, Canada). Brefeldin A was purchased from Sigma-Aldrich.
Cell culture
Human non-small cell lung cancer cell lines (A549, H460, H596, H358, Calu-1, H441, and H1299) were
cultured in RPMI-1640 supplemented with 10% fetal bovine serum (FBS, JR Scientific, Inc., Woodland, CA)
and 1% penicillin/streptomycin and were maintained at 37℃ in a 5% CO2 incubator. A549/GR cells were
raised and cultured in the same medium as described previously (1).
Sphere-forming, limiting dilution and Matrigel clonogenic assays
For sphere-forming assay, a single cell suspension from trypsinization was cultured in DMEM/F12 (Cellgro,
Manassas, VA) with EGF and bFGF (10 ng/ml each) without serum at a density of 1 × 10 3 cells/ml. After 10
days, spheres were attached by adding FBS (10%), stained with Diff-quick solution (Sysmex, kobe, Japan), and
counted.
For limiting dilution assay, cells were trypsinized, diluted serially, and plated in 96culture medium used for sphere-forming assay. After 7 days of incubation, wells with or without spheres were
counted and plotted against the number of cells per well.
For Matrigel clonogenic assay, single cell suspensions (102 cells/ml) were obtained in 2 × DMEM/F12 with
EGF and bFGF (10 ng/ml each) without serum, resuspended in a same volume of growth factor-reduced
Matrigel (BD Biosciences) and plated into 24-well plates. After 14 days of incubation, colonies in five random
fields per each well were counted under a microscope.
Immunocytochemistry
Cells were seeded in chamber slide with RPMI-1640 supplemented with 10% FBS. Next day, cells were fixed
with 4% paraformaldehyde for 20 min and washed three times with PBS. After fixation, cells were incubated in
blocking solution (5% BSA and 0.5% Triton X-100 in PBS) for 1 h at room temperature. Cells were stained
with primary antibodies in blocking solution (1:100) for 2 h and washed three times with PBS. Staining were
visualized using Alexa Fluor 488 goat anti-rabbit and Alexa Fluor 594 goat anti-mouse (Invitrogen) secondary
antibodies (1:1000) for 1h. Nuclei were stained using Dapi and stained cells were viewed under a confocal laser
scanning microscope.
MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) assay
Cells were seeded in 96well (5 × 103 cells/well) plates and incubated at 37 °C under 5% CO2 incubator for 24 h.
The medium was replaced with 100 μl of DMEM containing 10% FBS with or without gefitinib and cisplatin
(Sigma) at the indicated concentrations. After 48 h incubation, wells were replaced with fresh medium (100
μl/well) and added the 20 μl of MTS solution and 1μl of PMS (phenazine methosulfate) in a each well followed
by incubated for 2 h at 37℃. After incubation, optical density was measured at 490 nm using plate reader
(BioRad, CA, California).
RT-PCR
RT-PCR was performed as described previously (Park CM et al., 2006). Oligonucleotide primer sequences used
were
as
follows:
CXCR4
forward:
AATCTTCCTGCCCACCATCT;
CXCR4
reverse:
GACGCCAACATAGACCACCT. SDF-1α forward: ATGAACGCCAAGGTCGTGGTC; SDF-1α reverse:
GGTCTGTTGTGCTTACTTGTTT. 18S RNA forward: AAACGGCTACCACATCCAAG; 18S RNA reverse:
CGCTCCCAAGATCCAACTAC.
ELISA
Cells were cultured in serum-free medium for 18 h and collected conditioned media. The amount of SDF1secreted from A549 and A549/GR was measured by SDF-1 ELISA kit according to the manufacturer’s
instruction (Wuhan EIAab Science Co., Guangguguoji, China).
Western blot analysis
Western blot analysis was performed according to the protocol as described previously except with some
modifications (2).
IR and drug treatment
For measuring IR and drug resistance, cells were seeded in 60 mm dishes (5 × 102), and were exposed to rays from a 137Cs -ray source [Atomic Energy of Canada, Korea Institute of Radiological and Medical
Sciences, Seoul, Korea] at a dose rate of 3.81 Gy/min or treated with gefitinib and cisplatin, respectively. After
7 days incubation, culture dishes were washed with PBS and were stained with 0.05% crystal violet containing
20% Methanol. After washing three times with distilled water, colonies were counted.
Supplemental References
1.
Rho JK, Choi YJ, Lee JK, Ryoo BY, Na II, Yang SH et al. Epithelial to mesenchymal transition derived
from repeated exposure to gefitinib determines the sensitivity to EGFR inhibitors in A549, a non-small cell
lung cancer cell line. Lung Cancer 2009; 63: 219-226.
2.
Park CM, Park MJ, Kwak HJ, Lee HC, Kim MS, Lee SH et al. Ionizing radiation enhances matrix
metalloproteinase-2 secretion and invasion of glioma cells through Src/epidermal growth factor receptormediated p38/Akt and phosphatidylinositol 3-kinase/Akt signaling pathways. Cancer Res 2006; 66: 85118519.